Viral transduction device, viral transduction system and method thereof
The viral transduction system with a hollow fiber membrane improves transduction efficiency and scalability by automating the process, addressing low efficiency and high cost issues in conventional methods.
Patent Information
- Application Number
- PCT/SG2025/050366
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-20
- Filing Date
- 2025-05-30
- Publication Date
- 2025-12-26
AI Technical Summary
Conventional viral transduction processes face challenges such as low transduction efficiency, especially for 'hard-to-transduce' cells, requiring high viral doses and cell numbers, leading to off-target genome editing, high costs, and difficulty in scaling and automating the process.
A viral transduction system and device utilizing a hollow fiber membrane to facilitate controlled flow of feed media, enabling efficient transduction by maintaining cell-virus proximity and automating the process, reducing manual handling and infrastructure costs.
Enhances transduction efficiency, reduces viral doses, preserves cell viability, and allows scalable and automated viral transduction with consistent outcomes, minimizing human error and process uncertainties.
Smart Images

Figure SG2025050366_26122025_PF_FP_ABST
Abstract
Description
VIRAL TRANSDUCTION DEVICE, VIRAL TRANSDUCTION SYSTEM AND METHOD THEREOFCROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority to the Singapore application no. 1020240181 OP filed June 20, 2024, the contents of which are hereby incorporated by reference in their entirety for all purposes.TECHNICAL FIELD
[0002] This application relates to a viral transduction device, a viral transduction system, and a method of viral transduction.BACKGROUND
[0003] Viral transduction plays an important role in modifying cell genes for cell therapy. The viral transduction process involves selecting suitable viral vectors, modifying the genetic payload to carry certain target therapeutic genes, and introducing the engineered genes into cells by way of viral vectors which are capable of transporting therapeutic genes into cells, with all the above performed in a controlled laboratory setting.
[0004] Several challenges remain to be addressed in the conventional viral transduction process. For example, current processes are met with low to medium transduction efficiency, especially for “hard-to-transduce” cells. This inefficiency often necessitates the use of either high doses of viral vectors and / or high starting cell numbers to achieve sufficient numbers of transduced cells from the viral transduction process. However, high viral doses may result in a potential off-target genome editing, and this is in addition to high cost related to the viral vectors. A high starting cell number requires longer cell preparation time and higher cellpreparation cost. In addition, this may not be a practical solution for patients who are seriously ill and have limited number of viable cells available for the viral transduction process.
[0005] Further, conventional viral transduction processes are often performed manually and typically in open culture vessel(s). Skilled personnel are often needed to perform various specific tasks such as viral vector prepar ation, cell preparation and viral transduction, which in turn increases the manufacturing costs. Manual and open handling of viral vectors necessitates operation environment of high biosafety levels, further increasing the facility or infrastructure cost. In addition, conventional viral transduction processes are in general difficult to scale, thus is unable to meet the increasing demands for cell therapy.SUMMARY
[0006] According to an aspect, disclosed herein a method of viral transduction. The method comprises flowing a feed media into a first chamber of a housing, the first chamber being in fluid communication with an inlet port and an outlet port, the first chamber having a second chamber disposed therein, the second chamber defined by a hollow fiber membrane, the second chamber comprises a biological material disposed therein; harvesting the biological material by closing the outlet port of the first chamber, wherein the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber, forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction.; and applying a fluid pressure to the fluid flow from one of a pair of membrane ports, wherein the pair of membrane ports are in fluid communication with the second chamber.
[0007] According to another aspect, disclosed herein a viral transduction device. The viral transduction device comprises a housing defining a first chamber for flowing a feed media, the fust chamber being in fluid communication with an inlet port and an outlet port; a hollow fibermembrane, the hollow fiber membrane defining a second chamber in the first chamber, the second chamber for holding a biological material; wherein the hollow fiber membrane blocks transfer of the biological material from the second chamber to the first chamber, and allowing transfer of the feed media between the first chamber and the second chamber, wherein responsive to closing the outlet port of the first chamber, the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber, forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction, wherein the fluid flow' increases responsive to applying a fluid pressure to the fluid flow from one of a pair of membrane ports, wherein the pair of membrane ports are in fluid conununication with the second chamber.
