Use of novel strain for treating inflammatory skin diseases

Abstract

The present invention relates to a novel use of Lactobacillus plantarum IMB19 (KCTC 14337BP). The Lactobacillus plantarum IMB19 (KCTC 14337 BP) according to the present invention suppresses inflammatory responses, alleviates itching, and regenerates the stratum corneum, and thus exhibits the effects of preventing, treating, and alleviating inflammatory skin diseases.

Description

Use of a novel strain for the treatment of inflammatory skin diseases

[0001] The present invention relates to a novel use of Lactobacillus plantarum IMB19 KCTC 14337BP.

[0002] The skin functions to protect the body's organs from external stimuli, including changes in temperature and humidity and ultraviolet rays. However, the skin is frequently exposed to external stimuli like ultraviolet rays and various pathogens. This constant physical and chemical stimulation can impair skin function. Furthermore, it is also susceptible to pathological changes such as genetics, inflammation, benign and malignant tumors, hormones, trauma, and degenerative changes. Therefore, skin diseases can be triggered by a variety of factors.

[0003] Inflammatory skin diseases (IDDs) are skin conditions characterized by inflammatory reactions such as itching, swelling, erythema, and peeling, caused by various irritants that trigger a series of inflammatory responses within the epithelium. Known examples of these inflammatory skin diseases include allergic dermatitis, bites caused by animal or insect bites, dermatophytosis, and acne. Among these, atopic dermatitis has recently become a serious problem, with its incidence rapidly increasing due to factors such as westernized diets, housing environments, increased stress, and increased pollutants resulting from industrial development.

[0004] Atopic dermatitis (AD) is the most common chronic inflammatory skin disease, characterized by intense itching and recurrent eczematous lesions. It begins as eczema on the face and extremities in infancy, then spreads to the flexed arms and behind the knees as the child grows. Later, lichenification, a thickening of the skin in these areas, appears. Clinically, the disease presents a wide range of heterogeneous features, ranging from eczema confined to the hands to erythema affecting over 90% of the body surface. This heterogeneity makes it difficult to accurately assess the disease's prevalence, but its lifetime prevalence has been reported to be up to 20% worldwide. Previously, it was thought to have a prevalence of up to 25% in infancy, but recent reports indicate that the prevalence in adults also ranges from 7% to 10%.

[0005] Current treatments for inflammatory skin diseases, including atopic dermatitis, include antihistamines, topical corticosteroids, or oral psoralen followed by phototherapy using ultraviolet light. However, these treatments are effective only in some patients and are ineffective in most. Furthermore, long-term use of corticosteroids can lead to various side effects, and phototherapy can also increase the risk of skin cancer.

[0006] Accordingly, as a result of research on a method for effectively treating inflammatory skin diseases including atopic dermatitis, the inventors of the present invention confirmed that Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP has an excellent effect in suppressing inflammatory response, alleviating itching, and regenerating the stratum corneum, thereby completing the present invention.

[0007] One object of the present invention is to provide a composition for preventing, treating or improving inflammatory skin diseases, comprising Lactobacillus plantarum IMB19 KCTC 14337BP.

[0008] To avoid confusion due to overlapping content, the description of redundant content will be omitted below. In other words, the content of the invention is not limited to the content described below, and the content of the invention should be interpreted based on the overall content of the invention.

[0009] Hereinafter, the present invention will be described in detail.

[0010] The present invention provides a composition for preventing, treating or improving inflammatory skin diseases, comprising Lactobacillus plantarum IMB19 KCTC 14337BP.

[0011] The Lactobacillus plantarum IMB19 of the present invention is characterized as a lactic acid bacterium isolated and identified from microbial strains of kimchi.

[0012] The 16S rRNA base sequence for identification and classification of Lactobacillus plantarum IMB19 of the present invention may be amplified by the forward primer of sequence number 1 and the reverse primer of sequence number 2 attached to this specification.

[0013] Forward primer (27F primer, SEQ ID NO: 1): AGAGTTTGATCMTGGCTCAG

[0014] Reverse primer (1492R primer, SEQ ID NO: 2): TACGGYTACCTTGTTACGACTT

[0015] Accordingly, the Lactobacillus plantarum IMB19 of the present invention may include 16S rRNA of sequence number 3 and sequence number 4 as follows.

[0016] Lactobacillus plantarumIMB19 16S rRNA(785 Forward) (SEQ ID NO: 3):

[0017] TTCCGGTGTCAAATCCGACCGAATCCGGGGACTCGTCTCGCGGAAATGTGTTTCTTTTTAGAGACATGGATTCTTACAAACCGAGACCCTGTCATGCCCGGGATGAGGGTCTGCCACTAACAACT TTCCGAACATGATGGGAAGAACCCCCTAACGGGCGCCCACCTGGAGGAATTTGGGCCGGGGCACCACCGCCCGAGGTGGGGCGGAAAACCCCCTCCAGGGGTCCCATCCTCAATTTTTCCGGGGG GGACCCCCCTCCCCCCCAAAATGAGGGAAAACCCCCGGGGGGGCACCCCCAAAAGAAGGAGAGCCCCCCACCCTCACTCTTCCCGCCCGGCGTGCGGGGGCGGGTTTTTTTTTTTCTGTCAAAATAA ATTTTGTGTTGTTTGTGTGTTCCTCCCCCCCCCGCCGCGGGGGCGGGGTTGTACTTTTTTCCCTCTCCATCCCCCCCCCACCACAAAAGAAAAGGAGGGGACGACACCCACAGTGGGTGTGTTTTT

[0018] Lactobacillus plantarumIMB19 16S rRNA(907 Reverse) (SEQ ID NO: 4):

[0019] GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGTGTGGGGGGGGGGGGGTTGTTGTTTTTGTTTGGGGGGGGGGTTGTTTTTTGTGTGTGTGT TTTGTTGTTTGTTTGGGGGTGTGTTTTGTTGTGGGGTGGGGTGTTGGGGGGGTTGGGGGGGGGGTGTTGTTTGGGGGGGGTGGGGGGGGGGGTTTTTTTGTTGTTGTGTGGTTGTGTGTTGTGTGGTGGGTGG GGGGGGTGGTGTGTGTGTGGGGGTGGGGGGTGTTTGGTGGGGGGGGGGTTGTTGTGGGGGGGTGGTGTTTGTTTTTTGTTTTTTTTTGTGTGTGGGGGGGGGGTGGGGGGTGGTTTGTGGGGTGTTGTTTG TGTGTGGTTGGTGGTGGTGTGTGGGGGGGTTGGGGGGGGGGGGGTTGTCTTTTTTGTTGGTGTTGGGTGTTTGTTGGTGTTGGTGTGTGGTGGGGTGGTGTGGTGGGTGGGTGCTTGTTGTGTTGTGGTGTGT

[0020] In the present invention, the strain may be deposited with the Korea Research Institute of Bioscience and Biotechnology on October 21, 2020, under the accession number KCTC 14337BP.

