Guide agrna for regulating RNA splicing
By designing agRNA to recruit ADAR protein editing splicing sites, the problem of RNA splicing regulation has been solved, enabling precise regulation of target gene expression and showing broad potential for disease treatment.
Patent Information
- Application Number
- PCT/CN2025/098102
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-05-27
- Filing Date
- 2025-05-29
- Publication Date
- 2025-12-11
AI Technical Summary
Existing technologies are insufficient to effectively regulate RNA splicing, leading to abnormal gene expression and triggering various diseases, such as cancer and central nervous system degenerative diseases.
Design a guide agRNA that can bind to precursor mRNA, recruit ADAR proteins to specific splice sites for A-to-I editing, disrupt splice sites to control exon jumping, and regulate the RNA splicing process.
By editing splice sites, the mRNA expression and protein function of target genes can be altered, thereby achieving therapeutic effects on a variety of diseases.
Smart Images

Figure CN2025098102_11122025_PF_FP_ABST
Abstract
Description
Guide agRNA for regulating RNA splicing TECHNICAL FIELD
[0001] The present disclosure belongs to the field of biological medicine, and relates to a guide agRNA (ADAR guide RNA, agRNA) for regulating RNA splicing. BACKGROUND
[0002] Pre-mRNA splicing is a key step in the post-transcriptional regulation of gene expression, which can significantly expand the functional proteome of eukaryotes with limited number of genes. Protein-coding exonic sequences in eukaryotic genes are interrupted by introns, which are removed by a large and highly dynamic ribonucleoprotein complex called the spliceosome, which is composed of five small ribonucleoprotein (snRNP) complexes (U1, U2, U4, U5, and U6) and more than 150 other proteins. These snRNPs and additional non-snRNP-associated proteins (e.g., SF1, U2AF, and Prp19 complex) assemble on the pre-mRNA in an ordered process to sequentially form the pre-spliceosomal E, A, and B complexes. During this ordered process, complex binding and unbinding processes occur between these snRNPs and non-snRNP-associated proteins and the reaction sites, which provide multiple checking opportunities for the nucleosomes to ensure their accuracy of binding and thus improve the accuracy of site selection. Before the nucleosome assembly, U1 snRNP occupies the 5' splice site (5'-splice site, 5'SS), and SF1 binds to the branch site, which are both ATP-dependent and eventually form the pre-spliceosomal E complex. The snRNPs sequentially transition from the pre-spliceosomal E complex to the spliceosomal A, B, and C complexes with the involvement of ATP. Subsequently, the U2 snRNP replaces the SF1 binding to the branch site to form the A complex. Then, the pre-assembled U4-U6-U5 triplex complex and the NTC complex are recruited to the splice site to form the B complex. Subsequently, the U1 and U4 snRNPs are released from the complex, while the U6 snRNP binds to the 5' splice site together with the U2 snRNP. This replacement reaction facilitates the completion of the first transesterification reaction, i.e., cleaving the phosphodiester bond between the upstream exon and the intron, and simultaneously forming a 2' -5' phosphodiester bond between the guanosine at the 5'SS and the internal adenosine at the branch point (BP), generating a lariat intermediate, thus leading to the formation of the C complex. In the C complex, the second transesterification reaction is catalyzed to completion, i.e., cleaving the phosphodiester bond between the 3' splice site (3'-splice site, 3'SS) of the intron and the downstream exon, forming the intron lariat structure, and finally connecting the 3' and 5' ends of the exon to form the mature mRNA.
[0003] Alternative splicing (also known as "variable splicing") refers to the process in which different splicing methods during the process of pre-mRNA to mature mRNA make the same gene produce multiple different mature mRNAs, and ultimately produce different proteins, which is widely present in eukaryotic organisms. Studies have shown that among the genes containing multiple exons in the human genome, 95% of the genes have alternative splicing. Alternative splicing leads to polymorphism of transcripts and protein structure and function. The structural differences of various protein isoforms often affect the stability of the protein, the intracellular localization, the enzyme activity, and the interaction with other proteins or nucleic acids. Alternative splicing mainly includes cassette splicing, mutually exclusive exon splicing, variable start exon splicing, variable terminal exon splicing, 5' alternative splicing, 3' alternative splicing, intron retention splicing, and reverse splicing. Accurate splicing requires auxiliary sequences or structures that activate or suppress splicing site recognition, which are called intron or exon splicing enhancers or silencers. These elements enable the real splicing site to be recognized among a large number of excess cryptic sites or pseudo sites in the genomes of higher eukaryotes, which have the same sequence but are one order of magnitude more than the real sites. Alternative splicing is diverse in different tissues or different stages of development, and specific splicing isoforms are produced in specific tissues or conditions, thereby associating alternative splicing with normal life activities and diseases. A large number of studies have found that changes in alternative splicing are associated with various diseases such as cancer and central nervous system degenerative diseases. Abnormal alternative splicing, such as intron retention splicing caused by gene mutation, can introduce premature stop codons, which can trigger nonsense-mediated decay (NMD) and other RNA degradation mechanisms, leading to low expression of normal proteins and causing diseases.
[0004] Studies have shown that up to half of human genetic diseases can be caused by mutations affecting splicing. From the small nucleic acid drugs that have been approved for listing or are undergoing clinical experiments, it is clear that targeting and regulating the alternative splicing of pre-mRNA has high clinical treatment value. SUMMARY
[0005] In some embodiments, the present disclosure provides a method for regulating RNA splicing by RNA editing of an A base of a 3' splice site or a pseudo 3' splice site in a pre-mRNA, thereby causing exon skipping to change the expression of a target protein, thereby treating a disease.
[0006] In some embodiments, the present disclosure provides use of a guide agRNA (ADAR guide RNA, agRNA) in the manufacture of a medicament for altering expression of a target protein in a cell of a subject, the cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanking a 5’ splice site of the intron, and an exon flanking a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
[0007] In some embodiments, the present disclosure provides a method of altering expression of a target protein in a cell of a subject, wherein the cell has a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanking a 5’ splice site of the intron, and an exon flanking a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
[0008] The agRNA designed by the present disclosure can target and bind to the 3’ splice site or the pseudo 3’ splice site in the pre-mRNA of the target gene, edit the adenine in the NAG / N sequence of the 3’ splice site by recruiting ADAR protein to hypoxanthine, thereby destroying the 3’ splice site or the pseudo 3’ splice site, so that the exon flanking the edited 3’ splice site is skipped in the splicing process, thereby regulating the splicing of the pre-mRNA of the target gene, and affecting the expression and function of the mRNA and protein of the target gene.
[0009] In some embodiments, the guide agRNA is capable of recruiting ADAR to the 3’ splice site or the pseudo 3’ splice site to edit the A base of the 3’ splice site or the pseudo 3’ splice site, thereby causing the exon flanking the 3’ splice site or the pseudo 3’ splice site of the intron to be spliced from the pre-mRNA, resulting in skipping of the exon, thereby altering the expression level or sequence composition of the mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell.
[0010] In some embodiments, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein.
[0011] In some embodiments, the guide agRNA is unmodified or has a modification.
[0012] In some embodiments, the modification comprises a backbone modification, a sugar modification, or a base modification.
[0013] In some embodiments, the modification is selected from LNA, UNA, 2’-MOE, 2’-F, 2’-OMe, phosphorothioate modification, 5mC, polyethylene glycol modification, or DNA base substitution modification.
[0014] In some embodiments, the polyethylene glycol modification is selected from di-polyethylene glycol;
[0015] In some embodiments, the polyethylene glycol modified guide agRNA comprises two domains linked by a polyethylene glycol.
[0016] In some embodiments, the 5’ splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif.
[0017] In some embodiments, the 3’ splice site has a consensus NAG / N motif.
[0018] In some embodiments, the “N” is one of A, U, G, C base, and “ / ” is the exon-intron boundary.
[0019] In some embodiments, the adenine in the 3’ splice site NAG / N sequence is edited by ADAR.
[0020] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0021] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.
[0022] In some embodiments, the guide agRNA, after binding to the pre-mRNA, forms a complex capable of recruiting ADAR, which is capable of mutating the A in the NAG / N of the 3’ splice site of the pre-mRNA to G.
[0023] In some embodiments, the guide agRNA is fully complementary paired or incompletely complementary paired to the pre-mRNA.
[0024] In some embodiments, the incomplete base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region.
[0025] In some embodiments, the guide agRNA has at least one mismatch to the pre-mRNA.
[0026] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof.
[0027] In some embodiments, the base of the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C, or a base derivative thereof.
[0028] In some embodiments, the double-stranded RNA formed by the guide agRNA and the pre-mRNA is not fully base-paired.
[0029] In some embodiments, the complementary strand is base-paired at non-mismatch or non-deletion or non-bulge or non-internal loop or non-wobble base-pairing sites.
[0030] In some embodiments, the proportion of base-paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%.
[0031] In some embodiments, the proportion of base-paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%.
[0032] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein, and the editing efficiency of the pre-mRNA is greater than 1% after the binding.
[0033] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site.
[0034] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site.
[0035] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site.
[0036] In some embodiments, the sequence length of the guide agRNA is 10-300 bp.
[0037] In some embodiments, the sequence length of the guide agRNA is 20-150 bp.
[0038] In some embodiments, the sequence length of the guide agRNA is 25-100 bp.
[0039] In some embodiments, the sequence of the guide agRNA is 30-70 bp in length.
[0040] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity to the sequences set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.
[0041] In some embodiments, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO: 71.