[0008] According to another aspect disclosed herein a viral transduction system. The viral transduction system comprises a housing, the housing defining a first chamber for flowing a feed media therein, the first chamber being in fluid communication with an inlet port and an outlet port; and a hollow fiber membrane, the hollow fiber membrane defining a second chamber in the first chamber, the second chamber including a biological material disposed therein, w'herein the hollow fiber membrane blocks transfer of the biological material from the second chamber to the first chamber, and allowing transfer of the feed media between the first chamber and the second chamber; wherein the system is configured to perform a method including: flowing the feed media into the first chamber; harvesting the biological material by closing the outlet port of the first chamber, wherein the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber, forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction; and applying a fluid pressure to the fluid flow from one of a pair of membrane ports, wherein the pair of membrane ports are in fluid communication with the second chamber.BRIEF DESCRIPTION OF THE DRAWINGS
[0009] Various embodiments of the present disclosure are described below with reference to the following drawings:
[0010] FIG. 1 is a schematic diagram of a viral transduction system according to embodiments of the present disclosure;
[0011] FIG. 2 is a schematic of a viral transduction device according to embodiments of the present disclosure;
[0012] FIG. 3 is a sectional view of the viral transduction device of FIG. 2;
[0013] FIG. 4 is a sectional view of another viral transduction device according to embodiments of the present disclosure;
[0014] FIG. 5A is a schematic diagram of a viral transduction system in a biological material loading step according to embodiments of the present disclosure;
[0015] FIG. 5B is a schematic diagram of a viral transduction device in a biological material loading step according to embodiments of the present disclosure;
[0016] FIG. 6 A is a schematic diagram of a viral transduction system in a perfusion and transduction step according to embodiments of the present disclosure;
[0017] FIG. 6B is a schematic diagram of a viral transduction device in a perfusion and transduction step according to embodiments of the present disclosure;
[0018] FIG. 7A is a schematic diagram of a viral transduction system in a harvesting step according to embodiments of the present disclosure;
[0019] FIG. 7B is a schematic diagram of a viral transduction device in a harvesting step according to embodiments of the present disclosure;
[0020] FIG. 8 is a flow chart of a method of viral transduction according to embodiments of the present disclosure;[0021 J FIG. 9 is a schematic diagram of a viral transduction device where the cells and viral vectors are contained in the intracapillary (IC) of hollow fiber according to an exemplary implementation, wherein the perfusion of culture media and dissolved oxygen is carried out via the extracapillary (EC) of hollow fiber;
[0022] FIG. 10A is an image of a viral transduction system placed on a tray according to an exemplary implementation, the viral transduction system with a pair of hollow fiber (HF) cartridges connected to a gas exchanger (coiled gas permeable tubings), medium reservoir, and waste bottles;
[0023] FIG. 10B is a schematic diagram of the viral transduction system of FIG. 10A, with connection to a peristaltic pump and fresh media perfused through the gas exchanger, the EC of the HFs and finally into the waste bottle;
[0024] FIG. 11 is a schematic diagram illustrating a method of viral transduction, comprising the three steps: Loading; Perfusion and transduction, and Harvesting.
