Composition for preventing or treating metabolic diseases comprising roasted citrus unshiu peel extract as an active ingredient
A composition containing roasted tangerine peel extract addresses the growing issue of metabolic diseases by inhibiting lipid accumulation and regulating gene expression, offering a safe and sustainable solution for weight reduction and disease prevention.
Patent Information
- Application Number
- PCT/KR2024/019534
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-08
- Filing Date
- 2024-12-03
- Publication Date
- 2025-06-12
AI Technical Summary
The rapid increase in metabolic diseases such as obesity, hyperlipidemia, hypertension, and diabetes, driven by changes in eating habits and reduced physical activity, necessitates the development of sustainable, safe, and effective methods for prevention and treatment.
A pharmaceutical and health functional food composition containing roasted tangerine peel extract as an effective ingredient, which inhibits lipid accumulation, reduces weight, and regulates gene expression related to lipolysis and β-oxidation, thereby addressing metabolic diseases including obesity.
The composition effectively inhibits lipid accumulation, reduces weight, and regulates gene expression related to lipolysis and β-oxidation, providing a safe and sustainable approach for preventing and treating metabolic diseases such as obesity.
Smart Images

Figure KR2024019534_12062025_PF_FP_ABST
Abstract
Description
Composition for preventing and treating metabolic diseases containing tangerine peel extract as an active ingredient
[0001] The present invention relates to a composition for preventing and treating metabolic diseases including obesity, containing a perilla peel extract as an active ingredient.
[0002] Recent economic development and changes in eating habits have led to a sharp increase in the incidence of metabolic diseases (metabolic syndromes), which include various conditions such as obesity, hyperlipidemia, hypertension, arteriosclerosis, hyperinsulinemia, diabetes, and liver disease. While these conditions can occur independently, they are often closely interrelated and often present with multiple symptoms.
[0003] In particular, the rising obesity rate in adults and children is a critical public health issue. The "World Obesity Atlas" report projects that the global obese population will exceed 1 billion by 2030. The number of obese patients is certain to continue to increase, and social costs, including medical expenses, due to obesity are also expected to increase exponentially. Severe obesity increases the risk of various metabolic diseases, such as hyperlipidemia, cardiovascular disease, diabetes, and non-alcoholic fatty liver disease. Therefore, reducing body fat is recognized as a critical public health issue beyond mere aesthetic considerations.
[0004] The expansion of adipose tissue, a key characteristic of obesity, is caused by a multifactorial process, including overnutrition due to unbalanced eating habits, reduced physical activity, and genetic factors. Obesity can develop and worsen through the differentiation of fibroblasts, such as pre-obesity cells, into mature adipocytes, leading to increased intracellular lipid accumulation. Therefore, obesity can be suppressed through factors such as inhibition of adipocyte differentiation, inhibition of intracellular lipid accumulation, and promotion of lipolysis, beta-oxidation, and thermogenesis.
[0005] Beyond the current primary methods for alleviating obesity—exercise, lifestyle interventions, and medications, including appetite suppressants—sustainable, safe, and effective methods for obesity prevention must be developed. Recent studies have examined whether bioactive ingredients in foods can inhibit fat production and promote lipolysis, contributing to obesity prevention and treatment. However, the effects of persimmon peel on metabolic diseases, including obesity, remain unknown.
[0006] Meanwhile, Citrus unshiu is a citrus fruit cultivated worldwide. Its sweet flavor is characteristic and consumed in countries such as Korea, China, and Japan. The fruit has been reported to be effective in reducing oxidative stress, vascular endothelial dysfunction, and inflammation. However, while some tangerine peels are used in teas and other products, most are discarded. Therefore, identifying the industrial benefits of tangerine peel could generate significant social and economic benefits.
[0007] Accordingly, the inventors of the present invention have confirmed the industrial and economic efficacy of tangerine peel, and have found that the roasted tangerine peel extract exhibits lipid accumulation inhibition and weight loss effects without cytotoxicity, reduces the expression of genes involved in lipogenesis and lipid synthesis, increases the expression of genes involved in lipolysis, and significantly increases the expression of genes related to β-oxidation and energy metabolism, and thus can be usefully used as an effective ingredient of a composition for preventing and treating metabolic diseases including obesity, thereby completing the present invention.
[0008] [Prior Art Literature]
[0009] [Patent Document]
[0010] Republic of Korea Publication Patent No. 10-2018-0031280
[0011] Republic of Korea Patent No. 10-1773956
[0012] The purpose of the present invention is to provide a composition for preventing and treating metabolic diseases including obesity, which contains an extract of Citrus unshiuPeel as an active ingredient.
[0013] In order to achieve the above objects, the present invention provides a pharmaceutical composition for preventing and treating metabolic diseases, comprising a Citrus unshiuPeel extract as an active ingredient; a use of the Citrus unshiuPeel extract for use in a pharmaceutical composition for preventing and treating metabolic diseases; a use of the Citrus unshiuPeel extract for preparing a pharmaceutical composition for preventing and treating metabolic diseases; and a method for preventing and treating metabolic diseases, comprising a step of administering to a subject a therapeutically effective amount of the Citrus unshiuPeel extract.
