Strain for producing itaconic acid with high efficiency through acetic acid adaptive evolution and use thereof

Abstract

The present invention relates to: the development of a strain for efficiently producing itaconic acid by introducing an itaconic acid-specific biosensor into an E coli W strain, and culturing the strain in an environment that contains acetic acid and inducing adaptive evolution; and a use thereof. Specifically, the evolved strain, which improves the productivity of the high value-added product itaconic acid by efficiently metabolizing the undesired sugar acetic acid, can be economically and efficiently utilized in various industrial fields in which itaconic acid is utilized.

Description

High-efficiency itaconic acid production strain through acetic acid adaptive evolution and its use

[0001] The present invention relates to the development of a strain that efficiently produces itaconic acid by culturing an Escherichia coli W strain that has an itaconic acid-specific biosensor in an environment containing acetic acid and inducing adaptive evolution, and to its use.

[0002] Itaconic acid is a five-carbon dicarboxylic acid. Its structural properties make it a valuable precursor for the synthesis of various polymers, including plastics and latex, and therefore hold significant industrial value. Consequently, in 2004, it was selected as one of the Top 12 bio-based platform chemicals by the United States Department of Energy.

[0003] Previous studies have focused on producing itaconic acid using the fungus Aspergillus terreus, using its preferred sugars, glucose and glycerol, as carbon sources. However, the fermentation process is complex and expensive due to the strain's specific characteristics. Recently, several attempts have been reported to produce itaconic acid from various carbon sources using Corynebacterium glutamicum or Escherichia coli, replacing difficult-to-ferment fungi.

[0004] In biological production using microorganisms, the use of preferred sugars as the main carbon source leads to an increase in process costs due to the price of raw materials, which has the limitation of being very low in price competitiveness compared to the process cost of producing itaconic acid from petroleum resources.

[0005] Additionally, although the fungal strain A. terreus has high itaconic acid productivity, it is very difficult to cultivate and manipulate its genome over a long period of time, making it unsuitable for long-term itaconic acid production in various environments.

[0006] In order to solve the above problems, the inventors of the present invention were able to obtain a strain capable of high production of itaconic acid from acetic acid while studying acetic acid, which is a non-preferred sugar but is obtained in abundance as a by-product in various processes, and through optimization of the itaconic acid production pathway and exploration of genes whose functions are unknown, they identified genes that are helpful in the production of organic acids such as itaconic acid, thereby completing the present invention.

[0007] The present invention provides a method for screening an itaconic acid-producing strain with increased productivity through adaptive evolution of a microbial metabolic circuit necessary for efficient metabolism of a carbon source and high production of a target substance, a strain isolated from the method, and a use thereof.

[0008] According to one embodiment of the present invention, a method for screening a high itaconic acid producing strain is provided, comprising: (a) introducing an itaconic acid biosensor into a strain; (b) repeatedly culturing the strain into which the itaconic acid biosensor of step (a) has been introduced in a medium containing acetic acid to induce evolution; (c) evaluating the itaconic acid productivity of the strains in which evolution has been induced according to step (b); (d) selecting a high itaconic acid producing strain; and (e) performing a genome analysis on the high itaconic acid producing strain selected in step (d) and comparing it with an existing strain.

[0009] According to another embodiment of the present invention, a high-producing itaconic acid strain screened by the method of the present invention is provided.

[0010] According to another embodiment of the present invention, a method for producing itaconic acid is provided, comprising a step of culturing an itaconic acid high-producing strain screened according to the method of the present invention in a medium containing acetic acid.

[0011] A strain screening method according to one embodiment of the present invention can select a strain capable of high production of itaconic acid from acetic acid, a non-preferred sugar.

[0012] In addition, by optimizing the itaconic acid production pathway and exploring genes whose functions are unknown, it is possible to identify genes that are helpful in the production of organic acids such as itaconic acid, and itaconic acid, a high value-added product, can be produced more efficiently from acetic acid, a non-preferred sugar but a by-product obtained in large quantities in various processes, so that itaconic acid can be utilized in various industrial fields such as synthetic resins, latex, and food additives where itaconic acid is utilized, and thus can be useful in alleviating environmental problems that are becoming more serious day by day.

[0013] Figure 1 is a schematic diagram showing the adaptation and evolution process of E. coli W strain introducing an itaconic acid biosensor through the adaptive laboratory evolution (ALE) technique.