[0021] The present invention provides a pharmaceutical composition for preventing or treating inflammatory skin diseases, comprising Lactobacillus plantarum IMB19 KCTC 14337BP.

[0022] In the present invention, "inflammatory skin disease" means a disease in which a series of clinical signs and symptoms, such as itching, swelling, erythema, and peeling, are caused by various stimulating factors that cause a series of inflammatory reactions within the skin epithelium.

[0023] Although not limited thereto, the inflammatory skin disease may be at least one selected from the group consisting of atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, and lupus erythematosus.

[0024] Specifically, the inflammatory skin disease may be atopic dermatitis.

[0025] In the present invention, "atopic dermatitis" refers to a chronic inflammatory skin disease characterized by intense itching (e.g., severe itching) and scaly, dry eczematous lesions. Typically, atopic dermatitis is classified into infantile atopic dermatitis, juvenile atopic dermatitis, adult atopic dermatitis, and maternal atopic dermatitis, depending on the time of onset or the subject of onset. In this specification, atopic dermatitis is defined as including all of these types of atopic dermatitis.

[0026] Specifically, symptoms include dry, eczematous skin and papules, and lesion samples from atopic patients show epidermal hyperplasia, epidermal proliferation, and accumulation of lymphocytes and mast cells. Patients with atopic dermatitis may experience severe pruritus, which in turn induces inflammation of the skin lesions and further worsens clinical symptoms.

[0027] The term "pruritus" in the present invention refers to a disease that includes itching caused by a decrease in antibacterial activity and deterioration of barrier function due to a decrease in the lipid content of the stratum corneum of the skin, or itching caused by external stimuli such as temperature changes, chemical substances, and electrical stimulation. The scope of diseases according to the present invention also includes itching.

[0028] The composition according to the present invention is effective in improving symptoms of atopic dermatitis, such as skin inflammation and itching.

[0029] According to one embodiment of the present invention, Lactobacillus plantarum IMB19 KCTC 14337BP can suppress inflammatory response, relieve itching, and regenerate the stratum corneum.

[0030] Specifically, it was confirmed that Lactobacillus plantarumIMB19 KCTC 14337BP (i) reduces serum IgE concentration and infiltration of innate immune cells (neutrophils and eosinophils) into skin lesions, (ii) inhibits the production of cytokines (IL-4, IL-13), (iii) reduces itch-related genes (Areg), and (iv) increases stratum corneum-related genes (Lor), thereby exhibiting preventive and therapeutic effects on inflammatory skin diseases.

[0031] In the present invention, "IgE (Immunoglobulin E)" is an antibody isotype found only in mammals, and is known to induce a strong inflammatory response even though it is the isotype present in the least amount in serum.

[0032] In the present invention, "neutrophil" is a white blood cell that accounts for the largest proportion in mammals and plays an important role in innate immunity, and is subdivided into segmented neutrophil and banded neutrophil.

[0033] In the present invention, “eosinophil” is a type of granulocytic leukocyte that has eosinophilic granules in the cytoplasm, and corresponds to a major cell participating in an allergic reaction.

[0034] In the present invention, "IL-4 (Interleukin-4)" is a cytokine that induces differentiation from non-activated helper T cells into Th2 (T helper ytpe 2) cells, and functions as a major regulator of humoral and adaptive immunity.

[0035] In the present invention, "IL-13 (Interleukin-13)" is a cytokine secreted by Th2 cells, CD4 cells, natural killer T cells, mast cells, eosinophils, and nuclear cells, and is known to have secondary structural characteristics and biological functions similar to IL-4.

[0036] In the present invention, "Areg (Amphireuglin)" refers to a protein synthesized as a transmembrane glycoprotein having 252 amino acids, and is associated with a skin phenotype similar to psoriasis.

[0037] In the present invention, "Lor (Loricrin)" is a final differentiation structural protein that accounts for more than 70% of the keratinized outer skin and contributes to the protective barrier function of the stratum corneum.

[0038] The strain according to the present invention can be utilized in various forms, such as live cells, dead cells, cultures, lysates, or extracts. The strain according to the present invention, regardless of its form, exhibits results equivalent to or higher than the above-mentioned effects (especially considering live cells) under conditions involving the strain.

[0039] Probiotics refer to living bacteria, while dead bacteria refer to live bacteria cultured under certain conditions and then the effective ingredients are separated and extracted through methods such as heat drying, pressurization, and drug treatment.

[0040] A culture refers to a product obtained by culturing lactic acid bacteria in a known liquid medium or solid medium, and is a concept that includes a strain according to the present invention. The product may include lactic acid bacteria. The medium may be selected from known liquid or solid media, and may be, for example, MRS liquid medium, GAM liquid medium, MRS agar medium, GAM agar medium, or BL agar medium, but is not limited thereto.

[0041] A lysate refers to a form in which live cells, dead cells, or cultures thereof are separated and processed mechanically or chemically. For example, the lysate can be produced using bead mills, presses, sonicators, microfluidizers, enzyme treatment, etc.

[0042] An extract means a product obtained by extracting living cells, dead cells and / or fragments using a commonly known extraction method (a known extraction solvent (e.g., water, C1 to C4 alcohol (methanol, ethanol, etc.))).

[0043] In the present invention, the composition comprises 1 x 10 of the strain 8 3 x 10 9 It may be included in a concentration of CFU, preferably 5 x 10 8 3 x 10 9 It may include, but is not limited to, a concentration of CFU.