[0042] In some embodiments, the drug is a drug for treating amyotrophic lateral sclerosis, cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal ganglia migraine, alternating hemiplegia of childhood, ataxia 2, familial hemiplegic migraine, spinocerebellar ataxia 6, mental retardation-23, 3p25 microdeletion syndrome, Fechtner- McDowell syndrome, schizophrenia-15, neurofibromatosis, type 2, meningioma, NF2- associated, schwannomatosis 1, hereditary sensory neuropathy type IE, autosomal dominant cerebellar ataxia, deafness, and paroxysmal sleepiness, Pitt Hopkins syndrome, Smith-Magenis syndrome, peroxisome biogenesis disorder la, Heimler syndrome-1, metachromatic leukodystrophy, vanishing white matter leukodystrophy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile convulsions with paroxysmal kinesigenic choreoathetosis, paroxysmal kinesigenic dyskinesia 1, benign familial infantile convulsions 2, or generalized epilepsy with febrile seizures plus type 9.
[0043] In some embodiments, the disclosure provides use of a guide agRNA in the manufacture of a medicament for treating a disease in a subject in need thereof by altering expression of a target protein or functional RNA in a cell of the subject, the cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanking a 5’ splice site of the intron, and an exon flanking a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
[0044] In some embodiments, the disclosure provides a method of treating a disease in a subject in need thereof by altering expression of a target protein or functional RNA in a cell of the subject, wherein a guide agRNA is administered to the subject; the cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanking a 5’ splice site of the intron, and an exon flanking a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
[0045] In some embodiments, the guide agRNA is capable of recruiting ADAR to the 3’ splice site or the pseudo 3’ splice site to edit the A base of the 3’ splice site or the pseudo 3’ splice site, thereby splicing the entire exon flanking the 3’ splice site or the pseudo 3’ splice site of the intron from the pre-mRNA, causing the exon to skip, thereby altering the level or sequence of a mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell.
[0046] In some embodiments, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein.
[0047] In some embodiments, the guide agRNA is unmodified or has a modification.
[0048] In some embodiments, the guide agRNA comprises a backbone modification, comprises a sugar modification, or comprises a base modification.
[0049] In some embodiments, the chemical modification is selected from LNA, UNA, 2’-MOE, 2’-F, 2’-OMe, 5mC, polyethylene glycol modification, or DNA base substitution modification.
[0050] In some embodiments, the polyethylene glycol modification is selected from a dimeric polyethylene glycol.
[0051] In some embodiments, the PEG-modified guide agRNA comprises two domains linked by a polyethylene glycol.
[0052] In some embodiments, the 5' splice site has the consensus NNN / GUNNNN or NNN / GCNNNN motif.
[0053] In some embodiments, the 3' splice site has the consensus N / AGN motif.
[0054] In some embodiments, the "N" is any base and " / " is the exon-intron boundary.
[0055] In some embodiments, the adenine in the 3' splice site N / AGN sequence is edited by ADAR.
[0056] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0057] In some embodiments, the guide agRNA has at least one mismatch with the pre-mRNA.
[0058] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof.
[0059] In some embodiments, the guide agRNA forms a double stranded RNA with the pre-mRNA that is not perfectly base-paired.
[0060] In some embodiments, the imperfect base-pairing is a complementation with one or more mismatches, wobbles, deletions, and / or bulges in the targeted region.
[0061] In some embodiments, the complementary strands are base-paired at non-mismatch or non-deletion or non-bulge or non-internal loop or non-wobble base-pairing sites.
[0062] In some embodiments, the guide agRNA forms a double stranded RNA with the pre-mRNA that has a greater than 60% proportion of complementarily paired bases.
[0063] In some embodiments, the guide agRNA forms a double stranded RNA with the pre-mRNA that has a greater than 75% proportion of complementarily paired bases.
[0064] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with the ADAR protein, and the pre-mRNA is edited with an editing efficiency of greater than 1%.
[0065] In some embodiments, the guide agRNA targets a location of the pre-mRNA within a region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site.
[0066] In some embodiments, the guide agRNA targets a location of the pre-mRNA within a region of 500 bp upstream to 500 bp downstream relative to the 3' splice site.
[0067] In some embodiments, the guide agRNA targets a location of the pre-mRNA within a region of 100 bp upstream to 100 bp downstream relative to the 3' splice site.
[0068] In some embodiments, the guide agRNA has a sequence length of 10-300 bp.
[0069] In some embodiments, the guide agRNA has a sequence length of 20-150 bp.
[0070] In some embodiments, the guide agRNA has a sequence length of 25-100 bp.
[0071] In some embodiments, the guide agRNA has a sequence length of 30-70 bp.
[0072] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to the sequences set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.
[0073] In some embodiments, the sequence of the guide agRNA is selected from the group of SEQ ID NO: 56 and SEQ ID NO: 70, or from the group of SEQ ID NO: 60 and SEQ ID NO: 71.
[0074] In some embodiments of the guide agRNA, the drug is a drug for treating amyotrophic lateral sclerosis, cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal ganglia migraine, alternating hemiplegia of childhood, ataxia-2, familial hemiplegic migraine, spinocerebellar ataxia 6, mental retardation-23, 3p25 microdeletion syndrome, Fechtel-McDermid syndrome, schizophrenia-15, neurofibromatosis, type 2, meningioma, NF2-related, schwannomatosis 1, hereditary sensory neuropathy type IE, autosomal dominant cerebellar ataxia, deafness, and narcolepsy, Pitt Hopkins syndrome, Smith-Magenis syndrome, peroxisome biogenesis disorder la, Heimler syndrome-1, metachromatic leukodystrophy, vanishing white matter leukodystrophy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile convulsions with paroxysmal kinesigenic choreoathetosis, paroxysmal kinesigenic dyskinesia 1, benign familial infantile convulsions 2, or generalized epilepsy with febrile seizures plus type 9.
[0075] In some embodiments, the present disclosure provides a method of editing a target RNA in a host cell, comprising: introducing a construct comprising a nucleic acid encoding a guide agRNA into the host cell, wherein: (1) the host cell has a precursor mRNA encoding a target protein, wherein the precursor mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; (2) the host cell is contacted with the guide agRNA; (3) the host cell contains ADAR, and the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex with ADAR protein.
[0076] In some embodiments, the guide agRNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit the A base of the 3' splice site or the pseudo 3' splice site, thereby splicing out the entire exon flanked by the 3' splice site or the pseudo 3' splice site of the intron from the precursor mRNA to cause the exon skipping, to change the level or sequence of the mature mRNA encoding the target protein, and to change the expression level or function of the target protein in the cell.
[0077] In some embodiments, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Navl.1 protein.
[0078] In some embodiments, the guide agRNA is unmodified or has a modification.
[0079] In some embodiments, the modification is selected from LNA, UNA, 2’-MOE, 2’-F, 2’-OMe, phosphorothioate modification, 5mC, polyethylene glycol modification, or DNA base replacement modification.
[0080] In some embodiments, the polyethylene glycol modification is selected from a dimeric polyethylene glycol.
[0081] In some embodiments, the polyethylene glycol modified guide agRNA comprises two domains linked by a polyethylene glycol.
[0082] In some embodiments, the 5’ splice site has a consensus NNN / GUNNNN or NNN / GCNNNN sequence.
[0083] In some embodiments, the 3’ splice site has a consensus N / AGN sequence.
[0084] In some embodiments, the “N” is any base and “ / ” is the exon-intron boundary.
[0085] In some embodiments, the adenine in the 3’ splice site N / AGN sequence is edited by ADAR.
[0086] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0087] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.
[0088] In some embodiments, the base in the guide agRNA that binds to the A base of the 3’ splice site or pseudo 3’ splice site is one of C, A, G, or I, or a base derivative thereof.
[0089] In some embodiments, the base in the guide agRNA that binds to the A base of the 3’ splice site or pseudo 3’ splice site is C or a base derivative thereof.
[0090] In some embodiments, the guide agRNA forms a double stranded RNA with the pre-mRNA that is a perfect complement pair or an imperfect complement pair.
[0091] In some embodiments, the imperfect base pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region.
[0092] In some embodiments, the guide agRNA has at least one mismatch to the pre-mRNA.
[0093] In some embodiments, the complementary strand is base-paired at a non-mismatched or non-deleted or non-bulged or non-internal loop or non-wobbled base pairing site.
[0094] In some embodiments, the guide agRNA forms a double-stranded RNA with the pre-mRNA with a complementary base pairing ratio of greater than 60%.
[0095] In some embodiments, the guide agRNA forms a double-stranded RNA with the pre-mRNA with a complementary base pairing ratio of greater than 75%.
[0096] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein, and the editing efficiency of the pre-mRNA is greater than 1% after the binding.
[0097] In some embodiments, the guide agRNA targets a position of the pre-mRNA within a region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site.
[0098] In some embodiments, the guide agRNA targets a position of the pre-mRNA within a region of 500 bp upstream to 500 bp downstream relative to the 3' splice site.
[0099] In some embodiments, the guide agRNA targets a position of the pre-mRNA within a region of 100 bp upstream to 100 bp downstream relative to the 3' splice site.
[0100] In some embodiments, the guide agRNA has a sequence length of 10-300 bp. In some embodiments, the guide agRNA has a sequence length of 20-150 bp. In some embodiments, the guide agRNA has a sequence length of 20-100 bp. In some embodiments, the guide agRNA has a sequence length of 30-70 bp.
[0101] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity to the sequences set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.
[0102] In some embodiments, the sequence of the guide agRNA is selected from a combination of SEQ ID NO: 56 and SEQ ID NO: 70, or a combination of SEQ ID NO: 60 and SEQ ID NO: 71.