[0014] In addition, the present invention provides a health functional food for preventing and improving metabolic diseases, comprising a roasted tangerine peel extract as an active ingredient; a use of a roasted tangerine peel extract for use as a health functional food for preventing and improving metabolic diseases; a use of a roasted tangerine peel extract for manufacturing a health functional food for preventing and improving metabolic diseases; and a method for preventing and improving metabolic diseases, comprising a step of administering a roasted tangerine peel extract to a subject.
[0015] The Citrus unshiuPeel extract of the present invention exhibits lipid accumulation inhibition and weight loss effects without cytotoxicity, reduces the expression of genes involved in lipogenesis and lipid synthesis, increases the expression of genes involved in lipolysis, and significantly increases the expression of genes related to β-oxidation and energy metabolism, and therefore can be usefully used as an effective ingredient of a composition for preventing and treating metabolic diseases including obesity.
[0016] Figure 1 is a diagram confirming the lipid accumulation alleviation effect of the Citrus unshiupeel extract of the present invention in 3T3-L1 cells:
[0017] CON in Fig. 1A: Untreated control group of 3T3-L1 adipocyte precursor cells;
[0018] JRC of Fig. 1A: Group treated with the extract of the tangerine peel of the present invention;
[0019] Pre in Fig. 1B: 3T3-L1, a fat precursor cell;
[0020] CON in Fig. 1B: Untreated control group in differentiated 3T3-L1;
[0021] JRC: Group treated with the extract of the tangerine peel of the present invention to differentiated 3T3-L1;
[0022] ORL: Orlistat-treated group as a positive control group in differentiated 3T3-L1;
[0023] JRC 50: Group treated with 50 μg / mL of the dried tangerine peel extract of the present invention to differentiated 3T3-L1;
[0024] JRC 100: Group treated with 100 μg / mL of the dried tangerine peel extract of the present invention to differentiated 3T3-L1;
[0025] JRC 150: 150 μg / mL treatment group of the present invention on differentiated 3T3-L1; and
[0026] JRC 200: A group treated with 200 μg / mL of the dried tangerine peel extract of the present invention to differentiated 3T3-L1.
[0027] Figure 2 is a diagram confirming the effect of the dried tangerine peel extract of the present invention on adipocyte differentiation and lipid metabolism regulation in 3T3-L1 cells:
[0028] Pre: 3T3-L1, a fat precursor cell;
[0029] CON: untreated control group in differentiated 3T3-L1; and
[0030] JRC: Group treated with the extract of the tangerine peel of the present invention to differentiated 3T3-L1.
[0031] Figure 3 is a diagram confirming the effects of the dried tangerine peel extract of the present invention on weight loss and food intake reduction in an animal model:
[0032] CON: Animal model fed a standard diet;
[0033] HFD: High-fat diet-induced obesity animal model;
[0034] ORL: High-fat diet and orlistat treatment group as positive control group;
[0035] JRC-L: High-fat diet and tangerine peel extract treatment group of the present invention (30 mg / kg bodyweight);
[0036] JRC-M: high-fat diet and the present invention's roasted tangerine peel extract treatment group (60 mg / kg body weight); and
[0037] JRC-H: High-fat diet and tangerine peel extract treatment group of the present invention (120 mg / kg bodyweight).
[0038] Figure 4 is a diagram confirming the lipid accumulation alleviation effect of the tangerine peel extract of the present invention in an animal model:
[0039] The definitions of CON, HFD, ORL, JRC-L, JRC-M, and JRC-H are the same as in Fig. 3.
[0040] Figure 5 is a diagram confirming the serum biochemical index alleviation effect of the dried tangerine peel extract of the present invention in an animal model:
[0041] The definitions of CON, HFD, ORL, JRC-L, JRC-M, and JRC-H are the same as in Fig. 3.
[0042] Figures 6 and 7 are diagrams confirming the effects of the tangerine peel extract of the present invention on regulating fat cell differentiation, lipid metabolism, and energy metabolism in an animal model:
[0043] The definitions of CON, HFD, ORL, JRC-L, JRC-M, and JRC-H are the same as in Fig. 3.
[0044] Hereinafter, the present invention will be described in detail.
[0045] The present invention provides a pharmaceutical composition for preventing and treating metabolic diseases, comprising a roasted tangerine peel extract as an active ingredient; a use of the roasted tangerine peel extract for use in a pharmaceutical composition for preventing and treating metabolic diseases; a use of the roasted tangerine peel extract for preparing a pharmaceutical composition for preventing and treating metabolic diseases; and a method for preventing and treating metabolic diseases, comprising a step of administering to a subject a therapeutically effective amount of the roasted tangerine peel extract.
[0046] In the present invention, the tangerine peel may be the peel of Citrus unshiu.
[0047] In the present invention, the tangerine peel extract may be an ethanol extract, and preferably, the ethanol extract is extracted with 40% (v / v) to 60% (v / v) ethanol, and may have an extraction efficiency increased by 15% or more under the same conditions compared to at least one of a 20% (v / v) ethanol extract, an 80% (v / v) ethanol extract, or a 100% (v / v) ethanol extract.