[0014] Figure 2 is a diagram showing the culture profiles of the evolved strains (ALE strains) WCS3, WCS6, WCS19, and WCS23 compared to the WCS0 strain (Parental strain).

[0015] Figure 3 is a diagram showing the results of comparing the itaconic acid titer, specific growth rate, and yield of the evolved strains (ALE strains) WCS3, WCS6, WCS19, and WCS23 compared to the WCS0 strain (Parental strain).

[0016] Figure 4 is a diagram showing the results of comparing the genome sequences between the parental strain and the ALE strain through whole genome sequencing and confirming mutations in the genome.

[0017] Figure 5 is a diagram showing various genetic changes related to the stringent response through genetic analysis of the WCS19 strain.

[0018] Figure 6 is a diagram showing the results of comparing the itaconic acid titer, specific growth rate, and yield of the WCF1, WCF2, and WCF3 strains with the WC0 and WC19 strains.

[0019] Figure 7 is a diagram showing the results of comparing the itaconic acid titer, specific growth rate, and yield of the WCD6, WCD7, WCD67, WC19M7, and WC19M67 strains with the WC0 and WC19 strains.

[0020] Figure 8 is a diagram showing the results of comparing the culture profiles of the WCD and WCD67 strains with the WC0 and WC19 strains.

[0021] Hereinafter, the present invention will be described in detail by way of examples to explain in more detail.

[0022] However, the following examples are illustrative only and the scope of the present invention is not limited thereto, and unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the present invention belongs.

[0023] In addition, when describing the present invention, if it is determined that a detailed description of a related known technology may unnecessarily obscure the gist of the present invention, the detailed description is omitted.

[0024]

[0025] According to one embodiment of the present invention, a method for screening a high itaconic acid producing strain is provided, comprising: (a) introducing an itaconic acid biosensor into a strain; (b) repeatedly culturing the strain into which the itaconic acid biosensor of step (a) has been introduced in a medium containing acetic acid to induce evolution; (c) evaluating the itaconic acid productivity of the strains in which evolution has been induced according to step (b); and (d) selecting a high itaconic acid producing strain.

[0026] In the present invention, the biosensor can be introduced into the strain in the form of a “plasmid”, a “vector”, a “recombinant plasmid”, and a “recombinant vector”.

[0027] The above “introduction” means introducing a gene of a desired blood type into a strain, and may be done by the method of “transformation.”

[0028] The term "vector" as used above refers to a self-replicating DNA molecule used to transport a clone gene (or other fragment of clone DNA). In the present invention, an "expression vector" refers to a recombinant DNA molecule containing a desired coding sequence and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked to the sequence in a specific host organism. The expression vector may preferably include one or more selectable markers. The markers are nucleic acid sequences having characteristics that can be selected, typically by chemical methods, and include any genes that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, antibiotic resistance genes such as ampicillin, kanamycin, geneticin (G418), bleomycin, hygromycin, and chloramphenicol, and can be appropriately selected by those skilled in the art.

[0029] The term "recombinant vector" as used herein refers to a type of expression vector that is a recombinant plasmid capable of expressing a target peptide in a suitable host cell, and includes essential regulatory elements operably linked to enable expression of the inserted target gene. The recombinant vector of the present invention may include expression regulatory elements such as a promoter, an operator, an initiation codon, and a termination codon, which are elements included in conventional recombinant vectors. The initiation codon and termination codon are generally considered to be part of the nucleotide sequence encoding the polypeptide, and must be functional when the recombinant vector is introduced into a host cell and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

[0030] The term "transformation" as used above means any act that causes genetically stable inheritance so that the recombinant vector fragment moves into the genome of a host cell and can express the desired peptide. Any transformation method can be used for the transformation method of the present invention, and can be easily performed according to a conventional method in the art. Common transformation methods include the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing substance called DMSO (dimethyl sulfoxide) in the CaCl2 method, electroporation, calcium phosphate precipitation method, protoplast fusion method, stirring method using silicon carbide fiber, Agrobacterium-mediated transformation method, transformation method using PEG, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation methods.

[0031] In the present invention, the strain of step 1) may be characterized as being an E. coli W strain, and the E. coli W strain is a general E. coli strain, meaning a wild type or wild type, and means an E. coli W strain with accession number ATCC 9637.