[0103] In some embodiments, the present disclosure provides a method of screening or designing a guide agRNA, comprising designing a guide agRNA capable of binding to a pre-mRNA of a gene of interest to form a structure capable of recruiting an ADAR in a cell, the pre-mRNA comprising an intron, an exon flanked by a 5’ splice site of the intron, and an exon flanked by a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of recruiting the ADAR to the 3’ splice site or the pseudo 3’ splice site to edit an A base of the 3’ splice site or the pseudo 3’ splice site; determining the results of the expression level of the gene, the percentage of exon or pseudo exon skipping, or the editing level of the pre-mRNA of the gene of interest after the editing; screening the guide agRNA of interest according to the results.
[0104] In some embodiments, the guide agRNA is capable of recruiting the ADAR to the 3’ splice site or the pseudo 3’ splice site to edit an A base of the 3’ splice site or the pseudo 3’ splice site, thereby splicing the entire exon flanked by the 3’ splice site or the pseudo 3’ splice site of the intron from the pre-mRNA to cause the exon skipping, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell.
[0105] In some embodiments, the screening or designing method comprises the following steps: (1) transfecting a reporter plasmid of a target gene into a cell overexpressing ADAR gene; (2) transfecting a guide agRNA to be screened into the cell of step (1); (3) determining the expression of the target gene RNA, the percentage of exon or pseudo-exon skipping, or the editing level.
[0106] In some embodiments, in the determination of step (3), total RNA is extracted from the cell obtained after transfection of step (2), and cDNA is reverse transcribed from the total RNA, and the determination is performed again using the cDNA as a template.
[0107] In some embodiments, in order to measure the editing level of the editing site using the raw sequencing file obtained by Sanger sequencing, a software is used to analyze the peak values of A, T, G, and C of each base in the upstream and downstream regions of the editing site.
[0108] In some embodiments, the calculation method of the RNA editing level of the target gene is 100*(1-A peak value / A+T+C+G peak value sum).
[0109] In some embodiments, the software is EditR software.
[0110] In some embodiments, the determination of the percentage of exon or pseudo-exon skipping comprises: using the cDNA as a template, amplifying the target gene using a primer pair, and detecting the PCR product using agarose gel electrophoresis to analyze the gray scale of the result map.
[0111] In some embodiments, the calculation method of the percentage of exon or pseudo-exon skipping is: percentage of exon or pseudo-exon skipping = gray scale value of exon or pseudo-exon skipping gene / (gray scale value of exon or pseudo-exon skipping gene + gray scale value of exon or pseudo-exon containing gene).
[0112] In some embodiments, the determination step of the expression of the target gene RNA comprises: using the cDNA as a template, performing real-time quantitative PCR using a primer pair, and detecting the expression amount of the target gene exon or pseudo-exon containing gene, wherein the lower the expression amount, the higher the degree of exon or pseudo-exon skipping.
[0113] In some embodiments, the disclosure provides a guide agRNA or a complementary sequence thereof used in the application or the method.
[0114] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity to the sequence as set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.
[0115] In some embodiments, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or the combination of SEQ ID NO: 60 and SEQ ID NO: 71.
[0116] In some embodiments, the present disclosure provides a pharmaceutical composition comprising the guide agRNA or the complement thereof and a pharmaceutically acceptable excipient, diluent, or carrier.
[0117] In some embodiments, the agRNA referred to in the present disclosure is an isolated agRNA. BRIEF DESCRIPTION OF DRAWINGS
[0118] FIG. 1 is a map of a LRRK2 gene reporter plasmid.
[0119] FIG. 2 is a map of an APP gene reporter plasmid.
[0120] FIG. 3 is a map of a CFTR gene reporter plasmid.
[0121] FIG. 4 is a map of a UNC13A gene reporter plasmid.
[0122] FIG. 5 is the expression verification result of a LRRK2 gene reporter plasmid.
[0123] FIG. 6 is the expression verification result of an APP gene reporter plasmid.
[0124] FIG. 7 is the expression verification result of a CFTR gene reporter plasmid.
[0125] FIG. 8 is the expression verification result of a UNC13A gene reporter plasmid.
[0126] Figure 9 is the expression verification result of the endogenous MDM4 gene.
[0127] Figure 10 is the result of detecting agRNA-mediated exon splicing jump targeting the 3' splice site of exon 17 of the APP gene. (A) Agarose gel electrophoresis detection result of APP gene RNA expression. (B) APP gene exon 17 jump percentage result. (C) APP gene exon 17 containing gene expression amount result. (D) Editing efficiency result of A base in AG sequence of 3' splice site of exon 17 of APP gene pre-mRNA.
[0128] Figure 11 is the APP gene Sanger sequencing original map.
[0129] Figure 12 is the result of splicing jump of exons or pseudoexons promoted by ADAR protease. (A) Comparison result of agarose gel electrophoresis detection of APP gene RNA expression of HEK293T-ADAR-OE group and HEK293T-ADAR-KO group. (B) Comparison result of APP gene exon or pseudoexon jump percentage of HEK293T-ADAR-OE group and HEK293T-ADAR-KO group.
[0130] Figure 13 is the result of detecting agRNA-mediated exon splicing jump targeting the 3' splice site of exon 17 of the APP gene. (A) Agarose gel electrophoresis detection result of APP gene RNA expression. (B) APP gene exon 17 jump percentage result. (C) APP gene exon 17 containing gene expression amount result. (D) Editing efficiency result of A base in AG sequence of 3' splice site of exon 17 of APP gene pre-mRNA.
[0131] Figure 14 is the APP gene Sanger sequencing original map.
[0132] Figure 15 is the result of agRNA-mediated splicing jump of exons in APP gene pre-mRNA of different lengths. (A) Agarose gel electrophoresis detection result of APP gene RNA expression. (B) APP gene exon 17 jump percentage result. (C) APP gene exon 17 containing gene expression amount result. (D) Editing efficiency result of A base in AG sequence of 3' splice site of exon 17 of APP gene pre-mRNA.
[0133] Figure 16 is the APP gene Sanger sequencing original map.
[0134] Figure 17 is an agRNA-mediated exon skipping effect of targeting the 3' splice site of exon 41 of LRRK2. (A) Agarose gel electrophoresis detection results of LRRK2 gene RNA expression. (B) Exon 41 skipping percentage results of LRRK2 gene. (C) Expression amount of exon 41 containing gene results of LRRK2 gene. (D) Fold change of exon 41 skipping gene results of LRRK2 gene. (E) Editing efficiency results of A base in AG sequence of 3' splice site of exon 41 of LRRK2 gene pre-mRNA.
[0135] Figure 18 is a Sanger sequencing original map of LRRK2 gene.
[0136] Figure 19 is an agRNA-mediated exon skipping effect of targeting the 3' splice site of exon 23 of CFTR gene. (A) Agarose gel electrophoresis detection results of CFTR gene RNA expression. (B) Exon 23 skipping percentage results of CFTR gene. (C) Expression amount of exon 23 containing gene results of CFTR gene. (D) Editing efficiency results of A base in AG sequence of 3' splice site of exon 23 of CFTR gene pre-mRNA.
[0137] Figure 20 is a Sanger sequencing original map of CFTR gene.
[0138] Figure 21 is an agRNA-mediated exon skipping effect of targeting the 3' splice site of pseudo-exon of UNC13A gene. (A) Agarose gel electrophoresis detection results of UNC13A gene RNA expression. (B) TDP-43 gene fold change results. (C) UNC13A gene fold change results. (D) UNC13A abnormal splicing gene fold change results. (E) Editing efficiency results of A base in AG sequence of 3' splice site of Exon20N of UNC13A gene pre-mRNA.
[0139] Figure 22 is a Sanger sequencing original map of UNC13A gene.
[0140] Figure 23 is an agRNA-mediated exon skipping effect of targeting the 3' splice site of exon 6 of MDM4 gene. (A) Agarose gel electrophoresis detection results of MDM4 gene RNA expression. (B) Exon 6 skipping percentage results of MDM4 gene. (C) Expression amount of exon 6 containing gene results of MDM4 gene. (D) Editing efficiency results of A base in AG sequence of 3' splice site of exon 6 of MDM4 gene pre-mRNA.
[0141] Figure 24 is a Sanger sequencing original map of MDM4 gene.
[0142] Figure 25 shows detection of different structural agRNA targeting the 3' splice site of exon 41 of LRRK2. (A) Agarose gel electrophoresis detection results of LRRK2 gene RNA expression. (B) Results of the percentage of LRRK2 gene exon 41 skipping. (C) Results of the change fold of LRRK2 gene exon 41 skipping gene. (D) Results of the expression amount of LRRK2 gene containing exon 41. (E) Results of the editing efficiency of the A base in the AG sequence of the 3' splice site of exon 41 of the LRRK2 gene pre-mRNA.
[0143] Figure 26 shows the expression vector map of SCN1A. (A) pCAG-mSCN1A-WPRE plasmid map. (B) pCMV(CAT)T7-SB100 plasmid map.
[0144] Figure 27 shows the verification results of SCN1A gene transcription expression of mSCN1A-Hela stable cell strain.
[0145] Figure 28 shows the functional verification of agRNA targeting the 3' splice site of SCN1A gene pseudo-exon. (A) is the transcription expression result of SCN1A gene. (B) is the percentage of SCN1A gene productive transcription product. (C) is the expression of SCN1A gene productive transcription product detected by fluorescence quantitative PCR. (D) is the expression of SCN1A gene non-productive transcription product detected by fluorescence quantitative PCR. (E) is the editing efficiency result. DETAILED DESCRIPTION
[0146] The technical solutions of the present disclosure are further illustrated by specific examples below, which do not represent a limitation on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others according to the concept of the present disclosure still fall within the protection scope of the present disclosure.