[0048] In the present invention, the above-mentioned tangerine peel extract is preferably manufactured by a manufacturing method including the following steps, but is not limited thereto:
[0049] a) Drying step of tangerine peel;
[0050] b) Step of peeling dried tangerine peel;
[0051] c) a step of extracting the tangerine peel, discarding the extract, and obtaining the remaining residue; and
[0052] d) A step of extracting the obtained residue.
[0053] Specifically, it can be manufactured through a step of a) drying tangerine peel at 40°C to 70°C for 24 to 72 hours; b) roasting the dried tangerine peel at 130 to 300°C until the tangerine peel surface temperature becomes 130 to 170°C; c) extracting the roasted tangerine peel with hot water, then discarding the extract and obtaining the remaining residue; and d) extracting the obtained residue with 40% (v / v) to 60% (v / v) ethanol at 20°C to 90°C for 1 to 7 hours.
[0054] Step a) is a step for drying tangerine peel, which is a step for removing moisture in the tangerine peel to increase the extraction efficiency of the active ingredient. If the drying conditions are exceeded, it may not be easy to remove moisture in the tangerine peel or the tangerine peel may burn, so the above range is preferable.
[0055] Step b) is a step of roasting the dried tangerine peel, which is a step of roasting the tangerine peel at a specific temperature to improve the content of useful components. The roasting may be performed at 130 to 300°C until the tangerine peel surface temperature reaches 130 to 170°C, preferably at 150 to 270°C until the tangerine peel surface temperature reaches 130 to 160°C, more preferably at 200 to 270°C until the tangerine peel surface temperature reaches 130 to 160°C, and even more preferably at 220 to 270°C until the tangerine peel surface temperature reaches 140 to 160°C. If the roasting conditions are exceeded, the improvement in the content of useful components in the tangerine peel may be minimal or the tangerine peel may burn, so the above range is preferred.
[0056] Step c) is a step of extracting the roasted tangerine peel with hot water, discarding the extract, and obtaining the remaining residue. By extracting the roasted tangerine peel with hot water, glucose, etc. in the roasted tangerine peel can be removed, thereby improving the extraction efficiency of useful components, i.e., hesperidin.
[0057] Step d) is a step of extracting the roasted tangerine peel with ethanol, wherein the ethanol extract may be 40% (v / v) to 60% (v / v) ethanol, and preferably 50% (v / v) ethanol. If the concentration of the ethanol is outside the above range, the hesperidin content or the extraction efficiency of the roasted tangerine peel extract may decrease, so the above range is preferred.
[0058] In addition, the extraction can be carried out at 20°C to 90°C for 1 to 7 hours with 40% (v / v) to 60% (v / v) ethanol, preferably at 40°C to 90°C for 2 to 6 hours, more preferably at 40°C to 80°C for 2 to 5 hours, and even more preferably at 40°C to 60°C for 3 to 5 hours. If the extraction temperature is outside the above range, the hesperidin content or the extraction efficiency of the roasted tangerine peel extract may decrease, so the above range is preferred.
[0059] The above method may be repeated one or more times, preferably one to four times, more preferably one to two times.
[0060] More specifically, it is preferable that the above-mentioned tangerine peel extract is manufactured by a manufacturing method comprising the following steps:
[0061] a) A step of drying tangerine peel at 40℃ to 70℃ for 24 to 72 hours;
[0062] b) A step of roasting the dried tangerine peel until the surface temperature of the tangerine peel reaches 140°C to 160°C;
[0063] c) a step of extracting the peel of the tangerine with hot water, discarding the extract, and obtaining the remaining residue; and
[0064] d) A step of extracting the obtained residue with 40% (v / v) to 60% (v / v) ethanol at 40°C to 60°C for 3 to 5 hours.
[0065] The extraction efficiency and content of useful components of the tangerine peel extract manufactured by the above method are the best.
[0066] In the present invention, the roasted tangerine peel extract extracted according to the above extraction conditions is concentrated under reduced pressure at 50 to 70°C, and then mixed with 20 to 40 parts by weight of indigestible maltodextrin based on 100 parts by weight of the concentrated solid, and then manufactured into powder using a spray dryer, but is not limited thereto, and may be manufactured into powder using various methods widely known in the art.
[0067] In the present invention, the metabolic disease is preferably at least one selected from the group consisting of obesity, diabetes, dyslipidemia, hyperlipidemia, fatty liver, arteriosclerosis, stroke, hyperglycemia, insulin resistance disease, and hyperinsulinemia, but is not limited thereto.
[0068] In addition, it is preferable that the roasted tangerine peel extract of the present invention reduces the expression of genes involved in lipogenesis, and the genes involved in lipogenesis are preferably at least one selected from the group consisting of fatty acid synthase (FAS), diacylglycerol O-acyltransferase 1 (DGAT1), stearoyl-CoA 9-desaturase 1 (SCD1), and acetyl-CoA carboxylase (ACC), but are not limited thereto.
[0069] In addition, it is preferable that the roasted tangerine peel extract of the present invention increases the expression of a gene involved in lipolysis, and the gene involved in lipolysis is preferably hormone-sensitive lipase (HSL) or adipose triglyceride lipase (ATGL), but is not limited thereto.