[0032] In the present invention, the itaconic acid biosensor of step 1) may be characterized by including an itcR gene represented by sequence number 2 linked to a J23106 promoter represented by sequence number 1 and a tetA gene represented by sequence number 4 linked to a Pccl promoter represented by sequence number 3.

[0033] In the present invention, the strain into which the itaconic acid biosensor of step 1) is introduced may be characterized in that when itaconic acid productivity increases, expression of a tetracycline resistance gene is promoted.

[0034] In the present invention, the repeated culture of step 2) may be performed 1 to 25 times.

[0035] In the present invention, the step of inducing evolution in step 2) may be characterized in that it is performed in the direction of increasing the expression of a tetracycline resistance gene in the medium or increasing the productivity of itaconic acid, and evolution can be induced through repeated culture.

[0036] For example, repeated culture can be performed by diluting and culturing in a new medium when the optical density reaches 1 to 2.

[0037] In the present invention, the tetracycline resistance gene may be characterized as being tetA.

[0038] In the present invention, the itaconic acid productivity of the strains in which the evolution of step 3) is induced may be characterized by an increase of 1.3 to 1.8 times compared to the itaconic acid productivity of the non-induced strains, and suitably, the productivity and production efficiency may be characterized by an increase of about 1.5 times.

[0039] According to another embodiment, a high-producing itaconic acid strain screened by a method according to the present invention is provided.

[0040] In the present invention, the high-producing itaconic acid strain may be characterized by having a deletion of bases at positions 2,306,677 to 2,337,685 in the full-length gene sequence of E. coli W strain (accession number: ACTC9637).

[0041] The full-length genome sequence of the above E. coli W strain may refer to the full-length gene sequence of the E. coli W strain registered under Genbank accession number: CP002185.1.

[0042] In the present invention, the high-production strain of itaconic acid may be characterized in that the base at positions 2,306,677 to 2,337,685 in the full-length gene sequence of the E. coli W strain is approximately 31 kb downstream from the cyaR gene represented by sequence number 5.

[0043] In the present invention, the high-production strain of itaconic acid may be characterized by a deletion of a gene involved in the stringent response.

[0044] The term "stringent response" refers to a physiological response in which bacteria readjust their gene expression and metabolism to adapt to conditions such as nutrient deprivation, environmental stress, or growth restriction. This response is primarily mediated by guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp), which are alarmones produced in response to bacterial stress. ppGpp is synthesized by RelA and SpoT, and is produced in response to amino acid starvation during translation in the ribosome or other stress signals. The stringent response inhibits rRNA and tRNA synthesis and translation, and increases the expression of stress-resistant genes. Furthermore, carbon metabolism, lipid synthesis, and amino acid synthesis pathways are reorganized to conserve energy and maintain essential metabolic processes. The stringent response may include activation of the glycoxylate shunt, increased expression of RpoS, and inhibition of the TCA cycle.

[0045] Additionally, the gene involved in the stringent response may be the ecw_m2276 gene represented by SEQ ID NO: 6 or the ecw_m2277 gene represented by SEQ ID NO: 7.

[0046] The promoters and genes of the above-described sequence numbers 1 to 7 of the present invention are shown in Table 1 below.

[0047]