[0147] Certain definitions
[0148] In the present application, the term "RNA editing" generally refers to the realization of RNA regulation by editing the target RNA. In the present application, the purpose of RNA editing can be to change the base of the target RNA, and can be to regulate the gene expression amount of the target RNA. The editing of adenosine to inosine in the target RNA can be realized by expressing a specially designed RNA to recruit the endogenous deaminase ADAR in the cell.
[0149] In the present application, the term "guide agRNA", also known as "ADAR guide RNA", abbreviated as "agRNA", generally refers to an oligonucleotide in single-stranded or double-stranded form which is artificially synthesized. The structure and binding site of the agRNA can be modified. In the present application, the agRNA can be in single-stranded form, and its function can be to complementarily pair with a specific sequence of the target RNA and edit it.
[0150] In the present application, the term "target RNA", also known as "target RNA" or "Target RNA", can be used interchangeably in the present application, and generally refers to an RNA containing a target site. In the present application, the target RNA can be pre-mRNA, mRNA, rRNA, tRNA, Inc-RNA, snRNA, snoRNA, microRNA, etc. Mutations in certain nucleotide sites can cause different types of functional differences in target RNA, such as abnormal splicing, alternative splicing of RNA, truncation, extension, and misfolding of protein, etc.
[0151] In the present application, the term "target site", also known as "editing site", can be used interchangeably in the present application, and generally refers to the site edited by the agRNA in RNA editing. In the present application, the target site can be adenosine.
[0152] In the present application, the terms "complementarily paired", "complementary", and "paired" can be used interchangeably, and generally refer to Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. In the present application, base pairing can refer to A-T, C-G, T*A / T, C*G / C. In the present application, complementarily paired can be complete complementarily paired, or there can be one or more bulges, wobbles, deletions, and / or mismatches between nucleic acid molecules. In the present application, the agRNA can form a double-stranded complex with the target RNA through complementarily pairing.
[0153] In the present application, the term "bulge" generally refers to a region where the upstream and downstream bases of the bulge region are complementarily paired with the target RNA strand and the corresponding two bases of the target RNA strand are continuous. In the present application, the term "wobble" generally refers to G-U pairing. In the present application, the term "deletion" generally refers to a region where the upstream and downstream bases of the deletion region are continuous, and there are corresponding number of bases in the target RNA strand in the deletion region. In the present application, the term "mismatch" generally refers to a pair of nucleotides in a double-stranded RNA complex that are not perfectly base-paired according to Watson-Crick base pairing rules. The type of mismatch can be one of A-A, A-G, A-C, U-U, U-C, G-G, G-A, C-A, C-C, C-U.
[0154] In the present application, the term "perfectly complementary pairing" generally refers to the presence of only strict Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. Perfectly complementary pairing is absent of bulges, wobbles, deletions, and / or mismatches.
[0155] In the present application, the term "pseudo 3' splice site" generally has the same splice recognition sequence as a true splice site, but is not used in the splicing reaction. Pseudo 3' splice sites have the same NAG / N motif as 3' splice sites, where N is any nucleotide, and / is the exon-intron boundary. The number of pseudo 3' splice sites is an order of magnitude greater than the number of true splice sites in the human genome, and are generally repressed by molecular mechanisms that are not well understood to date. Activation of pseudo 3' splice sites is positively influenced by surrounding nucleotides that make the pseudo 3' splice site more similar to the optimal consensus sequence YAG / G of true splice sites, where Y is C or U.
[0156] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes multiple such methods, and reference to "the fragment" includes reference to one or more fragments and equivalents thereof known to those skilled in the art, and so forth.
[0157] The term "and / or", as used herein, refers to and encompasses any and all possible combinations of one or more of the associated listed items. The term "and / or" when used in a list of two or more items, means that any one of the listed items can be employed by itself, or any combination of two or more of the listed items can be employed. For example, if a composition, combination, formulation, or the like is described as comprising (or containing) components A, B, C, and / or D, the composition can comprise (or contain) A alone; B alone; C alone; D alone; a combination of A and B; a combination of A and C; a combination of A and D; a combination of B and C; a combination of B and D; a combination of C and D; a combination of A, B, and C; a combination of A, B, and D; a combination of A, C, and D; a combination of B, C, and D; or a combination of A, B, C, and D.
[0158] It is further understood that where the term "comprising" is used in the description of the various embodiments of the application, it is to be understood that it is not intended to be a limiting term in that it does not exclude the presence of one or more additional statements, features, compositions, steps, or components, but rather it is intended to be a broad term that encompasses one or more additional statements, features, compositions, steps, or components.
[0159] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although many methods and reagents are similar or identical to those described herein, exemplary methods and materials are disclosed.
[0160] It should be understood that the present disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments or aspects only and is not intended to limit the scope of the present disclosure.
[0161] When the sequence listing is inconsistent with the specification, the specification of the application prevails.
[0162] Herein, the blank control group refers to a group that is not transfected with agRNA.
[0163] Herein, pre-mRNA (pre-mRNA) refers to the primary transcription product produced during the process of gene transcription, which contains a mixed sequence composed of exon and intron sequences.
[0164] Herein, mature mRNA (mature mRNA) is a pre-mRNA molecule that has been processed during splicing. The intron sequence in the pre-mRNA is removed, and the exon sequence is connected together to generate a mature mRNA molecule containing only the information required to encode a protein. This mature mRNA molecule can be translated into a protein and participate in the biological activities of the cell.
[0165] Herein, "base derivative" refers to a modification on the basis of the base, for example, the C base can be replaced with 5mC (5-methylcytosine) and the like.
[0166] Herein, LN represents a locked nucleic acid (LNA) modification, fN represents a 2'-F modification, mN represents a 2'-OMe modification, eN represents a 2'-MOE modified base, "*" represents a phosphorothioate bond, and L5mN represents a 5-methyl base modified with LNA.
[0167] In the following examples herein, the capital letter base N represents the base of DNA, and the lowercase letter base N represents the RNA base.
[0168] Herein, PEG2 refers to a PEG2 (dimeric ethylene glycol) modification, specifically referring to using PEG2 as a linker to connect the two bases upstream and downstream in the agRNA.
[0169] Herein, unless otherwise specified, the sequence is from left to right as 5'→3'. Patent application CN202410712187.1 is incorporated by reference in its entirety herein.
[0170] Example 1: Method for constructing a reporter plasmid of LRRK2, APP, CFTR and UNC13A genes
[0171] 1. Human LRRK2 gene reporter plasmid:
[0172] Using human genomic DNA as a template, three fragments of the LRRK2 gene were amplified by PCR, and homologous arms were added. The first fragment was located at the genomic site Human GRCh37 / hg19: chr12+: 40728619-40729109; the second fragment was located at the genomic site Human GRCh37 / hg19: chr12+: 40733946-40734406; and the third fragment was located at the genomic site Human GRCh37 / hg19: chr12+: 40740405-40740875. The pcDNA3.1 vector was linearized by double digestion with Nhe I and Hind III, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The LRRK2 gene reporter plasmid map is shown in FIG. 1.
[0173] 2. Human APP gene reporter plasmid:
[0174] Using human genomic DNA as a template, three fragments of the APP gene were amplified by PCR, and homologous arms were added. The first fragment was located at the genomic site Human GRCh37 / hg19: chr21-: 27269736-27270135; the second fragment was located at the genomic site Human GRCh37 / hg19: chr21-: 27263884-27264330; and the third fragment was located at the genomic site Human GRCh37 / hg19: chr21-: 27252861-27254232. The pcDNA3.1 vector was linearized by double digestion with Nhe I and Hind III, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The APP gene reporter plasmid map is shown in FIG. 2.
[0175] 3. Human CFTR gene reporter plasmid:
[0176] PCR was used to amplify three fragments of the CFTR gene from the human genomic DNA template, and homologous arms were added. The first fragment was located at the genomic site Human GRCh37 / hg19: chr7+: 117267426-117267974; the second fragment was located at the genomic site Human GRCh37 / hg19: chr7+: 117282342-117282797; and the third fragment was located at the genomic site Human GRCh37 / hg19: chr7+: 117292746-117293135. The pcDNA3.1 vector was linearized by double digestion with Nhe I and Hind III, and the three fragments were connected to the pcDNA3.1 vector by homologous recombination. The CFTR gene reporter plasmid map is shown in FIG. 3.
[0177] 4. Human UNC13A gene reporter plasmid:
[0178] PCR was used to amplify a fragment of the UNC13A gene from the human genomic DNA template, and homologous arms were added. The fragment was located at the genomic site Human GRCh37 / hg19: chr19-: 17752002-17753969. The pcDNA3.1 vector was linearized by double digestion with Nhe I and Hind III, and the fragment was connected to the pcDNA3.1 vector by homologous recombination. The UNC13A gene reporter plasmid map is shown in FIG. 4.
[0179] Example 2: Verification of gene expression and RNA abnormal splicing of the reporter plasmid
[0180] HEK293T cells were seeded in a 24-well cell culture plate, and after 12 hours, the reporter plasmid of Example 1 was transfected into the cells using Lipofectamine 3000 reagent, with 500 ng of plasmid transfected per well. After 24 hours of plasmid transfection, the total RNA of the cells was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novizen, catalog number: RC101-01) according to the instructions.