[0044] The pharmaceutical composition according to the present invention can be formulated into a pharmaceutical formulation using methods well known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to a subject. In preparing the formulation, the pharmaceutical composition according to the present invention may additionally include a pharmaceutically acceptable carrier, provided that it does not inhibit the activity of the compound of the present invention.

[0045] The pharmaceutically acceptable carriers include, but are not limited to, those commonly used, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, the pharmaceutical composition of the present invention may include diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants, and other pharmaceutically acceptable additives.

[0046] The pharmaceutical composition according to the present invention may be administered in a pharmaceutically effective amount. Here, "pharmaceutically effective amount" means an amount sufficient to prevent or treat a disease at a reasonable benefit / risk ratio applicable to medical treatment. The level of the effective amount may be variously selected by those skilled in the art according to factors such as the formulation method, the patient's condition and body weight, the patient's sex, age, the extent of the disease, the drug form, the route and duration of administration, the excretion rate, the sensitivity of the reaction, etc. As will be recognized by those skilled in the art, the effective amount may vary depending on the route of administration, the use of excipients, and the possibility of use together with other drugs. However, for a desirable effect, in the case of an oral administration agent, the composition of the present invention may generally be administered to an adult at 0.0001 to 100 mg / kg per kg of body weight per day, preferably 0.001 to 100 mg / kg, but the above dosage does not limit the scope of the present invention in any way.

[0047] The pharmaceutical composition according to the present invention can be administered to mammals such as mice, livestock, and humans via various routes. Livestock may include, but are not limited to, dogs, cats, rabbits, squirrels, hamsters, guinea pigs, pigs, cows, and chickens.

[0048] Specifically, the pharmaceutical composition according to the present invention can be administered orally or parenterally (e.g., by topical application or intravenous, subcutaneous, or intraperitoneal injection), but oral administration is preferred. Solid preparations for oral administration may include powders, granules, tablets, capsules, soft capsules, pills, etc. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, aerosols, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Preparations for parenteral administration may be formulated and used in the form of external preparations such as sterilized aqueous solutions, liquids, non-aqueous solvents, suspensions, emulsions, eye drops, eye ointments, syrups, suppositories, aerosols, etc., and sterilized injection preparations according to conventional methods, and preferably, pharmaceutical compositions such as creams, gels, patches, sprays, ointments, ointments, lotions, liniments, eye ointments, eye drops, pastes, or cataplasmas may be prepared and used, but are not limited thereto. Preparations for topical administration may be anhydrous or aqueous depending on the clinical prescription. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases that can be used include witepsol, macrogol, tween 61, cocoa butter, laurin butter, and glycerogelatin.

[0049] The pharmaceutical composition of the present invention can be administered alone as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. Furthermore, the pharmaceutical composition of the present invention can be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer the amount that achieves maximum effect with the minimum amount possible without causing side effects, a determination readily made by those skilled in the art.

[0050] The term "subject" of the present invention includes an animal or human whose symptoms can be improved by administration of a pharmaceutical composition according to the present invention. By administering a pharmaceutical composition according to the present invention to a subject, inflammatory skin diseases can be effectively prevented and treated.

[0051] The term "administration" in the present invention refers to introducing a given substance into a human or animal by any suitable method. The pharmaceutical composition according to the present invention may be administered orally or parenterally via any common route, as long as it can reach the target tissue. Furthermore, the pharmaceutical composition according to the present invention may be administered by any device capable of transporting the active ingredient to target cells.

[0052] The preferred dosage of the pharmaceutical composition according to the present invention varies depending on the patient's condition and weight, the degree of disease, the drug form, the route and period of administration, and can be appropriately selected by a person skilled in the art.

[0053] The present invention provides Lactobacillus plantarum IMB19 KCTC 14337BP for use in the prevention or treatment of inflammatory skin diseases.

[0054] The present invention provides the use of Lactobacillus plantarum IMB19 KCTC 14337BP in the manufacture of a medicament for treating inflammatory skin diseases.

[0055] The present invention provides a method for preventing or treating an inflammatory skin disease, comprising a step of administering Lactobacillus plantarum IMB19 KCTC 14337BP to a subject in need thereof.

[0056] The present invention provides a composition comprising Lactobacillus plantarum IMB19 KCTC 14337BP.

[0057] The present invention provides a food composition for preventing or improving inflammatory skin disease, comprising Lactobacillus plantarum IMB19 KCTC 14337BP.

[0058] The above “Lactobacillus plantarumIMB19” and “inflammatory skin disease” are the same as described above.

[0059] Specifically, the lactic acid bacteria included in the food composition according to the present invention may be live cells thereof, dead cells thereof, culture thereof, lysate thereof, or extract thereof, but any form of lactic acid bacteria capable of achieving a preventive or improving effect on inflammatory skin diseases may be used without limitation.

[0060] There are no special restrictions on the types of the above foods. Foods to which the above lactic acid bacteria can be added include dairy products including sausages, meat, bread, chocolate, snacks, candies, confectionery, ramen, pizza, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes. When formulated as a beverage, the liquid ingredients added in addition to the novel lactic acid bacteria are not limited thereto, but may contain various flavorings or natural carbohydrates as additional ingredients, as in conventional beverages. The above-mentioned natural carbohydrates may be monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, etc.), and polysaccharides (e.g., conventional sugars such as dextrin, cyclodextrin, etc.), and sugar alcohols such as xylitol, sorbitol, and erythritol.

[0061] The type of the above food may be, specifically, a health functional food. The health functional food may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and enhancers (cheese, chocolate, etc.), pectic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These ingredients may be used alone or in combination, and the proportion of these additives is generally selected in the range of 0.001 to 50 parts by weight per total weight of the composition.

[0062] The above health functional foods emphasize the bioregulatory functions of food. They are foods with added value, utilizing physical, biochemical, and biotechnological methods to function and manifest for specific purposes. The ingredients of these health functional foods are designed and processed to fully exert their bodily regulatory functions related to biological defense, regulation of body rhythms, and disease prevention and recovery. They may also contain food additives, sweeteners, or functional ingredients permitted as food.

[0063] When the Lactobacillus plantarum IMB19 of the present invention is used as a health functional food (or health functional beverage additive), the Lactobacillus plantarum IMB19 may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method.

[0064] The pharmaceutical composition and / or food composition according to the present invention can also be used for veterinary purposes.