[0048] 서열번호설명염기서열1J23106 프로모터tttacggctagctcagtcctaggtatagtgctagc2itcR 유전자atggaattacgccatatccgttatttcttggctgtcgctgaagaacgccacttcacacgcgctgcagcccgcctgggtatcggacagccaccactgtcgcagcagatcaaggacttggagcgcgagcttggcgctcttctgtttcgtcgtgtgagctatggtgcggaattgaccgaagctggcattgcgtttctggacgttgttaaagaaatccccgtgatggcggaacgtgccacccaggccgcccaacgcgccgttcgtggcgaacttggtgttttacgtgtcggcttcactgcttcgtcagcattcaattcggtggtacctaccgcgattcgcgcgttccgccgtgcgtaccccgacgtgcgcctgcagttggaagaggacaatacaacgcgtttagctgacgggttgaacgaaggcagtctggacgtggcctttttacgtcctgggttcgcggggtcagagcgctttcatctgcgtatgttatccgaagagccaatgatgatcgtcatggctgaaaatcaccccgccgcgagctatgaggagattagtctgtcggcgtttcgtgacgaaacctttctgttatttcctcgtgaaatcggattaactttgtacgacagtgtgatcgagtcctgccgcactgcgggatttgaacctactattggacagttagcgccccaaattgcgagtgtcatcaatttagtagcagccgagatgggcgtctccattgtgcccgcgtccatgtcgcaagttaaagttatcggtgtagtttatcgtcatattgccgatcagacgccgactgcgaagttagccttagcatatcgccgcggcgatactagccccgtgcttcgcaacttcgtccttacagtatttccgtga3Pccl프로모터cttcatatccaaaagcaattaaacacaccggtatcatatattggataaatgataacggcgaccatagactaagcgaagttggaggaggaaccat4tetA 유전자cggctcttaccagcctaacttcgatcattggaccgctgatcgtcacggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcgacctga5cyaR 유전자tcgctgaaaaacataacccataaaatgctagctgtaccaggaaccacctccttagcctgtgtaatctcccttacacgggcttattt6ecw_m2276 유전자atgagtaatattatcaatgtaatacaaagttgcatcgatcctacatttcaattaatgcgagagcaggaatgctgggttgtatgcgaagagaacccaggtgctacaaataaaaaattactggtaaacggaaatggtatctatggattttcgctagattctaatagtatttctaaaccagtctggaaatttttaaaatcttctgctttaccaggagtatgctctgtttgtgatggaatttttgttacgtcgcacaaagacgtagattattttatcgtaatagatctcaaatcttataactcaaatggtgcggctaaacaggtagttactggcattcatttttgtaagtggctatattctgtattgaatttacatgggcatttgtcaagaaaagtggattacattggtgtaataagtaaattatcgaggaggcagcaatcagctaaaaaaacaactgttcgctcgcaattgcctcctcctgaaatttgctataattatcctgtgtttacattggaaaactataacagattatcactggcgcatatttgtgactttatatacaatatgaaaaaataa7ecw_m2277genetaatgattgacgaacccgagttaaatttacacccgtcaaatcagcgagtaattgcaagatttttagcaaagctagttaactctggtattcgggttattgtt agtactcacagtgattatttgtgaaagaaatcaatagcttgattatgttgcatggcgtttctgaaaatatgattgaaaaacgaaacgctatcatgcagaagca agggattagcatcgactcaattttagactctaacctagtcgctgcgtatttatttgataatggctcagtcaatgaaatgcagaagtcaaatgaagggattaatgctgtaacttttgatgaagtaattaatgccattaatgacgataatgatgaaatatattactccttggtggtggagaatgcctctgatagtgaggatgtagatgagtaa

[0049]

[0050] According to another embodiment of the present invention, a method for producing itaconic acid is provided, comprising a step of culturing an itaconic acid high-producing strain screened according to the method of the present invention in a medium containing acetic acid.

[0051] The itaconic acid produced by the above itaconic acid high-producing strain can be obtained by known separation and purification methods such as column chromatography, HPLC, and TLC.

[0052]

[0053] Hereinafter, the present invention will be described in more detail through specific examples. The following examples illustrate preferred embodiments of the present invention, and the scope of the present invention is not limited to the matters described in the following examples.

[0054]

[0055] Example 1. Introduction of an itaconic acid biosensor and selection of adaptive evolution strains.

[0056] 1-1. Production of itaconic acid biosensor and biosensor introduction strain

[0057] The itaconic acid-responsive screening system was constructed by synthesizing a codon-optimized itcR fragment derived from Yersinia pseudotuberculosis, a type of tuberculosis bacterium, and assembling it with amplified pETduet-1 and tetA fragments. The terminators and promoters used in all vectors were obtained from the Registry of Standard Biological Parts, http: / / parts.igem.org. The synthesized 5' untranslated region (5' UTR) was computer-designed using UTR Designer (http: / / sbi.postech.ac.kr / utr_designer). The amplified DNA fragment was introduced into an E. coliMach strain after appropriate purification and Gibson assembly, and the sequence was confirmed by plasmid extraction. The confirmed plasmid was introduced into an E. coliW strain, and the constructed strain was designated WCS0.

[0058]

[0059] 1-2. Adaptation and evolution of the itaconic acid biosensor strain

[0060] For the WCS0 strain produced according to the above Example 1-1, the efficiency of itaconic acid production was attempted to be increased through the adaptive laboratory evolution (ALE) technique.