[0181] The RNA was reversely transcribed to obtain cDNA by using HiScript III 1st Strand cDNA Synthesis Kit(+gDNA wiper) (manufacturer: Novoprotein, product number: R312-02) according to the instructions. Then, the LRRK2, APP, CFTR, UNC13A and MDM4 gene fragments were amplified by using 2x Taq PCR StarMix (manufacturer: GenStar, product number: A012) kit according to the instructions with the cDNA as the template. The expression and splicing of the reporter gene RNA are shown in FIGS. 5 to 9. The experimental results show that the gene reporter plasmid constructed in Example 1 can correctly express the corresponding gene fragments in cells, and can be effectively used to verify the function of the agRNA designed in the disclosure in subsequent examples.
[0182] Example 3 agRNA-mediated RNA editing promotes the splicing skipping of exon 17 in APP pre-mRNA
[0183] The HEK293T-ADAR-OE cells were inoculated in a 24-well cell culture plate, and after 12 hours, the reporter plasmid was transfected into the cells by using Lipofectamine 3000 reagent, and 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA (SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3) was respectively transfected into the cells by using Lipofectamine RNAiMAX. TM RNAiMAX into the cells. After 48 hours of agRNA transfection, the total RNA of the cells was extracted by using FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novoprotein, product number: RC101-01) according to the instructions.
[0184] Detection of the expression and splicing of the target gene RNA: The cDNA was used as the template to amplify the APP gene with Primer 1-F and Primer 1-R by using the 2x Taq PCR StarMix kit (manufacturer: GenStar, product number: A012) according to the instructions. The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection. Subsequently, the gray scale analysis of the result graph was performed to calculate the percentage of exon or pseudo-exon skipping (percentage of exon or pseudo-exon skipping = gray value of exon or pseudo-exon skipping gene / (gray value of exon or pseudo-exon skipping gene + gray value of exon or pseudo-exon containing gene)). The results are shown in FIGS. 10A and 10B.
[0185] Real-time fluorescent quantitative PCR detection: The ChamQ SYBR qPCR MasterMix kit (manufacturer: Novozyme, product number: Q311-02) was used to detect the expression of the exon 17 containing gene of the APP gene by real-time fluorescent quantitative PCR with Primer 2-F and Primer 2-R as the primer pair and cDNA as the template according to the instructions. The blank control group was used for normalization to calculate the gene expression change fold. The results are shown in FIG. 10C. The lower the expression of the exon 17 containing gene, the better the effect of the exon 17 skipping induced by the agRNA.
[0186] Preparation of Sanger sequencing samples: The cDNA was used as the template to amplify the APP gene with Primer 3-F and Primer 3-R by using the 2x Taq PCR StarMix kit (manufacturer: GenStar, product number: A012) according to the instructions. The PCR product was subjected to Sanger sequencing. The results are shown in FIG. 10D and FIG. 11.
[0187] Measurement of the RNA editing level by Sanger data: The raw sequencing file obtained by Sanger sequencing needs to measure the editing level of the editing site. The EditR software (https: / / moriaritylab.shinyapps.io / editr_v10 / ) is used for calculation and analysis. The software analyzes the peak value of each base of A, T, G and C in the upstream and downstream regions of the editing site. The calculation method of the editing level is 100*(1-A peak value / A+T+C+G peak value sum). The raw Sanger sequencing map is shown in FIG. 11.
[0188] The experimental results are shown in Figure 10. Both agRNAs SEQ ID NO: 2 and SEQ ID NO: 3 targeting the 3' splice site of exon 17 of the APP gene can induce the splicing jump of the 17th exon of the reporter gene in the cell, and the effect is better than the ASO (SEQ ID NO: 1) disclosed in the prior art (reference: Jennifer L Chang, et al. Targeting Amyloid-β Precursor Protein, APP, Splicing with Antisense Oligonucleotides Reduces Toxic Amyloid-b Production. Mol Ther. 2018.). On the other hand, SEQ ID NO: 2 is a 2'-OME modification on the base opposite to the editing site based on SEQ ID NO: 3, so that SEQ ID NO: 2 cannot induce RNA editing. The experimental results show that the A base in the AG sequence of the 3' splice site of the 17th exon of the APP gene pre-mRNA has an average editing efficiency of 10% after adding SEQ ID NO: 3. The splicing jump effect of the 17th exon mediated by SEQ ID NO: 3 is significantly better than that of SEQ ID NO: 2 which cannot induce RNA editing. It is proved that by ADAR-mediated RNA editing acting on the 3' splice site of the exon, editing the A in the AG sequence to I base to destroy the 3' splice site can effectively improve the splicing jump of the exon in the pre-mRNA of the target gene. That is, the higher the efficiency of agRNA-mediated RNA editing, the better the effect of induced exon splicing jump.
[0189] Table 1
[0190] Table 2 APP gene detection primer sequence
[0191] Example 4 Binding of ADAR protease promotes splicing jump of exon or pseudo-exon
[0192] HEK293T-ADAR-OE (ADAR1 gene overexpression) and HEK293T-ADAR-KO (ADAR1 gene knockout) cells were seeded in a 24-well cell culture plate, and after 12 hours, APP reporter plasmid was transfected into the cells using Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA (SEQ ID NO: 10) was added to the culture medium of the cells using Lipofectamine 3000 reagent, and the cells were cultured for 48 hours. The cells were collected and the total RNA was extracted, and the splicing jump of the 17th exon of the reporter gene was detected by RT-PCR. TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Norgen, product number: RC101-01) according to the instructions. Then the RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Norgen, product number: R312-02) according to the instructions.
[0193] The APP gene was amplified by Primer 1-F and Primer 1-R primers according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection. Then the gray scale analysis of the result map was carried out, and the results are shown in Figures 12A and 12B.
[0194] Experimental results: after agRNA (SEQ ID NO: 10) was transfected into cells, it could target and bind to the 3' splice site of exon 17 of the APP gene to form double-stranded RNA, and recruit ADAR proteinase to bind to the 3' splice site of exon 17 of the APP gene. However, because the base at the editing site and the editing site adjacent to SEQ ID NO: 10 has 2'-OME modification, agRNA SEQ ID NO: 10 cannot induce RNA editing. As shown in Figure 12, the effect of SEQ ID NO: 10 on inducing the splicing jump of exon 17 of the APP reporter gene in HEK293T-ADAR-OE cells was higher than that in HEK293T-ADAR-KO cells, indicating that the binding of ADAR proteinase to the 3' splice site can increase the splicing jump of the exon.
[0195] Table 3
[0196] Example 5 agRNA targeting different regions mediating splicing jump of exon 17 in APP gene pre-mRNA
[0197] HEK293T-ADAR-OE cells were seeded in a 24-well cell culture plate, and after 12 hours, the reporter plasmid was transfected into the cells using Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA was transfected into the cells using Lipofectamine 3000 reagent, and the transfection was carried out for 48 hours. TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.
[0198] The APP gene was amplified by Primer 1-F and Primer 1-R primer pair according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection. Then the gray scale analysis of the result map was performed, and the results are shown in Figures 13A and 13B. The expression amount of APP gene exon 17 containing gene was detected by real-time fluorescent quantitative PCR with Primer 2-F and Primer 2-R primer pair, and the results are shown in Figure 13C. The APP gene was amplified by Primer 3-F and Primer 3-R primer pair, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 13D and Figure 14.
[0199] Experimental results: as shown in Figure 13, agRNA targeting different regions of the 3' splice site of exon 17 of the APP gene (such as SEQ ID NO: 11-13) can induce RNA editing of the 3' splice site of exon 17 in pre-mRNA of the APP gene in cells, and can induce splicing skipping of exon 17 of the reporter gene, and the effect is better than that of the prior art ASO (SEQ ID NO: 1).
[0200] Table 4
[0201] Example 6 agRNA of different lengths mediating splicing skipping of exon 17 in pre-mRNA of the APP gene
[0202] HEK293T-ADAR-OE cells were seeded in a 24-well cell culture plate, and after 12 hours, the reporter plasmid was transfected into the cells by Lipofectamine 3000 reagent, and 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA was transfected into the cells by Lipofectamine 3000 reagent, and the transfection was performed according to the instructions. TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.
[0203] The APP gene was amplified by Primer1-F and Primer1-R primer pairs according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was performed, and the results are shown in Figures 15A and 15B. The expression amount of APP gene exon 17 containing gene was detected by real-time fluorescent quantitative PCR with Primer2-F and Primer2-R primer pairs, and the results are shown in Figure 15C. The APP gene was amplified by Primer3-F and Primer3-R primer pairs, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 15D and Figure 16.
[0204] Experimental results: as shown in Figure 15, different lengths of agRNA targeting the 3' splice site of exon 17 of the APP gene SEQ ID NO: 3, SEQ ID NO: 13 and SEQ ID NO: 14 can all induce RNA editing of the 3' splice site of exon 17 in pre-mRNA of the APP gene in cells, and can all induce splicing skipping of exon 17 of the reporter gene, and the effects are all better than that of the prior art ASO (SEQ ID NO: 1).
[0205] Table 5
[0206] Example 7 agRNA-mediated RNA editing promotes splicing skipping of exon 41 in pre-mRNA of LRRK2 gene
[0207] HEK293T-ADAR-OE cells were seeded in 24-well cell culture plates, and after 12 hours, the reporter plasmid was transfected into the cells by Lipofectamine 3000 reagent, and 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA was transfected into the cells by Lipofectamine 3000 reagent, and the transfection was performed according to the instructions of the reagent. TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reverse transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.
[0208] The LRRK2 gene was amplified by Primer4-F and Primer4-R primer pairs according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was performed, as shown in Figures 17A and 17B. The expression amount of LRRK2 gene exon 41 inclusion gene was detected by real-time fluorescent quantitative PCR with Primer5-F and Primer5-R primer pairs, and the expression amount of LRRK2 gene exon 41 skipping gene was detected by real-time fluorescent quantitative PCR with Primer6-F and Primer5-R primer pairs, as shown in Figures 17C and 17D. The LRRK2 gene was amplified by Primer7-F and Primer7-R primer pairs, and the PCR product was subjected to Sanger sequencing, as shown in Figure 17E and Figure 18.