[0025] FIG. 12 illustrates a set up for loading of cells and viral vectors into the IC of HFs;
[0026] FIG. 13A is an image of a viral transduction system wherein a viral transduction device is connected to a peristaltic pump located outside an incubator according to an exemplary implementation;
[0027] FIG. 13B is a schematic diagram of the viral transduction system of FIG. 14 illustrating a connection of the transduction device during a perfusion and transduction step;
[0028] FIG. 14A shows the cell recovery' in HF and 24-well plate at 6.6x10’ T-cell seeding number, with 3 different donor cells used;
[0029] FIG. 14B shows the cell recovery comparison in HF and 24-well plate at 6.6xl05(LS) and 1.32xl06(HS) seeding numbers. The gap in cell recovery rate was attenuated upon seeding number increase. HF and 24-well plate demonstrated comparable cell recovery rate at seeding number of 1.32xl06cells. Data was analysed by Student’s T-test to determine thesignificance between each group (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). LS: Low seeding number. HS: High seeding number;
[0030] FIG. 15 shows the effects of transduction media height to transduction efficiency at different Multiplicity of Infection (MOI) levels in 24-well plate. Transduction efficiency was inversely proportional to transduction media height at MOI below 4. With MOI 4, the transduction efficiency peaked at 2.5mm transduction media height instead of 1mm;
[0031] FIGs. 16A to 16D show the analysis of transduction efficiency across different MOIs: (FIG. 16A) 1mm media height, (FIG. 16B) 2.5mm media height, (FIG. 16C) 4mm media height and (FIG. 16D) 6mm media height in 24-well plate;
[0032] FIG. 17 shows a workflow of a general validation protocol for the viral transduction device and viral transduction system of the exemplary implementation;
[0033] FIGs. 18A to 18D show the cell recovery rate analysis after harvesting in HF and 24- well plate over different transduction duration: (FIG. 18A) 2 hours transduction, (FIG. 18B) 4 hours transduction, (FIG. 18C) 18 hours transduction. (FIG. 18D) The relationship of transduction duration and cell recovery; 24wp control: cell culture in 24-well plate without transduction. 24wp (x mm): cell transduction in 24-well plate with x mm medium height.
[0034] FIGs. 19A to 19C show the cell growth after transduction in HF and 24-well plate. Cells were seeded on DO for transduction, harvested on DI (when transduction stopped) and expanded from DI to D3. Cell growth curve after (FIG. 19A) transduction of 2 hours, (FIG. 19B) transduction of 4 hours, (FIG. 19C) transduction of 18 hours. The cell growth posttransduction was similar among all groups;
[0035] FIGs. 20A to 20C show the analysis of CD3 expression in HF and 24-well plate over different transduction duration: (FIG. 20A) 2 hours, (FIG. 20B) 4 hours and (FIG. 20C) 18 hours;
[0036] FIGs. 21A to 21C show the analysis of transduction efficiency in HF and 24-well plate over different transduction duration: (FIG. 21A) 2 hours, (FIG. 21B) 4 hours, (FIG. 21C) 18 hours;
[0037] FIG. 2 ID shows the transduction efficiency comparison in 24-well plate (4 hours and 2 hours of transduction with 2.5mm media height) with HF (2 hours of transduction);
[0038] FIGs. 22A and 22B show the cell recovery and cell growth analysis of cells transduced in HF and 24-well plate (0.5mm media height) with different MOI. FIG. 22A shows cell recovery percentage after harvesting on DI. FIG. 22B shows cell growth curve post transduction;
[0039] FIG. 23 shows the CD3 expression analysis of cells transduced in HF and 24-well plate with different viral dose, with HF enhanced CD3 population compared to 24-well plate groups with!8 hours of perfusion;
[0040] FIG. 24 shows the transduction efficiency analysis of HF and 24-well plate with different viral dose;
[0041] FIGs. 25 A to 25C show the comparison of T cells incubated for 18 hours without viral transduction in TransB (Hollow Fiber, HF) or 24-well plates, with similar (FIG. 25 A) live cell recovery rates, (FIG. 25B) cell growth, and (FIG. 25C) cell viability across two initial seeding densities; TransB: the viral transduction device. LS: low seeding (6.6 x 105cells); HS: high seeding (1.32 x 106cells);
[0042] FIGs. 25D to 25F show the comparison of T cells transduced with Lenti-GFP for 18 hours in TransB or 24-well plates, showing comparable (FIG. 25D) live cell recovery rates, (FIG. 25E) cell growth, and (FIG. 25F) cell viability.