[0061] First, the WCS0 strain was inoculated into modified minimal acetic acid medium supplemented with 5 g / L neutralized acetic acid, 50 μg / mL streptomycin, and 100 μg / mL ampicillin, and then cultured overnight. The saturated strain was inoculated into 25 mL of the initial OD 600 Diluted in a 300ml Erlenmeyer Flask with an OD of 0.1 600 Initial OD when the value reaches 1 or 2 600The strain was diluted again in fresh medium supplemented with 10 g / L acetic acid, 50 μg / mL streptomycin, 100 μg / mL ampicillin, and 0.5 mM IPTG for directed evolution, and designated as round 1. After 3 hours of evolution of the Round 1 strain, 7 mg / mL of tetracycline was added to induce evolution by promoting the expression of tetA, a tetracycline resistance gene.

[0062] OD of round 1 strains after 600 When the value reached 1 or 2, evolution continued by inoculating the strain on a new medium. This ALE was performed for a total of 12 rounds, and the concentration of tetracycline was increased (7–60 mg / mL) in each round to gradually increase the concentration of selection pressure. In addition, samples of the strains in each round were stored at -80°C for analysis. This process was repeated so that the strains that evolved in an environment that gradually increased selection pressure and in the direction of increased itaconic acid productivity accounted for the majority of the entire population, and a schematic diagram of this content is shown in Figure 1.

[0063]

[0064] 1-3. Strain selection based on adaptation and evolution

[0065] Next, 36 single colonies were randomly selected from the final round of evolutionary induction and their itaconic acid production was compared. The strains WCS 3, 6, 19, and 23 showed the best performance when compared to the itaconic acid production in vitro.

[0066]

[0067] Example 2. Activity evaluation of four selected strains

[0068] In order to evaluate the activity of the four strains WCS 3, 6, 19 and 23 selected according to the above Example 1, the culture profile, itaconic acid titer, specific growth rate and yield of the strains (ALE strains) WCS3, WCS6, WCS19 and WCS23 that underwent evolution induction were compared with the WCS0 strain (Parental strain) that did not undergo evolution induction. The results are shown in Figures 2 and 3.

[0069] Referring to Fig. 2, it was confirmed that the rate of increase in itaconic acid was higher than the rate of decrease in acetic acid in strains WCS3, WCS6, WCS19, and WCS23 compared to WCS0.

[0070] Referring to Fig. 3, it was confirmed that, compared to WCS0, the itaconic acid titer in strains WCS3, WCS6, WCS19, and WCS23 increased by up to 65%, the specific growth rate increased by up to 71%, and the yield (g / g yield) increased by up to 45%. Therefore, it was confirmed that the evolution-induced strain grew faster and produced itaconic acid more efficiently than the control group.

[0071]

[0072] Example 3. Genome analysis of four selected strains

[0073] In order to analyze the genomes of the four ALE strains WCS3, WCS6, WCS19, and WCS23 selected according to the above Example 1, the genome sequences between the parental strains and the ALE strains were compared through whole genome sequencing, and the results of confirming mutations in the genome are shown in Fig. 4.

[0074] Referring to Figure 4, we confirmed that a 31-kb deletion occurred at positions 2,306,677–2,337,685 in the genome sequences of all ALE strains. This indicates that the region begins downstream of the cyaR gene, a small RNA that regulates widespread gene expression.

[0075] Furthermore, since the WCS19 strain differs from the WCS0 (parental) strain in only a 31-kb deletion, we were able to confirm that the deletion of this region is a key factor in improving the physiology of the ALE strain. Therefore, subsequent genome-scale analyses focused on comparing the differences between the WCS19 strain and its parental strain.

[0076]

[0077] Example 4. Confirmation of the occurrence of a stringent response through genetic analysis of an ALE strain.

[0078] 4-1. RNA sequence analysis of ALE strain

[0079] To analyze the transformation of the ALE strain in more detail, RNA sequence analysis was performed on strains WCS0, WCS6, WCS19, and WCS23 across three growth stages (mid-exponential, transition, and stationary), and the results comparing gene expression of strains WCS0 and WCS19 at the mid-exponential stage are shown in Figure 5A.

[0080] As shown in Fig. 5A, the WCS19 strain showed a significant increase in expression of the aceBAK operon, which encodes a key enzyme of the glyoxylate shunt, by more than 50 times compared to the WCS0 strain.

[0081]

[0082] 4-2. Analysis of the regulatory module of the ALE strain

[0083] To analyze the transformation of the ALE strain in more detail, the relative functional activity of each module was analyzed using iModulon, an independent regulatory module derived from PRECISE-1K (Lamoureux et al., 2023), a gene expression data set of E. coli in the WCS19 strain, and the results are shown in Figure 5B.