[0209] Table 6 LRRK2 gene detection primer sequences
[0210] Experimental results: as shown in Figure 17, the agRNA (SEQ ID NO: 22) targeting the 3' splice site of exon 41 of the LRRK2 gene can induce RNA editing of the 3' splice site of exon 41 in the pre-mRNA of the LRRK2 gene in cells, and can induce splicing skipping of exon 41 of the reporter gene, and the effect is better than the ASO (SEQ ID NO: 23) of the prior art (Reference: Joanna A Korecka, et al. Splice-Switching Antisense Oligonucleotides Reduce LRRK2 Kinase Activity in Human LRRK2 Transgenic Mice. Molecular therapy. 2020.).
[0211] Table 7
[0212] Example 8 agRNA-mediated RNA editing promotes splicing skipping of exon 23 in CFTR gene pre-mRNA
[0213] HEK293T-ADAR-OE cells were seeded in 24-well cell culture plates, and 12 hours later, reporter plasmid was transfected into cells with Lipofectamine 3000 reagent, 500 ng plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into cells with Lipofectamine 3000 reagent. 48 hours after agRNA transfection, total RNA of cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reverse transcribed to cDNA with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions. TM RNAiMAX was transfected into cells. 48 hours after transfection of agRNA, total RNA of cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reverse transcribed to cDNA with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.
[0214] According to the detection method in Example 3, the CFTR gene was amplified with Primer 8-F and Primer 8-R primer pairs, and the PCR products were subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was performed, and the results are shown in Figures 19A and 19B. The expression amount of CFTR gene exon 23 containing gene was detected by real-time fluorescent quantitative PCR with Primer 9-F and Primer 9-R primer pairs, and the results are shown in Figure 19C. The CFTR gene was amplified with Primer 10-F and Primer 10-R primer pairs, and the PCR products were subjected to Sanger sequencing, and the results are shown in Figure 19D and Figure 20.
[0215] Table 8 CFTR gene detection primer sequences
[0216] Experimental results: as shown in Figure 19, the agRNA (SEQ ID NO: 30) targeting the 3' splice site of exon 23 of the CFTR gene can induce RNA editing of the 3' splice site of exon 23 in the pre-mRNA of the CFTR gene in cells, and can induce splicing skipping of exon 23 of the reporter gene, and the effect is better than the ASO (SEQ ID NO: 31) of the prior art (reference: Young Jin Kim, et al. Exon skipping antisense oligonucleotides for cystic fibrosis therapy. Proc Natl Acad Sci U S A. 2022.).
[0217] Table 9
[0218] Example 9 agRNA-mediated RNA editing promotes splicing skipping of Exon 20N in pre-mRNA of UNC13A gene
[0219] HEK293T-ADAR-OE cells were seeded in 24-well cell culture plates, and 12 hours later, 20 pmol of control siRNA or siTDP-43 was transfected into cells with Lipofectamine TM RNAiMAX. 36 hours after transfection of siRNA, reporter plasmid was transfected into cells with Lipofectamine 3000 reagent, 500 ng plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into cells with Lipofectamine TM RNAiMAX. 36 hours after transfection of siRNA, reporter plasmid was transfected into cells with Lipofectamine 3000 reagent, 500 ng plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into cells with Lipofectamine
[0220] The detection method in Example 3 was used to amplify the UNC13A gene with Primer 11-F and Primer 11-R primer pairs, and the PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection, and the results are shown in Figure 21A.
[0221] The expression amount of total mRNA of TDP-43 gene was detected by real-time fluorescent quantitative PCR with Primer 15-F and Primer 15-R primer pairs, and the results are shown in Figure 21B. The expression amount of total mRNA of UNC13A gene was detected by real-time fluorescent quantitative PCR with Primer 12-F and Primer 12-R primer pairs, and the results are shown in Figure 21C.
[0222] The expression amount of pseudo-exon containing gene of UNC13A gene was detected by real-time fluorescent quantitative PCR with Primer 13-F and Primer 13-R primer pairs, and the results are shown in Figure 21D. The UNC13A gene was amplified with Primer 14-F and Primer 14-R primer pairs, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 21E and Figure 22.
[0223] Table 10 Primer sequences for detection of UNC13A gene
[0224] The experimental results: the UNC13A reporter plasmid is normally expressed and spliced in HEK293T-ADAR-OE cells, but when the TDP-43 gene in the cells is knocked down by siRNA, the UNC13A reporter gene will be abnormally spliced during the splicing of the pre-mRNA due to the absence of TDP-43 protein, and three forms of transcripts containing the pseudo-exon Exon20N in the mature mRNA will be expressed, as shown in FIG. 21A. The results show that the agRNA targeting the 3' splice site of the pseudo-exon of the UNC13A gene can induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the UNC13A gene in cells, and can induce splicing skipping of the pseudo-exon of the reporter gene. The agRNAs of the present disclosure SEQ ID NO: 43 and SEQ ID NO: 44 are superior to the ASO (SEQ ID NO: 42) of the prior art (reference: X Rosa Ma, et al. TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A. Nature. 2022).
[0225] Table 11
[0226] Example 10: agRNA-mediated RNA editing promotes splicing skipping of exon 6 in MDM4 gene pre-mRNA
[0227] Hela cells were seeded in a 24-well cell culture plate, and 20 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 48 hours after transfection. Total RNA was extracted from the cells according to the instructions of the FastPure Cell / Tissue Total RNA Isolation Kit cell / tissue total RNA extraction kit. Then the RNA was reverse transcribed to obtain cDNA according to the instructions of the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper).
[0228] The MDM4 gene was amplified with the Primer 16-F and Primer 16-R primer pairs according to the detection method in Example 3, and the PCR products were subjected to 2% agarose gel electrophoresis and gel exposure detection, followed by gray scale analysis of the result map, as shown in FIGS. 23A and 23B. The expression amount of the MDM4 gene exon 6 containing gene was detected by real-time fluorescent quantitative PCR with the Primer 17-F and Primer 17-R primer pairs, as shown in FIG. 23C. The MDM4 gene fragment was amplified with the Primer 18-F and Primer 18-R primer pairs, and the PCR products were subjected to Sanger sequencing, as shown in FIG. 23D and FIG. 24.
[0229] Table 12 MDM4 gene detection primer sequences
[0230] Experimental results: As shown in FIG. 23, the agRNAs (SEQ ID NO: 52 and SEQ ID NO: 53) targeting the 3' splice site of exon 6 of the MDM4 gene can all induce RNA editing of the 3' splice site of exon 6 in the endogenous MDM4 gene pre-mRNA, and can all induce splicing skipping of exon 6 in the endogenous MDM4 gene pre-mRNA, and the effects are all better than that of the prior art (reference: Michael Dewaele, et al. Antisense oligonucleotide-mediated MDM4 exon 6 skipping impairs tumor growth. J Clin Invest. 2016.) ASO (SEQ ID NO: 51).
[0231] Table 13
[0232] Example 11 agRNAs with different structures mediate RNA editing to promote splicing skipping of exon 41 in LRRK2 gene pre-mRNA
[0233] To verify the effect of RNA editing mediated by agRNA of different structures on RNA splicing, several agRNAs of different structures were designed. SEQ ID NO: 54 and SEQ ID NO: 55 are a chemically modified oligonucleotide comprising a first domain and a second domain, the first domain and the second domain being connected by a linker, for example, a common chemical structure PEG2. Both the first domain and the second domain can target and bind to the pre-mRNA of the target gene and mediate ADAR protease-based RNA editing. SEQ ID NO: 56 and SEQ ID NO: 70 are a chemically modified oligonucleotide, wherein SEQ ID NO: 56 is the first domain and SEQ ID NO: 70 is the second domain. The first domain and the second domain can form double-stranded RNA through an in vitro annealing program and target and bind to the pre-mRNA of the target gene, mediating ADAR protease-based RNA editing.
[0234] Hela cells were seeded in a 24-well cell culture plate, and 12 hours later, the reporter plasmid was transfected into the cells using Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 100 pmol of agRNA was transfected into the cells using Lipofectamine TM RNAiMAX. After 48 hours of agRNA transfection, total RNA was extracted from the cells using the FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reverse transcribed to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.
[0235] According to the detection method in Example 3, the LRRK2 gene was amplified using Primer4-F and Primer4-R primers, and the PCR product was subjected to 2% agarose gel electrophoresis and exposed for gel detection, and then the gray scale analysis of the result graph was performed, and the results are shown in Figures 25A and 25B. The expression amount of the LRRK2 gene exon 41 inclusion gene was detected by real-time fluorescent quantitative PCR using Primer5-F and Primer5-R primer pairs, and the expression amount of the LRRK2 gene exon 41 skipping gene was detected by real-time fluorescent quantitative PCR using Primer6-F and Primer5-R primer pairs, and the results are shown in Figures 25C and 25D. The LRRK2 gene was amplified using Primer7-F and Primer7-R primers, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 25E.
[0236] Experimental results: As shown in Figure 25, the agRNA targeting the 3' splice site of exon 41 of the LRRK2 gene can induce RNA editing of the 3' splice site of exon 41 in the pre-mRNA of the LRRK2 gene in cells, and can induce splicing skipping of exon 41 of the reporter gene.