[0065] The present invention provides an animal feed additive comprising Lactobacillus plantarum IMB19 KCTC 14337BP.

[0066] The above animal feed additive may be an additive for improving atopy.

[0067] The animal feed additive of the present invention may be in the form of a dry or liquid formulation, and may further include other non-pathogenic microorganisms in addition to the Lactobacillus plantarum IMB19 strain.

[0068] The animal feed additive of the present invention may further include one or more enzyme preparations in addition to the Lactobacillus plantarum IMB19. The added enzyme preparation can be in either dry or liquid form, and the enzyme preparation includes a fat-decomposing enzyme such as lipase, phytase that breaks down phytic acid to create phosphate and inositol phosphate, amylase that hydrolyzes α-1,4-glycoside bonds contained in starch and glycogen, phosphatase that hydrolyzes organic phosphate esters, carboxymethylcellulase that breaks down cellulose, xylase that breaks down xylose, maltase that hydrolyzes maltose into two glucose molecules, and saccharose that hydrolyzes saccharose to create a glucose-fructose mixture. Sugar-producing enzymes such as invertase can be used.

[0069] When the Lactobacillus plantarum IMB19 strain of the present invention is used as an animal feed additive, various grains and soybean proteins, as well as peanuts, peas, sugar beets, pulp, grain by-products, animal viscera powder, and fish meal powder, can be used as feed raw materials, and these can be used without limitation in an unprocessed or processed form. The processing process is not necessarily limited thereto, but for example, it is a process in which feed raw materials are filled and compressed under pressure through a certain outlet, and in the case of proteins, it is preferable to use extrusion molding, which denatures proteins and increases their usability. Extrusion molding has the advantage of denaturing proteins and destroying anti-enzyme factors through a heat treatment process. In addition, in the case of soy protein, the digestibility of the protein can be improved through extrusion molding, and the nutritional value of soy protein can be increased by inactivating anti-nutritional factors such as trypsin inhibitor, which is one of the inhibitors of protein-decomposing enzymes present in soybeans, and increasing the digestibility by protein-decomposing enzymes.

[0070] The Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP of the present invention exhibits preventive, therapeutic and improvement effects on inflammatory skin diseases by suppressing inflammatory responses, alleviating itching and regenerating the stratum corneum.

[0071] Figure 1 is a diagram showing an experimental plan for evaluating the immune efficacy of Lactobacillus plantarum IMB19 KCTC 14337BP for an atopic dermatitis prevention and treatment model.

[0072] Figure 2 shows (a) an ear photograph and (b) a graph showing the change in ear thickness and final ear thickness of each mouse group to evaluate the alleviating effect of Lactobacillus plantarum IMB19 KCTC 14337BP on atopic dermatitis (****p<0.0001 (Student's t-test)).

[0073] Figure 3 is a graph showing the IgE concentration in the serum of each mouse group (*p<0.05, **p<0.01, ***p<0.001 (Student's t-test)).

[0074] Figure 4 is a graph showing the percentage of eosinophils in the CD45+ CD11b+ Ly6G- population infiltrating the ears of each mouse group (*p<0.05, ****p<0.0001 (Student's t-test)).

[0075] Figure 5 is a graph showing the percentage of (a) IL-4+ cells in the CD4+ T cell population and (b) IL-13+ cells in the CD4+ T cell population in the ear skin tissue of each mouse group (*p<0.05, **p<0.01, ***p<0.001 (Student's t-test)).

[0076] Figure 6 is a graph showing the relative gene expression level of Areg in the ear skin tissue of each mouse group (*p<0.05, **p<0.01 (Student's t test)).

[0077] Figure 7 is a graph showing the relative gene expression level of Lor in the ear skin tissue of each mouse group (*p<0.05, ***p<0.001, ****p<0.0001 (Student's t test)).

[0078] Figure 8 is a diagram showing a plan for an experimental study to evaluate the immune efficacy of Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP according to dose for an atopic dermatitis prevention model.

[0079] Figure 9 is a diagram showing (a) an ear photograph and (b) changes in ear thickness and final ear thickness to evaluate the alleviating effect of Lactobacillus plantarum IMB19 KCTC 14337BP on atopic dermatitis according to the dose (***p<0.001, ****p<0.0001 (Student's t test)).

[0080] Figure 10 is a diagram showing an experimental plan for evaluating the immune efficacy of live or dead Lactobacillus plantarum IMB19 KCTC 14337BP for an atopic dermatitis prevention and treatment model.

[0081] Figure 11 shows (a) an ear photograph and (b) a diagram showing the change in ear thickness and the final ear thickness in an experiment using live or dead Lactobacillus plantarum IMB19 KCTC 14337BP cells to evaluate the alleviating effect on atopic dermatitis (****p<0.0001 (Student's t test)).

[0082] Figure 12 is a diagram showing cross-sections of ear tissues from each control group and experimental group stained with hematoxylin and eosin (H&E) for histology analysis in atopic lesions in an experiment using live or dead Lactobacillus plantarum IMB19 KCTC 14337BP cells.

[0083] Figure 13 is a graph showing the percentage of eosinophils in the CD45+ CD11b+ Ly6G- population infiltrated into the ears of each group of mice in an experiment using live or dead Lactobacillus plantarum IMB19 KCTC 14337BP cells (*p<0.05, **p<0.01, ****p<0.0001 (Student's t-test)).

[0084] Figure 14 is a diagram showing an experimental plan for evaluating the immune efficacy of Lactobacillus plantarum IMB19 KCTC 14337BP for an atopic dermatitis prevention and treatment model using NC / Nga mice.

[0085] Figure 15 is a diagram showing (a) an ear photograph and (b) changes in ear thickness and final ear thickness to evaluate the alleviating effect of Lactobacillus plantarum IMB19 KCTC 14337BP on atopic dermatitis using NC / Nga mice (***p<0.001, ****p<0.0001 (Student's t test)).

[0086] Figure 16 is a graph showing the percentage of eosinophils in the CD45+ CD11b+ Ly6G- population infiltrating the ears of each mouse group using NC / Nga mice (*p<0.05, **p<0.01, ****p<0.0001 (Student's t-test)).