[0043] FIG. 26A shows the transduction efficiency of T cells following incubation for 2, 4, and 18 hours in either TransB or static 24-well plate conditions. MOI= 1;
[0044] FIG. 26B shows the fold change in transduction efficiency achieved by TransB compared to static transduction across the three time points. MOI= 1;
[0045] FIG. 26C shows the transduction efficiency at different multiplicities of infection (MOIs: 0.5, 1, and 2) using TransB and static transduction. Duration =18 hours;
[0046] FIG. 26D shows the fold change in transduction efficiency between TransB and static conditions across different MOIs. Duration =18 hours;
[0047] FIG. 26E shows the transduction efficiency at two seeding densities: low seeding (LS, 6.6 x 105cells) and high seeding (HS, 1.32 x 106cells). MOI=1, Duration =18 hours;
[0048] FIG. 26F shows the fold change in transduction efficiency in TransB relative to static transduction at both seeding densities. MOI=1, Duration =18 hours, n = 1 (pilot study);
[0049] FIG. 27A shows the comparison of cell recovery rates after the harvest step at the end of transduction;
[0050] FIG. 27B shows the cell growth tracking post-transduction;
[0051] FIG. 27C shows the cell viability tracking post-transduction;
[0052] FIG. 27D shows the percentage of CD3+ T-cells on Day 4 post-transduction;
[0053] FIG. 27E shows the CD4 / CD3 and CD8 / CD3 ratios of cells on Day 4 posttransduction;
[0054] FIG. 27F shows the memory phenotype distribution on Day 4 post-transduction, (TN;CCR7+ CD45RA+, TCM; CCR7+ CD45RA-, TEM; CCR7- CD45RA-; TEMRA; CCR7- CD45RA+);
[0055] FIG. 27G shows the transduction efficiency (%GFP+) of CD3+, CD4+ and CD8+ T- cells respectively on Day 4 post-transduction;
[0056] FIG. 27H shows the fold increase in transduction efficiency between TransB and static transduction in 24-well plates;
[0057] FIG. 271 shows the transduction efficiency (%GFP+) of TN, TCM, TEM and TEMRA respectively on Day 4 post-transduction;
[0058] FIG. 27J shows the fold increase in transduction efficiency across memory subsets between TransB and static transduction in 24-well plates, with the gating strategy for each subset;
[0059] FIG. 27K shows the vector copy number (VCN) per cell on Day 4 post-transduction. N=3;
[0060] FIG. 28A shows the different hollow fibres used for TransB (L) and TransB (S) to support different cell numbers; TransB(L): transduction device with larger volume; TransB(B): transduction device with smaller volume
[0061] FIG. 28B shows the comparison of cell recovery rates after the harvest step;
[0062] FIG. 28C shows the cell growth tracking post-transduction;
[0063] FIG. 28D shows the cell viability tracking post-transduction;
[0064] FIG. 28E show's the percentage of CD3+ T-cells on Day 4 post-transduction;
[0065] FIG. 28F shows the CD4 / CD3 and CD8 / CD3 ratios on Day 4 post-transduction;
[0066] FIG. 28G show's the memory phenotype distribution on Day 4 post-transduction, (TN;CCR7+ CD45RA+, TCM; CCR7+ CD45RA-, TEM; CCR7- CD45RA-; TEMRA; CCR7- CD45RA+);
[0067] FIG. 28H shows the transduction efficiency (%GFP+) of CD3+, CD4+ and CD8+ T- cells respectively on Day 4 post-transduction;
[0068] FIG. 281 shows the fold increase in transduction efficiency between TransB(L) and TransB(S);
[0069] FIG. 28J shows the transduction efficiency (%GFP+) of TN, TCM, TEM and TEMRA respectively on Day 4 post-transduction, with the gating strategy for each subset;
[0070] FIG. 28K shows the fold increase in transduction efficiency across memory subsets between TransB and static transduction in 24-well plates;
[0071] FIG. 28L shows the VCN per cell on Day 4 post-transduction. N=3;
[0072] FIG. 29A shows the cell recovery rate in TransB and 24-well plate following the harvest process at the end of each respective transduction duration; MOI=1
[0073] FIG. 29B shows the cell growth monitored after transduction in TransB and 24-well plate for each respective duration; MOI=1
[0074] FIG. 29C shows the cell viability monitored after transduction in TransB and 24-well plate for each respective duration. MO 1=1
[0075] FIGs. 29D to 29F show for different MOIs (0.5, 1, 2): (FIG. 29D) Cell recovery rate following the harvest process after overnight transduction in TransB and 24-well plate at the respective MOI, (FIG. 29E) Cell growth monitored after overnight transduction in TransB and 24-well plate at the respective MOI, (FIG. 29F) Cell viability monitored after overnight transduction in TransB and 24-well plate at the respective MOI; Incubation duration = 18 hours.