[0237] Table 14
[0238] Example 12 Functional verification of agRNAs with different structures
[0239] In order to verify the function of agRNAs with different structures, several agRNAs with different structures were designed. SEQ ID NO: 58 and SEQ ID NO: 59 are a chemically modified oligonucleotide comprising a first domain and a second domain, the first domain and the second domain being connected by a linker, for example a common chemical structure PEG2. The first domain and the second domain can both target and bind to the pre-mRNA of the target gene, mediating ADAR enzyme-based RNA editing. SEQ ID NO: 60 and SEQ ID NO: 71 are a chemically modified oligonucleotide, wherein SEQ ID NO: 60 is the first domain and SEQ ID NO: 71 is the second domain. The first domain and the second domain can form double-stranded RNA through an in vitro annealing program and target and bind to the pre-mRNA of the target gene, mediating ADAR enzyme-based RNA editing. The steps include:
[0240] 1. Construction of mSCN1A-Hela stable cell strain and detection of gene expression
[0241] Construction of pCAG-mSCN1A-WPRE plasmid: The sequence of SCN1A gene in the SCN1A gene reporter plasmid of murine origin was amplified by PCR and homologous arms were added to obtain an insertion fragment. The pCAG-WPRE was linearized by double digestion with NheI and SpeI and the insertion fragment was connected to the vector by homologous recombination to obtain the pCAG-mSCNA-WPRE plasmid.
[0242] According to the conventional cell passage and transfection steps, the SCN1A expression vector pCAG-mSCNA-WPRE (Figure 26A) and pCMV(CAT)T7-SB100 (Figure 26B) plasmids were co-transfected into Hela cells. 48 hours after transfection, G418 was added, and the medium was changed every two days. When there were no living cells in the untransfected group, the selection of Hela cell strain stably expressing murine SCN1A gene was completed, and the mSCN1A-Hela stable cell strain was obtained.
[0243] The obtained mSCN1A-Hela stable cell strain was inoculated in a 24-well cell culture plate, and 12 hours later, 20 pmol of positive drug ASO was transfected into the cells using Lipofectamine TM RNAiMAX. 48 hours after transfecting the ASO, total RNA was extracted from the cells using a FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Norgen, catalog number: RC101-01) according to the instructions. Then, the RNA was reverse transcribed to obtain cDNA using a HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Norgen, catalog number: R312-02) according to the instructions. Then, PCR amplification was performed using a 2x Taq PCR StarMix (manufacturer: GenStar, catalog number: A012) kit according to the instructions, with cDNA as the template and primer pair Mouse-F: CCCTAAGAGCCTTATCACGATTT (SEQ ID NO: 61) and Mouse-R: TAACAGGGCATTCACAACCA (SEQ ID NO: 62). The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection.
[0244] The results are shown in Figure 27. The mSCN1A-Hela stable cell strain can stably express the mouse SCN1A gene fragment, and there are two types of transcription products, a non-productive transcription product containing a pseudo-exon and a productive transcription product not containing a pseudo-exon. After treatment with the positive drug (SEQ ID NO: 63: LC*LA*LA*g*u*u*g*g*a*g*c*a*a*g*a*u*u*a*u*c*c*c*a*u*a*c*a*a*a*a*LT*LA*LG), the non-productive transcription product decreased and the productive transcription product significantly increased, indicating that the mSCN1A-Hela stable cell strain constructed in the present disclosure can be effectively used to verify the function of the agRNA targeting the pseudo-exon of the mouse SCN1A gene.
[0245] 2. Verification of the function of the agRNA targeting the 3' splice site of the pseudo-exon of the mouse SCN1A gene in Hela cells
[0246] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene was inoculated in a 24-well cell culture plate, and 12 hours later, 100 pmol of agRNA was transfected into the cells using Lipofectamine TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions. The expression of SCN1A gene in cells and the editing of pre-mRNA target site of SCN1A gene were detected according to the method of Example 3:
[0247] The expression changes of the productive transcription product of SCN1A gene in cells transfected with mouse SCN1A gene reporter plasmid were detected by real-time fluorescent quantitative PCR using ChamQ SYBR qPCR Master Mix Kit according to the instructions, with cDNA as template, and MPrimerl-F and MPrimerl-R primer pairs. The expression changes of the non-productive transcription product of SCN1A gene were detected by real-time fluorescent quantitative PCR using 2x Taq PCR StarMix Kit according to the instructions, with cDNA as template, and MPrimer2-F and MPrimer2-R primer pairs. The pre-mRNA of SCN1A gene in cells transfected with mouse SCN1A gene reporter plasmid was amplified by 2x Taq PCR StarMix Kit according to the instructions, with cDNA as template, and MPrimer3-F and MPrimer3-R primer pairs, and the editing efficiency of the target site was detected.
[0248] Table 15 Sequences of primers for detection of mouse SCN1A gene
[0249] The experimental results are shown in Figure 28. The results show that different structures of agRNA targeting the 3' splice site of pseudo-exon of SCN1A gene can induce RNA editing of the 3' splice site of pseudo-exon in pre-mRNA of SCN1A gene in cells (Figure 28E), can induce splicing skipping of pseudo-exon of SCN1A gene in cells (Figures 28A and 28B), can increase the expression of productive SCN1A gene (Figure 28C), and can reduce the expression of non-productive SCN1A gene (Figure 28D). Some agRNAs are superior to the ASO of the prior art (SEQ ID NO: 57)
[0250] (Reference: Zhou Han, et al. Antisense oligonucleotides increase Scn1a expression and reduce seizures and SUDEP incidence in a mouse model of Dravet syndrome. Sci Transl Med. 2020.).
[0251] The embodiments described in the present disclosure are only illustrative examples, and do not limit the embodiments of the present disclosure. Any other changes, modifications, replacements, combinations and simplifications made without departing from the spirit and principles of the present disclosure shall be equivalent replacement manners, and shall belong to the protection scope of the present disclosure.
Claims
1. Use of a guide agRNA in the manufacture of a medicament for altering the expression of a target protein by a cell of a subject, wherein, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanking the 5' splice site of the intron, and an exon flanking the 3' splice site or pseudo 3' splice site of the intron; The guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
2. A method of altering the expression of a target protein by a cell of a subject, wherein, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanking the 5' splice site of the intron, and an exon flanking the 3' splice site or pseudo 3' splice site of the intron; The guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
3. Use according to claim 1 or 2, wherein, The guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo 3' splice site to edit the A base of the 3' splice site or pseudo 3' splice site, thereby splicing the entire exon flanking the 3' splice site or pseudo 3' splice site of the intron from the precursor mRNA to skip the exon, thereby changing the expression level or sequence composition of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4 or Nav1.1 protein; Preferably, the guide agRNA is unmodified or has a modification; Preferably, the modification comprises a backbone modification, a sugar modification or a base modification; Preferably, the modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, phosphorothioate modification, 5mC, polyethylene glycol modification or DNA base substitution modification; Preferably, the polyethylene glycol modification is selected from di-polyethylene glycol; Preferably, the polyethylene glycol modified guide agRNA comprises two domains connected by polyethylene glycol; Preferably, the 5' splice site has a common NNN / GUNNNN or NNN / GCNNNN motif; Preferably, the 3' splice site has a common NAG / N motif; Preferably, the "N" is one of A, U, G, C base, and " / " is the exon-intron boundary; Preferably, the adenine in the NAG / N sequence of the 3' splice site is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, after the guide agRNA binds to the precursor mRNA to form a complex capable of recruiting ADAR, the A in the NAG / N of the 3' splice site of the precursor mRNA is mutated to G; Preferably, the guide agRNA is completely complementary or incompletely complementary to the precursor mRNA; Preferably, the imperfect base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges to the targeting region; Preferably, the guide agRNA has at least one mismatch to the pre-mRNA; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof; Preferably, the guide agRNA forms a double-stranded RNA with the pre-mRNA that is imperfectly base complementary paired.
4. Use according to any one of claims 1 to 3, wherein The complementary strands are base complementary paired at non-mismatched or non-deleted or non-bulged or non-internal looped or non-wobbled base pairing sites; Preferably, the proportion of complementary paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%; Preferably, the proportion of complementary paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%; Preferably, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein and editing the pre-mRNA with an editing efficiency of greater than 1%.
5. The use according to any one of claims 1 to 4, wherein The position of the guide agRNA targeting the pre-mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site; Preferably, the sequence length of the guide agRNA is 10-300 bp; Preferably, the sequence length of the guide agRNA is 20-150 bp; Preferably, the sequence length of the guide agRNA is 25-100 bp; Preferably, the sequence length of the guide agRNA is 30-70 bp; Preferably, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity to the sequence as set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or the combination of SEQ ID NO: 60 and SEQ ID NO: 71; Preferably, the drug is a drug for treating amyotrophic lateral sclerosis, cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal ganglia migraine, alternating hemiplegia of childhood, ataxia 2, familial hemiplegic migraine, spinocerebellar ataxia 6, mental retardation-23, 3p25 microdeletion syndrome, Fechtner syndrome, schizophrenia-15, neurofibromatosis, type 2, meningioma, NF2-related, schwannomatosis 1, hereditary sensory neuropathy type IE, autosomal dominant cerebellar ataxia, deafness and paroxysmal sleepiness, Pitt Hopkins syndrome, Smith-Magenis syndrome, peroxisome biogenesis disorder la, Heimler syndrome-1, metachromatic leukodystrophy, vanishing white matter leukodystrophy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile convulsions with paroxysmal kinesigenic choreoathetosis, paroxysmal kinesigenic dyskinesia 1, benign familial infantile convulsions 2, or generalized epilepsy with febrile seizures plus type 9.