[0087] Figure 17 is a graph showing the percentage of (a) IL-4+ cells in the CD4+ T cell population and (b) IL-13+ cells in the CD4+ T cell population in the ear skin tissue of each mouse group using NC / Nga mice (*p<0.05, **p<0.01, ****p<0.0001 (Student's t-test)).

[0088] Hereinafter, preferred examples are presented to aid understanding of the present invention. However, the following examples are provided solely to facilitate understanding of the present invention and are not intended to limit the scope of the present invention.

[0089] Experimental Example 1. Preparation of Lactic Acid Bacteria

[0090] Experimental Example 1-1. Isolation and Cultivation of Lactic Acid Bacteria

[0091] Kimchi was homogenized and the suspension collected. It was then serially diluted, streaked onto MRS broth and agar, and cultured at 37°C for 48 hours to isolate colonies, which were then further cultured for various analyses.

[0092] Lactobacillus plantarum IMB19 strain was cultured in MRS broth at 37°C for 24–36 h. For transmission electron microscopy (TEM), the cultured bacteria were streaked onto MRS-1.5% agar (Neogen Corp., USA) and incubated for 24–30 h. Bacterial colonies were drop-cast onto 2000-mesh graphene-coated copper grids. TEM imaging was performed at 80 kV using a JEOL1220 and a Hitachi HT7700.

[0093] For identification, the cellular morphology of the selected isolates was examined microscopically. Genetic characterization was performed using genomic DNA, and 16S rRNA sequence analysis was performed at Macrogen (Korea).

[0094] The 16S rRNA gene was amplified by direct PCR using the universal primers forward (27F primer, SEQ ID NO: 1), 5'-AGAGTTTGATCMTGGCTCAG-3' and reverse (1492R primer, SEQ ID NO: 2), 5'-TACGGYTACCTTGTTACGACTT-3'.

[0095] The 16S rRNA sequence information of the Lactobacillus plantarum IMB19 strain is as follows.

[0096] Lactobacillus plantarumIMB19 16S rRNA(785 Forward) (SEQ ID NO: 3):

[0097] TTCCGGTGTCAAATCCGACCGAATCCGGGGACTCGTCTCGCGGAAATGTGTTTCTTTTTAGAGACATGGATTCTTACAAACCGAGACCCTGTCATGCCCGGGATGAGGGTCTGCCACTAACAACT TTCCGAACATGATGGGAAGAACCCCCTAACGGGCGCCCACCTGGAGGAATTTGGGCCGGGGCACCACCGCCCGAGGTGGGGCGGAAAACCCCCTCCAGGGGTCCCATCCTCAATTTTTCCGGGGG GGACCCCCCTCCCCCCCAAAATGAGGGAAAACCCCCGGGGGGGCACCCCCAAAAGAAGGAGAGCCCCCCACCCTCACTCTTCCCGCCCGGCGTGCGGGGGCGGGTTTTTTTTTTTCTGTCAAAATAA ATTTTGTGTTGTTTGTGTGTTCCTCCCCCCCCCGCCGCGGGGGCGGGGTTGTACTTTTTTCCCTCTCCATCCCCCCCCCACCACAAAAGAAAAGGAGGGGACGACACCCACAGTGGGTGTGTTTTT

[0098] Lactobacillus plantarumIMB19 16S rRNA(907 Reverse) (SEQ ID NO: 4):

[0099] GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGTGTGGGGGGGGGGGGGTTGTTGTTTTTGTTTGGGGGGGGGGTTGTTTTTTGTGTGTGTGT TTTGTTGTTTGTTTGGGGGTGTGTTTTGTTGTGGGGTGGGGTGTTGGGGGGGTTGGGGGGGGGGTGTTGTTTGGGGGGGGTGGGGGGGGGGGTTTTTTTGTTGTTGTGTGGTTGTGTGTTGTGTGGTGGGTGG GGGGGGTGGTGTGTGTGTGGGGGTGGGGGGTGTTTGGTGGGGGGGGGGTTGTTGTGGGGGGGTGGTGTTTGTTTTTTGTTTTTTTTTGTGTGTGGGGGGGGGGTGGGGGGTGGTTTGTGGGGTGTTGTTTG TGTGTGGTTGGTGGTGGTGTGTGGGGGGGTTGGGGGGGGGGGGGTTGTCTTTTTTGTTGGTGTTGGGTGTTTGTTGGTGTTGGTGTGTGGTGGGGTGGTGTGGTGGGTGGGTGCTTGTTGTGTTGTGGTGTGT

[0100] In the following examples, the Lactobacillus plantarum IMB19 strain was used in a live state or in a heat-killed form.

[0101] The optimal conditions for producing dead cells were confirmed through experiments, and accordingly, dead cells produced by performing heat treatment at 70°C for 30 minutes were used in this experiment.

[0102] Experimental Example 2. Reagents, Equipment, Supernatant, and Consumables

[0103] The reagents used in the present invention are as shown in Table 1 below.

[0104] No. Reagent Name Manufacturer Product Number Lot Number Purpose of Use 12,4-Dinitrochlorobenzene T&IC 016 2GI 6X CS Sensitization and induction solution manufacturing 2Acetone DUKSAN 507E 6GBB 1 Sensitization and induction solution manufacturing 3Tween 20 Sigma-aldrich P 2287-500ML MKCP 19 19 House dust mite induction solution manufacturing 4Olive oil Sigma-aldrich O 15 14-500ML BCT 78 22 Sensitization and induction solution manufacturing 5FBSHyclone SV 30 207.02 SF 000 500 3 Media manufacturing 6MITE, DUST D. FARINA EGREER XPB 81D 3A 25 364 761 House dust mite induction solution manufacturing 7MITE, DUST D. FARINA EGREER XPB 81D 3A 25 4 15 0 3 5 House dust mite Induction solution manufacturing 8MEM NON-Essential Amino Acid SolutionWELGENELS 005-01LS05180301Media manufacturing 92-MercaptoethanolGibco21985-0232392438T cell media manufacturing 101M HEPESWELGENEBB 001-01BB01220101Media manufacturing 110.5M EDTAT&IBED-9180P220708L-9180FACS Buffer manufacturing 12RPMI 1640WELGENELM 011-01LM11231701Media manufacturing 13DPBSWELGENELB 001-02LB012319020.5% PBST manufacturing14Pen StrepGibco15140-1222051354Media manufacturing15Collagenase from Clostridium histolyticum (Type V)Sigma-aldrichC9263-500MG0000120891Ear enzyme media manufacturing16Olumiant tablets2 milligramsLilly112696027300D490751Baricitinib solution manufacturing.