[0070] In addition, it is preferable that the roasted tangerine peel extract of the present invention reduces the expression of genes involved in adipogenesis, and the genes involved in adipogenesis are preferably peroxisome proliferator activated receptor γ (PPARγ) or sterol regulatory element-binding protein-1c (SREBP-1c), but are not limited thereto.
[0071] In addition, the tangerine peel extract of the present invention is preferably, but not limited to, increasing the expression of genes related to β-oxidation and energy metabolism.
[0072] In addition, the roasted tangerine peel extract of the present invention significantly regulates biochemical indicators in serum related to obesity, and specifically, it is preferable to reduce at least one selected from the group consisting of alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), triglyceride (TG), total cholesterol (TC), and low-density cholesterol (LDL), and increase high-density cholesterol (HDL), but is not limited thereto.
[0073] In a specific embodiment of the present invention, the inventors prepared a roasted tangerine peel extract by roasting and then extracting Jeju tangerine peel (Citrus unshiuS. Markov. peel).
[0074] In addition, as a result of confirming the cytotoxicity of the roasted tangerine peel extract of the present invention, it was confirmed that the cell viability was not affected even in the group treated with a high concentration of the roasted tangerine peel extract (see Figure 1A).
[0075] In addition, in order to confirm the lipid accumulation inhibitory effect of the roasted tangerine peel extract of the present invention, the lipid accumulation effect was confirmed using preadipocytes (3T3-L1), and as a result, it was confirmed that the roasted tangerine peel extract significantly alleviated lipid accumulation (see Figures 1B and 1C).
[0076] In addition, the effects of the roasted tangerine peel extract of the present invention on adipocyte differentiation and lipid metabolism regulation were confirmed using preadipocytes, and it was confirmed that the roasted tangerine peel extract of the present invention reduces the expression of genes involved in adipogenesis and lipogenesis, and increases the expression of genes involved in lipolysis (see Fig. 2).
[0077] In addition, as a result of confirming the weight reduction effect of the roasted tangerine peel extract of the present invention in an obese animal model, it was confirmed that the roasted tangerine peel extract of the present invention not only significantly reduces body weight but also significantly reduces food intake (see Fig. 3).
[0078] In addition, in order to confirm the lipid accumulation alleviation effect of the persimmon peel extract of the present invention in an obese animal model, body composition analysis and histopathological analysis of fat tissue were performed, and it was confirmed that the persimmon peel extract of the present invention reduces fat mass in a concentration-dependent manner (see Fig. 4).
[0079] In addition, as a result of confirming the effect of the roasted tangerine peel extract of the present invention on alleviating serum biochemical indicators in an obese animal model, it was confirmed that the roasted tangerine peel extract of the present invention reduces alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), triglyceride (TG), total cholesterol (TC), and low-density cholesterol (LDL), and increases high-density cholesterol (HDL) (see Fig. 5).
[0080] In addition, as a result of confirming the effects of the roasted tangerine peel extract of the present invention on regulating adipocyte differentiation, lipid metabolism, and energy metabolism in animal cells, it was confirmed that in animal cells, it also reduced the expression of genes involved in fat formation and lipid synthesis, increased the expression of genes involved in lipolysis, and increased the expression of genes related to β-oxidation and energy metabolism (see Figures 6 and 7).
[0081] Therefore, the roasted tangerine peel extract of the present invention exhibits lipid accumulation inhibition and weight loss effects without cytotoxicity, reduces the expression of genes involved in lipogenesis and lipid synthesis, increases the expression of genes involved in lipolysis, and significantly increases the expression of genes related to β-oxidation and energy metabolism, and thus can be usefully used as an effective ingredient of a composition for preventing and treating metabolic diseases including obesity.
[0082] The pharmaceutical composition may be administered to adults once or several times a day at a dosage of 0.01 to 500 mg / kg, specifically 0.1 to 200 mg / kg, more specifically 0.1 to 100 mg / kg, even more specifically 0.1 to 20 mg / kg, and even more specifically 1 to 10 mg / kg, 1 to 3 times a day, and the formulated unit dosage form may be administered several times at regular time intervals as needed.
[0083] In addition, the pharmaceutical composition may further comprise pharmaceutically acceptable carriers and vehicles. Specifically, the pharmaceutical composition may include, but is not limited to, ion exchange resins, alumina, aluminum stearate, lecithin, serum proteins (e.g., human serum albumin), buffer substances (e.g., various phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids), water, salts or electrolytes (e.g., protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride and zinc salts), colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substrates, polyethylene glycol, sodium carboxymethylcellulose, polyarylates, waxes or wool fats.
[0084] The composition comprising a pharmaceutically acceptable carrier and vehicle may be administered orally or parenterally in various dosage forms. When formulated, it is prepared using commonly used diluents or excipients, such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.
[0085] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations can be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, calcium carbonate, gelatin, etc., with the pharmaceutical composition of the present invention. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used.
[0086] Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives.
[0087] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin butter, and glycerogelatin.
[0088] The above pharmaceutical composition may have any one dosage form selected from the group consisting of tablets, pills, powders, granules, coated tablets, capsules, suspensions, liquids, emulsions, syrups, juices, sterilized aqueous solutions, non-aqueous solutions, injections, lyophilized preparations, and suppositories.