[0084] Referring to Figure 5B, it was confirmed that the transcriptome expression pattern by global regulators such as RpoS, translation, and ppGpp, which are involved in the stringent response, among several global regulators in the WCS19 strain, changed significantly.

[0085]

[0086] 4-3. Genetic analysis of modules with significantly changed gene expression patterns

[0087] Based on the results showing that the modules involved in the stringent response in Example 4-2 were significantly changed, various genes involved in the stringent response were analyzed, and the results are shown in Figures 5C to 5F.

[0088] Referring to Figure 5C, it was confirmed that genes related to translation were down-regulated in the COG category analysis, and genes related to carbohydrate and amino acid metabolism were up-regulated.

[0089] Also, referring to Figure 5D, it was confirmed that the expression of genes related to growth-related processes, including nucleotide, fatty acid, LPS, and peptidoglycan biosynthesis, was generally decreased, whereas the expression of genes involved in glycogen biosynthesis was increased, consistent with the regulatory effect of ppGpp in the stringent response.

[0090] Also, referring to Figure 5F, genes in the ppGpp and translation modules were consistently downregulated, while genes in the RpoS module were upregulated. Among these downregulated genes, those negatively correlated with ppGpp levels indicated increased ppGpp levels and RpoS activity, while decreased translation activity, consistent with the characteristics of a stringent response.

[0091]

[0092] Example 5. Functional analysis of the missing base sequence

[0093] 5-1. Identification of the region involved in itaconic acid production within the base sequence

[0094] To identify the region involved in itaconic acid production among the approximately 31 kb deleted region in the genome sequence of the ALE strain, the region was divided into three fragments (F1, F2, and F3), each approximately 10 kb in length, using random breakpoints. Each fragment was then deleted from the WC0 strain, which had been introduced with the gene (cad) encoding cis-aconitate decarboxylase into the E. coli W strain, to create strains WCF1, WCF2, and WCF3. Furthermore, for a more precise comparison, the WC19 strain was created by removing the biosensor for itaconic acid production from the WCS19 strain. The results of comparing the itaconic acid titer, specific growth rate, and yield of the WCF1, WCF2, and WCF3 strains thus created with those of the WC0 and WC19 strains are shown in Figure 6A.

[0095] Referring to Fig. 6A, the WCF1 and WCF2 strains showed similar characteristics to the WC0 strain, whereas the WCF3 strain with the F3 fragment deleted showed an increase in itaconic acid titer, growth rate, and yield similar to those of the WC19 strain.

[0096]

[0097] 5-2. Identification of genes involved in itaconic acid production within the F3 region

[0098] To identify genes involved in itaconic acid production within the F3 region, the presence or absence of phage residue replication of 16 genes present in the F3 fragment was confirmed, and the results are shown in Figures 6B and 6C.

[0099] Referring to Figures 6B and 6C, among the 16 genes present in the F3 fragment, only two genes, ecw_m2276 and ecw_m2277, were not replicated as phage remnants and were confirmed to be expressed in the WCS0 strain during the mid-exponential phase.

[0100]

[0101] Example 6. Production of reverse engineering strains to confirm the function of defective genes.

[0102] To confirm the knockout effect of the ecw_m2276 and ecw_m2277 genes identified in Example 5, each gene was individually deleted from the WC0 strain to produce the WCD6 (ecw_m2276 deletion), WCD7 (ecw_m2277 deletion), and WCD67 (both genes deleted) strains. In addition, the WC19M7 strain was produced by inserting a plasmid containing ecw_m2277 into the WC19 strain, and the WC19M67 strain was produced by inserting a plasmid containing ecw_m2277 into a strain expressing ecw_m2276 by its native promoter.

[0103] The results of comparing the itaconic acid titer, specific growth rate, and yield of the WCD6, WCD7, WCD67, WC19M7, and WC19M67 strains manufactured in this manner with those of the WC0 and WC19 strains are shown in Figure 7.

[0104] Referring to Fig. 7, it was confirmed that the WCD6, WCD7, WCD67, and WC19M7 strains showed increased itaconic acid titer, growth rate, and yield similar to those of the WC19 strain compared to the WC0 strain.