[0105] The equipment, primers and consumables used in the present invention are as shown in Tables 2 and 3 below.

[0106] No. Equipment Name Manufacturer Model Name Serial Number Equipment Number 1 Dial Caliper KORIA-15115-0702 N / A

[0107] No. Product Name Manufacturer Product Number Lot Number 1 ANIMAL FEEDING NEEDLES CADENCE SCIENCE 992104-14-23 228mm Syringe Filter Corning 431219143170303 Kovax-Syringe 30mL Korea Vaccine 21G-30mL 3010605

[0108] Experimental Example 3. Preparation of a Mouse Model

[0109] To induce atopy, BALB / c mice, which have a strong Th2 response, or NC / Nga mice, in which atopy can be induced naturally, were used.

[0110] For BALB / c mice, 5-week-old mice were used for preventive oral administration, and 8-week-old mice were used for therapeutic oral administration. One week prior to oral administration, mice were brought into the animal room and their forelimbs were clipped and marked to stabilize the microbiota.

[0111] For NC / Nga mice, 5-week-old mice were used for preventive oral administration, and 8-week-old mice were used for therapeutic oral administration. One week prior to oral administration, mice were brought into the animal room and their forelimbs were clipped and marked to stabilize the microbiota.

[0112] Experimental Example 4. 1.5% DNCB Sensitization

[0113] (1) Prepare 1.5% DNCB solution

[0114] DNCB solvent (Acetone: Olive oil = 1:3) was prepared according to the number of mice. DNCB was weighed according to the capacity, transferred to a 5 ml tube, dissolved in DNCB solvent according to the concentration, and vortexed for 1 minute.

[0115] (2) Baricitinib preparation

[0116] The total dose of baricitinib required for oral administration to mice during the experimental period was calculated. The solution was dissolved in PBS according to the dosage, filtered using a 28 mm syringe filter, and dispensed into a single oral dose (1 mg / kg).

[0117] (3) 1.5% DNCB Sensitization

[0118] Mice were divided into groups receiving oral administration of PBS, baricitinib, and probiotic strains, respectively. Mice were anesthetized and 10 μl of 1.5% DNCB solution was applied to each ear (total of 40 μl per mouse).

[0119] Experimental Example 5. 1.0% DNCB induction

[0120] (1) Preparation of 1.0% DNCB solution

[0121] The total DNCB solvent (Acetone:Olive oil = 1:3) required for oral administration to mice during the experimental period was prepared. DNCB was weighed and transferred to a 15-ml tube according to the required volume. The solution was dissolved in DNCB solvent according to the concentration, vortexed for 1 minute, and then dispensed into the ear in a single dose. The remainder was stored in a -20°C reagent freezer.

[0122] (2) 1.0% DNCB Induction

[0123] Mice were orally administered PBS, baricitinib, and probiotic strains, respectively, to each group. Mice were anesthetized, and 10 μl of 1.0% DNCB solution was applied to each ear (total of 40 μl per mouse).

[0124] Experimental Example 6. HDM induction

[0125] (1) Preparation of HDM solution

[0126] 0.5% PBST was prepared according to the required volume. HDM was dissolved in 0.5% PBST to a concentration of 10 mg / mL based on the dry weight indicated on the HDM bottle and dispensed into the ear in a single dose. The remainder was stored in a -20°C reagent freezer.

[0127] (2) HDM Induction

[0128] Mice were orally administered PBS, baricitinib, and probiotic strains, respectively, to each group. Mice were anesthetized, and 10 μl of HDM solution was applied to each side of the ear (total of 40 μl per mouse).

[0129] Experimental Example 7. Mouse sacrifice

[0130] (1) Preparing for mouse sacrifice

[0131] Two E-tubes were prepared per mouse to obtain blood samples. For ear prep, Enzyme media, 20 ml FACS Buffer (in a 50 ml Erlenmeyer flask), and three 30 ml PBS (in a 50 ml tube) were prepared per mouse and stored at 4°C.

[0132] (2) Ear prep

[0133] The mouse ears were cut according to the shape of the head and stored in a 24-well plate containing PBS until washing. Two 100Φ Petri dishes were prepared for each group, and four container sides were prepared. PBS was poured into each container and shaken with forceps to remove dead skin cells and contaminants attached to the ears (3-4 times). In the last dish, the ear hair was removed, divided into 4-6 pieces, and placed in 30 ml of PBS (in a 50 ml tube). After shaking for 15 seconds, the pieces were filtered through a metal strainer, and the ear pieces were collected and placed in 20 ml of FACS Buffer (in a 50 ml Erlenmeyer flask) and stirred at 37°C for 20 min.

[0134] Ear enzyme media was prepared during the reaction period. 500 μl of the media was added to each vial, sealed, and stored in a 37°C incubator. The ear fragments were washed in 20 ml of FACS Buffer (in a 50 ml tube, stored at 4°C) after being filtered through a steel strainer. The pieces were then washed again in 30 ml of PBS (in a 50 ml tube, stored at 4°C). The pieces were then filtered through a steel strainer and transferred to 30 ml of PBS, washed again. Finally, the pieces were filtered through a steel strainer and transferred to the vial containing the Ear enzyme media. The pieces were chopped with curved scissors, filled with the remaining volume (4.5 mL), and stirred at 37°C for 45 min.

[0135] After the reaction, the tissue was allowed to settle and pipetted at least 10 times using a pipette aid. The tissue was then filtered through a mesh filter and transferred to a 15-ml tube. The vial was then washed with 3 ml of PBS, filtered through a mesh filter again, and transferred to a 15-ml tube. After centrifugation at 4°C, 1500 rpm, and 5 min, the sample was washed with 1 ml of T cell media per sample. After another centrifugation at 4°C, 1500 rpm, and 5 min, the sample was used for FACS staining.