[0089] The above pharmaceutical composition can be administered to mammals such as rats, mice, livestock, and humans via various routes. All modes of administration are conceivable, including oral, rectal, intravenous, intramuscular, subcutaneous, or intracerebrovascular injection.
[0090] The dosage of the pharmaceutical composition according to the present invention can be adjusted according to various factors including the purpose of administration, type of disease, severity of disease, type and content of the active ingredient and other ingredients contained in the composition, type of formulation, and the patient's age, weight, general health, sex and diet, time of administration, route of administration and secretion rate of the composition, treatment period, and concurrently used drugs.
[0091] In addition, the present invention provides a health functional food for preventing and improving metabolic diseases, comprising a roasted tangerine peel extract as an active ingredient; a use of a roasted tangerine peel extract for use as a health functional food for preventing and improving metabolic diseases; a use of a roasted tangerine peel extract for manufacturing a health functional food for preventing and improving metabolic diseases; and a method for preventing and improving metabolic diseases, comprising a step of administering a roasted tangerine peel extract to a subject.
[0092] When the roasted tangerine peel extract of the present invention is used as a health functional food, the extract can be added as is or used together with other foods or food ingredients, and can be used appropriately according to a conventional method. The roasted tangerine peel is preferably extracted using hot water and ethanol, and the concentration of the ethanol is preferably 50% to 70%. The amount of the active ingredient mixed can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount can be below the above range, and since there is no problem in terms of safety, the active ingredient can also be used in an amount above the above range.
[0093] There is no particular limitation on the type of the above food. Examples of foods to which the roasted tangerine peel extract of the present invention can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all health foods in the conventional sense.
[0094] The health beverage composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages. Natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 ml of the roasted tangerine peel extract of the present invention.
[0095] In addition to the above, the roasted tangerine peel extract of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the roasted tangerine peel extract of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients may be used independently or in combination.
[0096] Hereinafter, the present invention will be described in detail through examples and experimental examples.
[0097] However, the following examples and experimental examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples and experimental examples.
[0098] <Example 1> Preparation of experimental materials
[0099] <1-1> Preparation of dried tangerine peel extract
[0100] The roasted tangerine peel extract of the present invention was manufactured using a method with excellent hesperidin content and extraction efficiency described in Republic of Korea Application No. 10-2022-0173343, and was provided by J&J Bio Healthcare Co. Ltd. (Hanam, South Korea) and used, and stored at -20°C for subsequent experiments.
[0101] Specifically, to produce a roasted tangerine peel extract, tangerines (Citrus unshiu) were washed in running water, the peel was removed, and dried using a hot air dryer at 60°C for 48 hours. Thereafter, roasting was performed using a roaster equipped with a temperature sensor at a temperature of 220 to 270°C while rotating at 90 to 100 rpm until the surface temperature of the tangerine peel reached 130 to 160°C, thereby producing a roasted tangerine peel.
[0102] 100 kg of roasted tangerine peel was added with 1,000 L of water and extracted at 100°C for 4 hours. The extract was discarded and the residue remaining after extraction was obtained. 10 times the volume of 40% (v / v) to 100% (v / v) ethanol was added to the residue, and extraction was performed at 40°C to 90°C for 2 to 5 hours. The same process was repeated 1 to 2 times to obtain an extract. The extract was concentrated under reduced pressure at 60°C, and 30 parts by weight of resistant maltodextrin was mixed with 100 parts by weight of the concentrated solid, and then a spray dryer (Inlet temp. 190±10°C / Outlet temp. 95±10°C) was used to obtain a powdered roasted tangerine peel extract.
[0103] <1-2> Preparation of experimental equipment and reagents
[0104] Newborn calf serum (NCS), fetal bovine serum (FBS), Dulbecco's modified eagle's medium (DMEM), penicillin-streptomycin (PS), and insulin used in the experiments of the present invention were purchased from Gibco BRL (Grand Island, NY, USA). 2,3-Bis-(2-Methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT), phenazine methosulfate (PMS), Oil Red O, orlistat (ORL) as a positive control, 3-isobutyl-1-methylxanthine (IBMX), and dexamethasone were purchased from Sigma-Aldrich Chemical Co (St. Louis, MO). TRIzol™ reagent was purchased from Thermo Fisher (MA, USA), and iScript™ cDNA synthesis kit and iQ SYBR Green supermix were purchased from Bio-Rad Laboratories (CA, USA).
[0105] <Example 2> Cell culture
[0106] 3T3-L1, the mouse adipose precursor cells used in the present invention, were purchased from the American Type culture collection (Manassas, VA, USA).
[0107] Cells were cultured in DMEM containing 10% NCS and 1% PS at 37°C in a 5% CO2 environment. 3T3-L1 were cultured for 3 days in DMEM containing 0.5 mM IBMX, 10 μg / mL insulin, 1 μM dexamethasone, 10% FBS, and 1% PS, and differentiated by culturing for 3 days in DMEM containing 10 μg / mL insulin, 10% FBS, and 1% PS, and 2-3 days in DMEM containing 10% FBS and 1% PS. Then, the differentiated 3T3-L1 were treated with JRC and ORL for 72 hours.