[0105]

[0106] In addition, the results of comparing the culture profiles of the WCD and WCD67 strains manufactured as described above with the WC0 and WC19 strains are shown in Figure 8.

[0107] Referring to Figure 8, the final cell biomass of WC19 and the reverse-engineered strains (WCD, WCD67) was confirmed to be reduced compared to the WC0 strain. These results suggest that both the ecw_m2276 and ecw_m2277 genes are required for altering the phenotype in ALE strains.

[0108]

[0109] Therefore, the screening method for the high-producing itaconic acid strain developed in the present invention and the high-producing itaconic acid strain using the same have the effect of increasing the productivity of itaconic acid while having excellent economic efficiency, and thus can be utilized in various industrial fields such as synthetic resins, latex, and food additives where itaconic acid is utilized.

[0110] While specific aspects of the present invention have been described in detail, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0111] A strain screening method according to one embodiment of the present invention can select a strain capable of high production of itaconic acid from acetic acid, a non-preferred sugar.

[0112] In addition, by optimizing the itaconic acid production pathway and exploring genes whose functions are unknown, it is possible to identify genes that are helpful in the production of organic acids such as itaconic acid, and itaconic acid, a high value-added product, can be produced more efficiently from acetic acid, a non-preferred sugar but a by-product obtained in large quantities in various processes, so it can be utilized in various industrial fields such as synthetic resins, latex, and food additives where itaconic acid is utilized, and thus it can be usefully used to alleviate environmental problems that are becoming more serious day by day, so it has industrial applicability.

Claims

1. (a) A step of introducing an itaconic acid biosensor into a strain; (b) a step of inducing evolution by repeatedly culturing the strain into which the itaconic acid biosensor of step (a) has been introduced in a medium containing acetic acid; (c) a step of evaluating the itaconic acid productivity of the strains in which evolution has been induced according to the above step (b); (d) a step of selecting a strain that produces high itaconic acid; and (e) a step of performing a genome analysis on the itaconic acid high-producing strain selected in the step (d) and comparing it with an existing strain; a screening method for an itaconic acid high-producing strain, comprising:

2. In paragraph 1, A method for screening a high-producing itaconic acid strain, characterized in that the strain of the above step (a) is an E. coli W strain deposited under the accession number ATCC 9637.

3. In paragraph 1, A method for screening an itaconic acid high-producing strain, characterized in that the itaconic acid biosensor of the above step (a) comprises an itcR gene represented by SEQ ID NO. 2 linked to a J23106 promoter represented by SEQ ID NO. 1 and a tetA gene represented by SEQ ID NO. 4 linked to a Pccl promoter represented by SEQ ID NO.

3.

4. In paragraph 1, A method for screening a high-producing itaconic acid strain, characterized in that the repeated cultivation of step (b) is performed 1 to 25 times.

5. In paragraph 1, A method for screening a high-producing itaconic acid strain, characterized in that the step of inducing evolution in the above step (b) is performed in the direction of increasing the expression of a tetracycline resistance gene in a medium or increasing the productivity of itaconic acid.

6. In paragraph 5, A method for screening an itaconic acid high-producing strain, characterized in that the tetracycline resistance gene is tetA.

7. In paragraph 1, A method for screening for a high-producing itaconic acid strain, characterized in that the itaconic acid productivity of the strains in which evolution has been induced in the above step (c) is increased by 1.3 to 1.8 times compared to the itaconic acid productivity of the strains in which evolution has not been induced.

8. A high-producing itaconic acid strain screened by any one of the methods of clauses 1 to 7.

9. In paragraph 8, The above strain is an itaconic acid high-producing strain, characterized in that it is an E. coli W strain in which bases at positions 2,306,677 to 2,337,685 in the full-length gene sequence are deleted.

10. In paragraph 9, An itaconic acid high-producing strain, characterized in that the bases at positions 2,306,677 to 2,337,685 are bases starting from the downstream of the cyaR gene represented by sequence number 5.

11. In paragraph 8, The above strain is an itaconic acid high-producing strain characterized in that it is an E. coli W strain in which a gene involved in the stringent response has been deleted.

12. In paragraph 11, A high-producing itaconic acid strain, wherein the gene involved in the stringent response is the ecw_m2276 gene represented by sequence number 6 or the ecw_m2277 gene represented by sequence number 7.

13. A method for producing itaconic acid, comprising the step of culturing an itaconic acid-producing strain according to Article 8 in a medium containing acetic acid.

Images