[0136] Example 1. Evaluation of the preventive and therapeutic efficacy of IMB001 for atopic dermatitis

[0137] (1) Experimental preparation

[0138] To evaluate the preventive efficacy of Lactobacillus plantarum IMB19 strain (IMB001) on atopic dermatitis, IMB001 was administered to BALB / c mice under SPF conditions at a dose of 5Х10 8 CFU was administered orally five times a week for 10 weeks. Three weeks after administration of the strain, 1.5% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of the mice to induce atopic dermatitis, thereby performing sensitization.

[0139] Meanwhile, to evaluate the therapeutic efficacy on atopic dermatitis, IMB001 was administered to BALB / c mice under SPF conditions at a dose of 5Х10 8 CFU was administered orally five times a week for seven weeks. Simultaneously with the start of strain administration, 1.5% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of mice to induce atopic dermatitis for sensitization.

[0140] In both conditions, allergic atopic dermatitis was induced by alternately applying 1.0% DNCB and house dust mites to the ears of mice once a week for 6 weeks, starting 1 week after sensitization, at 3-4 day intervals (Fig. 1).

[0141] (2) Measurement of mouse ear thickness

[0142] As a result of measuring the ear thickness of the mice, the Mock group (negative control group) continued to increase in ear thickness until the end of the experiment, while the Healthy control group showed no change in ear thickness. The IMB001 Prevention group and the IMB001 Treatment group showed a significant suppression of the increase in ear thickness compared to the Mock group (Figs. 2a and 2b).

[0143] (3) Serum IgE regulatory function

[0144] As a result of measuring the serum IgE concentration, which is an important indicator of the symptoms and severity of atopic dermatitis, the serum IgE concentration was significantly reduced in the IMB001 prevention and treatment group compared to the mock group (Fig. 3).

[0145] (4) Confirmation of efficacy in suppressing innate immune cell infiltration

[0146] To measure changes in the severity of atopic dermatitis, innate immune cells infiltrating ear tissue were analyzed by flow cytometry. Results showed that the percentage of eosinophils within the CD45+ CD11b+ Ly6G- population infiltrating ear tissue was significantly reduced in the IMB001 prevention and treatment groups (Fig. 4).

[0147] That is, through the above experiments, it was confirmed that the symptoms and severity of atopic dermatitis can be alleviated through administration of Lactobacillus plantarum IMB19.

[0148] (5) Evaluation of cytokine induction and inhibition efficacy

[0149] Analysis of the cytokine production of CD4+ T cells in the ear skin tissue of each group of mice showed that IL-4+ CD4+ T cells and IL-13+ CD4+ T cells were significantly reduced in the IMB001 prevention group (Fig. 5).

[0150] That is, it was confirmed that the inflammatory response was suppressed by reducing IL-4 and IL-13 induced by atopic dermatitis.

[0151] (6) Analysis of expression of genes related to itch and stratum corneum

[0152] Analysis of the expression of Areg (Amphiregulin), an inducer associated with the itching symptoms of atopic dermatitis, in ear skin tissue showed a significant decrease in the IMB001 prevention group compared to the mock group (Fig. 6).

[0153] Meanwhile, it was confirmed that the expression level of Lor (Loricrin), which is related to keratinocyte differentiation and keratinization, significantly increased in the IMB001 prevention group (Fig. 7).

[0154] That is, it was confirmed that atopic dermatitis symptoms were alleviated by reducing itching symptoms and regenerating the stratum corneum.

[0155] Example 2. Evaluation of the preventive efficacy of IMB001 against atopic dermatitis according to dose.

[0156] (1) Experimental preparation

[0157] To evaluate the atopic prevention efficacy of Lactobacillus plantarum IMB19 strain (IMB001) according to dose, IMB001 was administered at a low dose (1Х10) to BALB / c mice under SPF conditions. 8 CFU), medium dose (5Х10 8 CFU), high dose (3Х10 9 CFU) was administered orally five times a week for 10 weeks. Three weeks after administration of the strain, 1.5% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of the mice to induce atopic dermatitis.

[0158] Allergic atopic dermatitis was induced by applying 1.0% DNCB and house dust mites alternately to the ears of mice once a week for 6 weeks, at 3-4 day intervals, starting one week after sensitization (Fig. 8).

[0159] (2) Measurement of mouse ear thickness

[0160] As a result of measuring the ear thickness of the mice, the Mock group continued to increase in ear thickness until the end of the experiment, while the Healthy control group showed no change in ear thickness. Compared to the Mock group, the increase in ear thickness was significantly suppressed in the Low, Intermediate, and High dose groups, and this suppression effect tended to be more pronounced as the dose increased (Figs. 9a and 9b).

[0161] Through this, it was confirmed that Lactobacillus plantarum IMB19 was effective in preventing atopic dermatitis even when administered in low doses, but that administration in medium or high doses was more effective.

[0162] Example 3. Evaluation of the preventive and therapeutic efficacy of IMB001 bacteria on atopic dermatitis.

[0163] (1) Experimental preparation

[0164] To evaluate the preventive efficacy of live and dead Lactobacillus plantarum IMB19 strain (IMB001) on atopic dermatitis, live 5Х10 8 CFU was heat treated at 70℃ for 30 minutes to kill 5х10 8 CFU was manufactured.

[0165] To evaluate the preventive efficacy of live and dead Lactobacillus plantarum IMB19 strain (IMB001) on atopic dermatitis, 5Х10 live IMB001 strains were administered to BALB / c mice under SPF conditions. 8 CFU or dead cells 5Х10 8 CFU was administered orally five times a week for 10 weeks. Three weeks after administration of the strain, 1.5% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of mice to induce atopic dermatitis, thereby sensitizing them.

[0166] Meanwhile, to evaluate the therapeutic efficacy for atopic dermatitis, 5Х10 IMB001 live cells were injected into BALB / c mice under SPF conditions. 8 CFU or dead cells 5х10 8 CFU was administered orally five times a week for seven weeks. Simultaneously with the start of strain administration, 1.5% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of mice to induce atopic dermatitis for sensitization.

[0167] In both conditions, allergic atopic dermatitis was induced by applying 1.0% DNCB and house dust mites alternately to the ears of mice once a week for 6 weeks, starting 1 week after sensitization, at 3-4 day intervals (Fig. 10).