[0108] <Example 3> Statistical processing
[0109] All data of the present invention were analyzed using SPSS (Statistical Package for the Social Sciences, version 27.0, SPSS Inc., Chicago, USA) and expressed as mean ± SD for in vitro and mean ± SE for in vivo. Statistical analysis between various groups was performed using one-way ANOVA and verified using Duncan's multiple range test, and a confidence interval >0.95 was indicated as a significant difference.
[0110] <Experimental Example 1> Confirmation of lipid accumulation inhibition effect
[0111] <1-1> Confirmation of cytotoxicity
[0112] In order to confirm the lipid accumulation inhibitory effect of the roasted tangerine peel extract of the present invention in 3T3-L1 mature adipocytes, the cytotoxicity of the roasted tangerine peel extract of the present invention was first confirmed.
[0113] Specifically, cytotoxicity was performed using XTT reagent. 3T3-L1 cells were seeded at 0.5 × 10 in a 96-well cell culture plate. 4After dispensing cells / well, extracts were dispensed for 72 hours when 70% confluency was reached. XTT was dissolved in phenol red-free DMEM, and PMS solution was added at a ratio of 800:1 and dispensed into each well. After incubation for 2 hours at 37°C in a 5% CO2 environment, absorbance was measured at 450 nm.
[0114] As a result, as shown in Fig. 1A, it was confirmed that the cell viability of the dried tangerine peel extract of the present invention did not show a significant difference at 0-500 μg / mL (Fig. 1A).
[0115] Therefore, the following experiment was conducted with 0 to 200 μg / mL JRC, which did not show cytotoxicity, and 25 μg / mL of orlistat was used as the positive control group.
[0116] <1-2> Confirmation of lipid accumulation inhibition effect using oil red o staining
[0117] After differentiating 3T3-L1 cells as in <Example 2> above, the effect of inhibiting lipid accumulation was confirmed after treating JRC and ORL for 72 hours.
[0118] Specifically, the Oil Red O reagent was dissolved in isopropanol for 24 hours and then filtered. The filtered solution was mixed with water in a 6:4 ratio for 24 hours and then filtered to prepare an Oil Red O working solution. After rinsing each well with PBS, the cells were fixed for 30 minutes with 10% formalin. After rinsing twice with PBS, the Oil Red O working solution was added and stained for 1 hour. After rinsing twice with PBS, the degree of staining was observed under an optical microscope with PBS remaining. After completely removing the PBS, isopropanol was added, the stained reagent was dissolved again, and the absorbance was measured at 510 nm.
[0119] As a result, as shown in Figures 1B and 1C, the results of oil red o staining confirmed that the roasted tangerine peel extract of the present invention significantly reduced lipid accumulation by 100 to 200 μg / mL compared to the control group (CON) (Figure 1B). In addition, when looking at the images stained with oil red o, it was confirmed that lipid accumulation was significantly alleviated in the groups treated with ORL and JRC (Figure 1C).
[0120] <Experimental Example 2> Confirmation of the effects of regulating adipocyte differentiation and lipid metabolism.
[0121] Intracellular lipid accumulation can be regulated by adipocyte differentiation, lipogenesis, and lipolysis. In this <Experimental Example 2>, we confirmed the expression of mRNAs related to lipogenesis, adipogenesis, and lipolysis in 3T3-L1 mature adipocytes.
[0122] Specifically, total RNA was extracted from mature adipocytes using Trizol. The concentration was measured using a Nanodrop, and stable cDNA was synthesized using the iScript™ cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). Real-time PCR (RT-PCR) was then performed using the SYBR green RT-PCR kit and designed primers. β-actin was used as a housekeeping gene to ensure consistent interpretation of the data. The primers used are listed in [Table 1].
[0123] As a result, as shown in Fig. 2, it was confirmed that the expression of peroxisome proliferator activated receptor γ (PPARγ) involved in lipogenesis was significantly reduced in the group treated with 150-200 μg / mL of the roasted tangerine peel extract of the present invention (Fig. 2A). In addition, it was confirmed that the expression of fatty acid synthase (FAS) involved in lipid synthesis was concentration-dependently alleviated in the group treated with 150-200 μg / mL of the roasted tangerine peel extract of the present invention compared to the control group (CON) (Fig. 2B). In addition, it was confirmed that the expression of hormone-sensitive lipase (HSL) involved in lipolysis was significantly increased in all groups treated with the roasted tangerine peel extract of the present invention compared to CON (Fig. 2C).
[0124] Primer sequence (5'→3') SEQ ID NO:PPARγForwardGGTGAAACTCTGGGAGATTC1ReverseCAACCATTGGGTCAGCTCTT2FASForwardGAAGTGTCTGGACTGTGTCATTTTTAC3ReverseTTAATTGTGGGA TCAGGAGAGCAT4HSLForwardGCTGGGCTGTCAAGCACTGT5ReverseGTAACTGGGTAGGCTGCCAT6β-ActinForwardAGCCATGTACGTAGCCATCC7ReverseCTCTCAGCTGTGGTGGTGAA8
[0125] <Experimental Example 3> Confirmation of weight loss effect in an obese animal model.