[0076] FIGs. 29G to 291 show for different seeding densities (LS : 6.6 x 105; HS: 1.32 x 106): (FIG. 29G) Cell recovery rate following the harvest process after 18-hour transduction in TransB and 24-well plate at the respective seeding densities, (FIG. 29H) Cell growth monitored after 18-hour transduction in TransB and 24-well plate at the respective seeding densities, (FIG. 291) Cell viability monitored after 18-hour transduction in TransB and 24-well plate at the respective seeding densities;
[0077] FIGs. 30A to 30F show the phenotypes of cells and transduction efficiency on different memory subsets for robustness test; and
[0078] FIGs. 31A to 3 IE show the phenotypes of cells and transduction efficiency on different memory subsets for scalability test.DETAILED DESCRIPTION
[0079] The following detailed description is made with reference to the accompanying drawings, showing details and embodiments of the present disclosure for the purposes of illustration. Features that are described in the context of an embodiment may correspondingly be applicable to the same or similar features in the other embodiments, even if not explicitly described in these other embodiments. Additions and / or combinations and / or alternatives as described for a feature in the context of an embodiment may correspondingly be applicable to the same or similar feature in the other embodiments.
[0080] In the context of various embodiments, the articles “a”, “an” and “the” as used with regard to a feature or element include a reference to one or more of the features or elements.
[0081] Tn the context of various embodiments, the term “about” or “approximately” as applied to a numeric value encompasses the exact value and a reasonable variance as generally understood in the relevant technical field, e.g., within 10% of the specified value.
[0082] As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.
[0083] For the sake of brevity, the term “biological material” may be used to refer to or include any one or a combination of “T cells”, “cells”, “cell cultures”, “viral vector”, “virus particle”, “virus”, etc., as will be understood from the context. The term “biological material” may generally refer to a combination of substances derived from or produced by living organisms, such as cells from blood, tissues or organs, recombinant or synthetic DNA / RNA, viral vectors, biological fluids, microorganisms, and even genetically modified organisms. An exemplary biological material may include a mixture of Periphery blood mononuclear cells (PBMCs) with pLenti CMV GFP Puro viral vector.
[0084] The term “feed media” or “cell culture media” may generally refer to one or multiple types or formulations of liquid products (which include gel-based products) used to support thegrowth of cells / cell cultures, as will be understood from the context. The media may be an oxygen perfused media and / or a pH-controlled media. An exemplary feed media suitable for use with the present disclosure may include RPMI xl640 supplemented with 10% FBS, lx GlutaMAX and 50 lU / ml of IL-2.
[0085] The present disclosure addresses challenges for conventional viral transduction process such as low transduction efficiency, low throughput, low process scalability, high operational cost, higher infrastructure cost, requirement of manual handling. The system, device and method of the present disclosure enables the advancement of viral gene delivery technology and the manufacturing of genetically modified cell therapies.