[0168] (2) Measurement of mouse ear thickness and histology analysis

[0169] As a result of measuring ear thickness of mice, the Mock group (negative control group) continued to increase ear thickness until the end of the experiment, while the Healthy control group showed no change in ear thickness. The live prevention, live treatment, heat-killed prevention, and heat-killed treatment groups of IMB001 all showed significantly suppressed increase in ear thickness compared to the Mock group (Figs. 11a and 11b).

[0170] In addition, for histological analysis of atopic lesions, hematoxylin and eosin (H&E) staining was performed on ear tissues of each experimental group at the end of the experiment, and cross-sectional images were obtained (Fig. 12). The image analysis results showed that the Mock group had the thickest tissue thickness, the Healthy control group had the thinnest tissue thickness, and the IMB001 live prevention, live treatment, heat-killed prevention, and heat-killed treatment groups all showed a significant decrease in tissue thickness compared to the Mock group.

[0171] Through this, it was confirmed that both live and dead Lactobacillus plantarum IMB19 had preventive and therapeutic effects on atopic dermatitis.

[0172] (3) Confirmation of efficacy in suppressing innate immune cell infiltration

[0173] To measure changes in the severity of atopic dermatitis, innate immune cells infiltrating ear tissue were analyzed by flow cytometry. Results showed that the percentage of eosinophils within the CD45+ CD11b+ Ly6G- population infiltrating ear tissue significantly decreased in the live prevention, heat-killed prevention, and heat-killed treatment groups of IMB001 (Fig. 13).

[0174] Through this, it was confirmed that the prophylactic group of Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) or the prophylactic or therapeutic group of Lactobacillus plantarumIMB19 can alleviate the symptoms and severity of atopic dermatitis.

[0175] Example 4. Evaluation of the preventive and therapeutic efficacy of IMB001 on atopic dermatitis in the NC / Nga mouse model.

[0176] (1) Experimental preparation

[0177] To evaluate the preventive efficacy of Lactobacillus plantarum IMB19 strain (IMB001) on atopic dermatitis, IMB001 was administered to NC / Nga mice, which can be naturally induced with atopy, at a dose of 5Х10 8 CFU was administered orally five times a week for eight weeks. Three weeks after administration of the strain, 1.0% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of the mice to induce atopic dermatitis, thereby sensitizing them.

[0178] Meanwhile, to evaluate the therapeutic efficacy on atopic dermatitis, IMB001 was administered to NC / Nga mice, which can naturally induce atopy, at a dose of 5X10 8CFU was administered orally five times a week for five weeks. Simultaneously with the start of strain administration, 1.0% DNCB (2,4-Dinitrochlorobenzene) was applied to both ears of mice to induce atopic dermatitis for sensitization.

[0179] In both conditions, allergic atopic dermatitis was induced by applying 0.5% DNCB and house dust mites alternately to the ears of mice once a week for 6 weeks, starting 1 week after sensitization, at 3-4 day intervals (Fig. 14).

[0180] (2) Measurement of mouse ear thickness

[0181] As a result of measuring the ear thickness of the mice, the Mock group (negative control group) continued to increase in ear thickness until the end of the experiment, while the Healthy control group showed no change in ear thickness. The IMB001 Prevention group and the IMB001 Treatment group showed a significant suppression of the increase in ear thickness compared to the Mock group (Figs. 15a and 15b).

[0182] Through this, it was confirmed that Lactobacillus plantarum IMB19 has a preventive and therapeutic effect on atopic dermatitis in NC / Nga mice.

[0183] (3) Confirmation of efficacy in suppressing innate immune cell infiltration

[0184] To measure changes in the severity of atopic dermatitis, innate immune cells infiltrating ear tissue were analyzed by flow cytometry. Results showed that the percentage of eosinophils within the CD45+ CD11b+ Ly6G- population infiltrating ear tissue was significantly reduced in the IMB001 prevention group (Fig. 16).

[0185] Through this, it was confirmed that prophylaxis using Lactobacillus plantarumIMB19 could alleviate the symptoms and severity of atopic dermatitis in NC / Nga mice.

[0186] (4) Evaluation of cytokine induction and inhibition efficacy

[0187] Analysis of the cytokine production of CD4+ T cells in the ear skin tissue of each group of mice showed that IL-4+ CD4+ T cells and IL-13+ CD4+ T cells were significantly reduced in the IMB001 prevention group (Fig. 17).

[0188] Through this, it was confirmed that prevention using Lactobacillus plantarumIMB19 suppressed IL-4 induced by atopic dermatitis in NC / Nga mice and also suppressed the inflammatory response.

[0189] [Accession number]

[0190] Name of depositor: Korea Research Institute of Bioscience and Biotechnology

[0191] Accession number: KCTC14337BP

[0192] Date of acceptance: 20201021

[0193]

[0194]

Claims

1. A pharmaceutical composition for preventing or treating inflammatory skin disease containing Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP.

2. A pharmaceutical composition according to claim 1, wherein the Lactobacillus plantarum IMB19 KCTC 14337BP is in the form of a live cell, a dead cell, a culture, a lysate or an extract.

3. A pharmaceutical composition according to claim 1, wherein the inflammatory skin disease is at least one selected from the group consisting of atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, and lupus erythematosus.

4. A pharmaceutical composition according to claim 3, wherein the inflammatory skin disease is atopic dermatitis.

5. A food composition for preventing or improving inflammatory skin disease containing Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP.

6. A food composition according to claim 5, wherein the Lactobacillus plantarum IMB19 KCTC 14337BP is in the form of a live cell, a dead cell, a culture, a fragment, or an extract.

7. A food composition according to claim 5, wherein the inflammatory skin disease is at least one selected from the group consisting of atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, and lupus erythematosus.

8. A food composition according to claim 7, wherein the inflammatory skin disease is atopic dermatitis.

9. Animal feed additive for improving atopy containing Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP.

10. Lactobacillus plantarum IMB19 KCTC 14337BP for use in the prevention or treatment of inflammatory skin diseases.

11. Use of Lactobacillus plantarum IMB19 KCTC 14337BP in the manufacture of a drug for the treatment of inflammatory skin diseases.

12. A method for preventing or treating an inflammatory skin disease, comprising administering Lactobacillus plantarum IMB19 (Lactobacillus plantarumIMB19) KCTC 14337BP to an individual in need thereof.

Images