[0126] All experiments performed in the present invention were approved by the Institutional Animal Care and Use Committee of Chonnam National University (Approval Number: CNU IACUC-YB-2023-98).
[0127] Specifically, 4-week-old C57BL / 6N mice were purchased from Orient Bio (Seongnam, South Korea) and maintained in a house with a humidity of 40-60%, a temperature of 20-24℃, and a 12-h light-dark cycle. After a one-week adaptation period to the room environment, they were divided into six groups: a control group (CON) fed a regular diet ad libitum, a HFD group fed only a high-fat diet, and four groups fed a HFD plus ORL or JRC (n=10 or 12). The mice were administered ORL (30 mg / kg body weight) or JRC (30, 60, or 120 mg / kg body weight) dissolved in water orally daily for 8 weeks. Water was provided ad libitum and AIN-93G (standard diet) or a 60% Kcal HFD (high-fat diet) was provided. The body weight and food intake of mice were measured twice a week, and the mice were dissected after fasting for 16 hours.
[0128] As a result, as shown in Fig. 3, compared to the control group that consumed a normal diet for 8 weeks, the body weight significantly increased in the HFD group that consumed a high-fat diet, and the ORL group, which is a positive control group, significantly decreased in body weight. In addition, compared to the HFD group, it was confirmed that the body weight decreased in a concentration-dependent manner in the JRC-L (30 mg / kg body weight), JRC-M (60 mg / kg body weight), and JRC-H (120 mg / kg body weight) groups of the present invention (Fig. 3A). In addition, when the food intake for 8 weeks was confirmed, it was confirmed that the food intake significantly decreased in the ORL, JRC-L, JRC-M, and JRC-H groups compared to the HFD group (Fig. 3B).
[0129] <Experimental Example 4> Confirmation of lipid accumulation mitigation effect in an obese animal model.
[0130] In order to confirm the lipid accumulation alleviation effect of the tangerine peel extract of the present invention in an obese animal model, body composition analysis using dual energy x-ray absorptiometry (DXA) and histopathological analysis of adipose tissue were performed.
[0131] Specifically, mice that consumed the general diet, high-fat diet, high-fat diet, and the perilla peel extract of the present invention for 8 weeks in the above <Experimental Example 3> were anesthetized with CO2 and isoflurane, and then the body composition was measured using iNSiGHT DXA (osteosis, South Korea).
[0132] Additionally, for histological image analysis, adipose tissue was dissected and fixed in a 10% formalin solution. After dehydration with xylene, it was embedded in paraffin solution. Sections cut at 10 μm were stained with hematoxylin and eosin and observed under an optical microscope.
[0133] As a result, as shown in Fig. 4, it was visually confirmed through radiography using DXA and histological images of adipose tissue that the amount of fat, which had significantly increased in the HFD group, decreased in a concentration-dependent manner in the JRC treatment group (Fig. 4A). In addition, it was confirmed that the amount of fat analyzed by DXA significantly decreased in the JRC-M and JRC-H groups, and that testicular fat and renal fat significantly decreased in the JRC-M and JRC-H groups (Figs. 4B and 4C).
[0134] <Experimental Example 5> Confirmation of the effect of alleviating serum biochemical indicators in an obese animal model.
[0135] In order to confirm the effect of the roasted tangerine peel extract of the present invention on alleviating serum biochemical indices in an obese animal model, blood collected from mice was centrifuged at 5000 rpm, 4℃, for 10 minutes to separate serum and stored at -80℃ until the experiment. Aspartate aminotransferase (AST), alanine aminotransferase (ALT), triglyceride (TG), total cholesterol (TC), and high-density cholesterol (HDL) were measured using commercially available kits from Asan, and gamma-glutamyl transferase (GGT) was measured using a colorimetric assay kit (abcam, ab241029, United kingdom). Additionally, low-density cholesterol (LDL) was calculated using the Friedewald formula.
[0136] As a result, as shown in Fig. 5, in the HFD group, AST, ALT, GGT, TG, TC, and LDL were dramatically higher than in the control (CON) group, and HDL was confirmed to be lower. In addition, it was confirmed that ALT, AST, and GGT were significantly reduced in the JRC-M and JRC-H groups (Fig. 5A). In addition, it was confirmed that TG, TC, and LDL were significantly reduced in the JRC-M and JRC-H treatment groups, and HDL was significantly increased in JRC-M and JRC-H (Fig. 5B).
[0137] <Experimental Example 6> Confirmation of the effects of regulating adipocyte differentiation, lipid metabolism, and energy metabolism in animal cells isolated from obese animals.
[0138] The molecular pathway of the effect of the tangerine peel extract of the present invention on adipocytes was confirmed by checking the mRNA expression level.
[0139] As with the cell model of the above <Experimental Example 2>, the expression levels of genes related to adipocyte differentiation, lipid synthesis, and lipolysis were measured, and genes related to energy metabolism related to body fat accumulation were also measured.