6. Use of a guide agRNA in the manufacture of a medicament for treating a disease in a subject in need thereof by altering expression of a target protein or functional RNA by a cell of the subject, wherein, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; The guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
7. A method of treating a disease in a subject in need thereof by altering the expression of a target protein or functional RNA by a cell of the subject, wherein, administering to a subject a guide agRNA; the cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
8. The use as claimed in claim 6 or the method as claimed in claim 7, wherein, the guide agRNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit the A base of the 3' splice site or the pseudo 3' splice site, thereby splicing the entire exon flanked by the 3' splice site or the pseudo 3' splice site of the intron from the precursor mRNA to cause the exon to skip, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; preferably, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein; preferably, the guide agRNA is unmodified or has a modification; preferably, the guide agRNA comprises a backbone modification, comprises a backbone modification, a sugar modification, or a base modification; preferably, the chemical modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, phosphorothioate modification, 5mC, polyethylene glycol modification, or DNA base substitution modification; preferably, the polyethylene glycol modification is selected from di-polyethylene glycol; preferably, the polyethylene glycol modified guide agRNA comprises two domains linked by polyethylene glycol; preferably, the 5' splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif; preferably, the 3' splice site has a consensus N / AGN motif; preferably, the "N" is any base, and " / " is the exon-intron boundary; preferably, the adenine in the 3' splice site N / AGN sequence is edited by ADAR; preferably, the ADAR editing is ADAR-mediated A-to-I editing; preferably, the ADAR is selected from ADAR1 or ADAR2; preferably, the guide agRNA, after binding to the precursor mRNA to form a complex capable of recruiting ADAR, is capable of causing the A in NAG / N of the 3' splice site of the precursor mRNA to be mutated to G; preferably, the guide agRNA is completely complementary or incompletely complementary to the precursor mRNA; preferably, the incomplete base complementation is a complementation with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region; preferably, the guide agRNA has at least one mismatch to the precursor mRNA; preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or the pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof; Preferably, the base of the guide agRNA binding to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof; Preferably, the double-stranded RNA formed by the guide agRNA and the pre-mRNA is incompletely base-paired; Preferably, the incomplete base-pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges in the targeted region; Preferably, the complementary strand is base-paired at non-mismatched or non-deleted or non-bulged or non-internal loop or non-wobbled base-pairing sites; Preferably, the proportion of complementary base-pairing in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%; Preferably, the proportion of complementary base-pairing in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%; Preferably, the guide agRNA can bind to the pre-mRNA to form a complex with an ADAR protein, and after editing the pre-mRNA, the editing efficiency is greater than 1%; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site; Preferably, the sequence length of the guide agRNA is 10-300 bp; Preferably, the sequence length of the guide agRNA is 20-150 bp; Preferably, the sequence length of the guide agRNA is 25-100 bp; Preferably, the sequence length of the guide agRNA is 30-70 bp; Preferably, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to the sequences as set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71. Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO:
71. Preferably, the drug is a drug for treating amyotrophic lateral sclerosis, cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basilar migraine, alternating hemiplegia of childhood, ataxia 2, familial hemiplegic migraine, spinocerebellar ataxia 6, mental retardation-23, 3p25 microdeletion syndrome, Fechtner syndrome, schizophrenia-15, neurofibromatosis, type 2, meningioma, NF2-related, schwannomatosis 1, hereditary sensory neuropathy type IE, autosomal dominant cerebellar ataxia, deafness, and narcolepsy, Pitt Hopkins syndrome, Smith-Magenis syndrome, peroxisome biogenesis disorder la, Heimler syndrome-1, metachromatic leukodystrophy, vanishing white matter leukodystrophy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile convulsions with paroxysmal kinesigenic choreoathetosis, paroxysmal kinesigenic dyskinesia 1, benign familial infantile convulsions 2, or generalized epilepsy with febrile seizures plus type 9.
9. A method of editing a target RNA in a host cell, wherein, Comprising: introducing a construct comprising a nucleic acid encoding a guide agRNA into the host cell, wherein: (1) the host cell has a precursor mRNA encoding a target protein, wherein the precursor mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; (2) the host cell is contacted with the guide agRNA; (3) the host cell contains ADAR, the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex with ADAR protein; Preferably, the guide agRNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit the A base of the 3' splice site or the pseudo 3' splice site, thereby splicing the entire exon flanked by the 3' splice site or the pseudo 3' splice site of the intron from the precursor mRNA to cause the exon skipping, to change the level or sequence of the mature mRNA encoding the target protein, and to change the expression level or function of the target protein in the cell; Preferably, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein; Preferably, the guide agRNA is unmodified or has a modification; Preferably, the modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, phosphorothioate modification, 5mC, polyethylene glycol modification, or DNA base replacement modification; Preferably, the polyethylene glycol modification is selected from diethylene glycol; Preferably, the polyethylene glycol modified guide agRNA comprises two domains linked by a polyethylene glycol; Preferably, the 5' splice site has a consensus NNN / GUNNNN or NNN / GCNNNN sequence; Preferably, the 3' splice site has a consensus N / AGN sequence; Preferably, the "N" is any base, and " / " is the exon-intron boundary; Preferably, the adenine in the 3' splice site N / AGN sequence is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof; Preferably, the double-stranded RNA formed by the guide agRNA and the pre-mRNA is incompletely complementary pairing or completely complementary pairing; Preferably, the incompletely base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges in the targeted region; Preferably, the guide agRNA has at least one mismatch with the pre-mRNA; Preferably, the complementary strands are base complementary paired at non-mismatched or non-deleted or non-bulged or non-looped or non-wobbled base pairing sites; Preferably, the proportion of complementary paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%; Preferably, the proportion of complementary paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%; Preferably, the guide agRNA can bind to the pre-mRNA to form a complex with an ADAR protein, and after editing the pre-mRNA, the editing efficiency is greater than 1%; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site; Preferably, the position of the guide agRNA targeting the pre-mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site; Preferably, the sequence length of the guide agRNA is 10-300 bp; Preferably, the sequence length of the guide agRNA is 20-150 bp; Preferably, the sequence length of the guide agRNA is 20-100 bp; Preferably, the sequence length of the guide agRNA is 30-70 bp; Preferably, the sequence of the guide agRNA is selected from at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity to the sequence as set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or the combination of SEQ ID NO: 60 and SEQ ID NO:
71.
10. A method of screening or designing a guide agRNA, wherein, comprising designing a guide agRNA capable of binding to a pre-mRNA of a gene of interest to form a structure capable of recruiting ADAR in a cell, the pre-mRNA comprising an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; the guide agRNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit an A base of the 3' splice site or the pseudo 3' splice site; determining the result of the expression level of the gene, the percentage of exon or pseudo exon skipping, or the editing level of the pre-mRNA of the gene of interest after the editing; screening a guide agRNA of interest according to the result; Preferably, the guide agRNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit an A base of the 3' splice site or the pseudo 3' splice site, thereby splicing the entire exon flanked by the 3' splice site or the pseudo 3' splice site of the intron from the pre-mRNA to cause the exon skipping, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the screening or designing method comprises the following steps: (1) transfecting a reporter plasmid of a gene of interest into a cell overexpressing ADAR gene; (2) transfecting a guide agRNA to be screened into the cell of step (1); (3) determining the expression of the RNA of the gene of interest, the percentage of exon or pseudo exon skipping, or the editing level; Preferably, in the determination of step (3), total RNA of the cells obtained after transfection in step (2) is extracted, the total RNA is reverse transcribed to obtain cDNA, and the cDNA is used as a template for further determination. Preferably, the RNA editing level of the target gene is measured by using the raw sequencing file obtained by Sanger sequencing to analyze the peak values of A, T, G and C at each base in the upstream and downstream regions of the editing site. Preferably, the calculation method of the RNA editing level of the target gene is 100*(1-A peak value / A+T+C+G peak value sum). Preferably, the software is EditR software. Preferably, the determination of the exon or pseudo-exon skipping percentage comprises: Using the cDNA as a template, a primer pair is used to amplify the target gene, and the PCR product is detected by agarose gel electrophoresis to analyze the gray scale of the result map. Preferably, the calculation method of the exon or pseudo-exon skipping percentage is: exon or pseudo-exon skipping percentage = exon or pseudo-exon skipping gene gray value / (exon or pseudo-exon skipping gene gray value + exon or pseudo-exon containing gene gray value). Preferably, the determination step of the expression of the target gene RNA comprises: Using the cDNA as a template, a primer pair is used to perform real-time quantitative PCR to detect the expression amount of the target gene exon or pseudo-exon containing gene, and the lower the expression amount, the higher the degree of exon or pseudo-exon skipping.
11. The guide agRNA or the complement thereof for use according to any one of claims 1-8, or the method according to claim 9, or the guide agRNA or the complement thereof for use in the method according to claim 9.
12. A guide agRNA, wherein, which comprises at least any one of the sequences having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to the sequence as set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, or SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60 or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO:
71.
13. A pharmaceutical composition, wherein, which comprises the guide agRNA or the complement thereof as set forth in claim 11 or 12 and a pharmaceutically acceptable excipient, diluent or carrier. which comprises the guide agRNA or the complement thereof as set forth in claim 11 or 12 and a pharmaceutically acceptable excipient, diluent or carrier.
Citation Information
Patent Citations
Single-stranded RNA-editing oligonucleotides
CN109477103A
RNA and DNA base editing via engneered ADAR recruitment
CN112996912A
Methods and Compositions for Editing RNAs
CN113631708A
Methods and compositions for editing rnas
CN113939591A
Methods and compositions for modulating splicing of selective introns
CN114127286A