[0086] According to various aspects, the present disclosure relates to a viral transduction system, a viral transduction device and a method of viral transduction. As an exemplary application, the proposed system, device and method may be employed for scalable viral transduction in T cell manufacturing. In comparison to conventional methods, such as well plate based viral transduction method, the proposed system, device and method may aid in elevating transduction efficiency with reduced viral dose and transduction duration. Capitalizing on the high surface area-to-volume ratio of hollow fibers (HF), the present disclosure proposes bringing cells and viral vectors into a close proximity, thereby creating an environment that optimally facilitates the cell-viral vector interaction, thus improving transduction efficiency.
[0087] In addition, the proposed system, device and method enable a seamless transition from the viral transducing process into the cell harvesting process, continuously preserving the viability of the transduced cells. As such, the cell harvesting process may be performed based on existing components / structure without requiring further device / modules to be added.
[0088] With the use of feed media flow as a pressure head for dislodging transduced cells from an attachment surface, the amount of residual transduced cells left attached to the attachment surface is reduced, enabling an efficient and effective harvest. Further, duringharvesting, the transduced cells remain in a consistently viable environment without significant variations, such as temperature, media, etc. This allows the viability of the transduced cells to be preserved, maximizing the outcome of the viral transduction process.
[0089] The proposed system, device and method also enables scalability and automation to the viral transduction process, facilitating cell transduction / viral transduction over a wide range of capacity with consistent and reliable outcomes. Process uncertainties due to variation in external factors / variables may be minimized / mitigated, while concurrently enhancing process safety by reducing the amount of manual task involvement. With the reduction or even elimination of manual tasks, process automation may be implemented streamlining the viral transduction process, thus improving efficiency and reducing the risk of human error.
[0090] FIG. 1 illustrates a viral transduction system 50 according to various embodiments of the disclosure. The viral transduction system 50 comprises a viral transduction device 100. The viral transduction device 100 may be configured for receiving a biological material 400, such as a mixture of T cells and viral vectors, to perform a method of viral transduction on the biological material 400. As examples, the viral vectors may commonly be derived from viruses such as lentiviruses or retroviruses. Tn various examples, in addition or in place of the viral vectors, the biological material 400 may also comprise mRNA molecules and / or nanoparticles. In various examples, the biological material 400 may also include induced pluripotent stem cells (iPSCs), and / or natural killer (NK) cells.
[0091] The viral transduction system 50 may be provided with an inlet side 200 and an outlet side 300. The inlet side 200 and the outlet side 300 may be in fluid communication with the viral transduction device 100. The inlet side 200 may comprise a feed source 210 for providing a feed media to the viral transduction device 100. The outlet side 300 may comprise a waste collector 310 or a waste tank for receiving the feed media from the viral transduction device 100. Cooperatively, the inlet side 200 and the outlet side 300 may be attached to the viraltransduction device 100 to enable a feed media flow through the viral transduction device 100. It may be appreciated that the inlet side 200 and the outlet side 300 may collectively flow a feed media fluid in and out of the viral transduction device 100, thus enabling feed media circulation in the viral transduction device 100. The feed media circulation may enable a consistent supply of fresh feed media to the viral transduction device 100, advantageously facilitating an efficient viral transduction process.
[0092] In various embodiments, the inlet side 200 may include an inlet valve 212 fluidly coupled between the feed source 210 and the viral transduction device 100. The inlet valve 212 may be operable to enable and disable fluid communication between the feed source 210 and the viral transduction device 100. Similarly, the outlet side 300 may include an outlet valve 312 coupled between the viral transduction device 100 and the waste collector 310. The outlet valve 312 may be operable to enable and disable fluid communication between the viral transduction device 100 and the waste collector 310.