[0140] As a result, as shown in Figs. 6 and 7, sterol regulatory element-binding protein-1c (SREBP-1c) and PPARγ, which are related to lipogenesis in adipocytes, were significantly decreased in all JRC treatment groups compared to the HFD group (Fig. 6A). FAS, diacylglycerol O-acyltransferase 1 (DGAT1), and stearoyl-CoA 9-desaturase 1 (SCD1), which are related to lipid synthesis, were significantly decreased in the JRC-M and JRC-H groups, and acetyl-CoA carboxylase (ACC) was significantly decreased in all JRC treatment groups (Fig. 6B). In addition, lipolytic enzymes related to lipolysis, HSL and adipose triglyceride lipase (ATGL), were significantly increased in the JRC-M and JRC-H groups compared to the HFD group, and PPARα and carnitine palmitoyltransferase I (CPT-1), which are related to β-oxidation, were significantly increased in the JRC-M and JRC-H groups (Fig. 7A). In addition, AMP-activated protein kinase (AMPK), peroxisome proliferator-activated receptor gamma coactivator 1-α (PGC-1α), and uncoupling protein (UCP), which are related to energy metabolism, were significantly increased in the JRC-M and JRC-H groups (Fig. 7B).
[0141] Primer sequence (5'→3') Sequence number SREBP-1c Forward TGGCTTGGTGATGCTATGTTG9 Reverse GACCATCAAGGCCCCTCAA10 β-Actin Forward AGCCATGTACGTAGCCATCC7 Reverse CTCTCAGCTGTGGTGGTGAA8
[0142]
[0143] The roasted tangerine peel extract of the present invention exhibits lipid accumulation inhibition and weight loss effects without cytotoxicity, reduces the expression of genes involved in lipogenesis and lipid synthesis, increases the expression of genes involved in lipolysis, and significantly increases the expression of genes related to β-oxidation and energy metabolism, and therefore can be usefully used as an effective ingredient of a composition for preventing and treating metabolic diseases including obesity.
Claims
1. A pharmaceutical composition for preventing and treating metabolic diseases containing tangerine peel extract as an effective ingredient.
2. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that in claim 1, the tangerine peel is roasted until the surface temperature of the tangerine peel reaches 130°C to 170°C.
3. In paragraph 1, the extract contains water, C 1 Inland C 2 A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that it is extracted with lower alcohol or a mixture thereof.
4. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that in paragraph 1, the metabolic disease is at least one selected from the group consisting of obesity, diabetes, dyslipidemia, hyperlipidemia, fatty liver, arteriosclerosis, stroke, hyperglycemia, insulin resistance disease, and hyperinsulinemia.
5. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that the dried tangerine peel extract of paragraph 1 reduces the expression of genes involved in lipogenesis.
6. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that in paragraph 5, the gene involved in lipid synthesis is at least one selected from the group consisting of fatty acid synthase (FAS), diacylglycerol O-acyltransferase 1 (DGAT1), stearoyl-CoA 9-desaturase 1 (SCD1), and acetyl-CoA carboxylase (ACC).
7. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that the dried tangerine peel extract of paragraph 1 increases the expression of genes involved in lipolysis.
8. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that in paragraph 7, the gene involved in lipolysis is hormone-sensitive lipase (HSL) or adipose triglyceride lipase (ATGL).
9. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that the dried tangerine peel extract of paragraph 1 reduces the expression of genes involved in adipogenesis.
10. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that the gene involved in lipogenesis in claim 9 is peroxisome proliferator activated receptor γ (PPARγ) or sterol regulatory element-binding protein-1c (SREBP-1c).
11. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that the dried tangerine peel extract of claim 1 reduces at least one enzyme selected from the group consisting of alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), triglyceride (TG), total cholesterol (TC), and low-density cholesterol (LDL).
12. A pharmaceutical composition for preventing and treating metabolic diseases, characterized in that the dried tangerine peel extract of claim 1 increases high-density cholesterol (HDL).
13. Health functional food containing tangerine peel extract as an effective ingredient for preventing and improving metabolic diseases.
14. A health functional food for preventing and improving metabolic diseases, characterized in that in claim 13, the metabolic disease is at least one selected from the group consisting of obesity, diabetes, dyslipidemia, hyperlipidemia, fatty liver, arteriosclerosis, stroke, hyperglycemia, insulin resistance disease, and hyperinsulinemia.
15. A method for preventing and treating metabolic diseases, comprising a step of administering a therapeutically effective amount of a tangerine peel extract to a subject.
16. A method for preventing and improving metabolic diseases, comprising a step of administering a tangerine peel extract to a subject.
17. Use of a dried tangerine peel extract as a pharmaceutical composition for preventing and treating metabolic diseases.
18. Use of dried tangerine peel extract as a health functional food for preventing and improving metabolic diseases.
19. Use of a dried tangerine peel extract for preparing a pharmaceutical composition for preventing and treating metabolic diseases.
20. Use of dried tangerine peel extract for manufacturing health functional food for preventing and improving metabolic diseases.
Citation Information
Patent Citations
A Composition comprising an extract of fermented or non-fermented Lonicerae Flos and Citri Reticulatae Pericarpium for treating or preventing obesity
KR101344189B1
The manufacturing method of dried citrus unshiu peeltea using organic citrus unshiu
KR1020050051619A
Composition for improvement of fatty liver
KR1020090043758A
Tea making method and tea to be made in a making method
KR1020100012282A