[0093] According to various embodiments, the viral transduction device 100 may further include one or more membranes disposed in the viral transduction device 100. Biological material 400, which comprises T cells and viral vectors, may be held within the one or more membranes. In some embodiments, the biological material 400, which comprises a mixture of T cells and viral vectors, may be prepared in advance and loaded into the one or more membranes of the viral transduction device 100. Alternatively, the T cells and viral vectors may be loaded into the one or more membranes from a cell source 410 and a viral vector source 420 sequentially, and mixed within the one or more membranes of the viral transduction device 100. As the T cells and viral vectors are held in close proximity, the cell-virus interactions may be improved and the viral transduction efficiency may be enhanced.
[0094] In various embodiments, the viral transduction system 50 may comprise multiple viral transduction devices 100 arranged in a parallel fluid communication with the inlet side200 and the outlet side 300. The number of viral transduction devices 100 may be increased / varied, providing scalability to the viral transduction process.
[0095] FIGs. 2 and 3 illustrate a viral transduction device 100 according to various embodiments of the present disclosure. The viral transduction device 100 may include a housing 110 formed or provided with an inlet port 114 and an outlet port 116. The inlet port 114 may be in fluid communication with the feed source 210 of the inlet side 200, and the outlet port 116 may be in fluid communication with an exterior of the housing 110. In an exemplary embodiment, the outlet port 116 may be in fluid communication with the waste collector 310 of the outlet side 300.
[0096] In an exemplary embodiment as shown in FIG. 2, the housing 110 may be in an elongated cylindrical configuration defining a longitudinal axis 92 and a transverse axis 94 orthogonal to the longitudinal axis 92. The housing 110 may define a first chamber 112 extending along the longitudinal axis 92 with a generally annular cross section. The first chamber 112 may be in fluid communication with the inlet port 114 and the outlet port 116. The inlet port 114 and the outlet port 116 may be formed on opposing sides of the housing 110 along the transverse axis 94.
[0097] In various embodiments, the first chamber 112 may be solely in fluid communication with the inlet port 114 and the outlet port 116. The inlet port 114 and the outlet port 116 may enable fluid communication between the first chamber 112 and an exterior of the housing 110. The first chamber 112 may be configured for holding and flowing a feed media 80 therein. In various embodiments, the inlet port 1 14 and the outlet port 1 16 may enable a flow of the feed media 80 into and out of the first chamber 112.
[0098] According to various embodiments, the viral transduction device 100 may further include a membrane 120 disposed in the first chamber 112. In an example, the membrane 120 may be a hollow fiber membrane. The membrane 120 may define a second chamber 122.
[0099] For clarity, various figures and description in the present disclosure presents embodiments of viral transduction devices with a single membrane. However, such embodiments are merely for the ease of illustration and is non-limiting in nature. It may be appreciated that the description and illustration of viral transduction devices with a single membrane may also be applicable to and within the ambit of the embodiments of the viral transduction device with multiple membranes. It is also worth noting that the schematic diagrams of the present disclosure may not be to scale.
[0100] The housing 110 may define the first chamber 112 which corresponds to the space between interior walls of the housing 110. The first chamber 112 may also be known as an extracapillary (EC) region or a region exterior of the membrane 120. Further, the membrane 120 may define a second chamber 122 corresponding to an interior of the membrane 120. The second chamber 122 may also be known as an intracapillary (IC) region or a region interior of the membrane 120. In various embodiments, a viral transduction device 100 with multiple membranes 120 may define multiple second chambers 122.
[0101] In various embodiments, the membrane 120 may be configured to receive and to hold a biological material 400. The biological material 400 may include a plurality of cells and a plurality of viral particles, such as a mixture of a plurality of T cells and a plurality of viral particles. In various embodiments, in addition or in place of the plurality of viral particles, the biological material 400 may also comprise a plurality of mRNA molecules and / or a plurality of nanoparticles. In various embodiments, in addition or in place of the plurality of T cells, the biological material 400 may also include a plurality of induced pluripotent stem cells (iPSCs) and / or a plurality of natural killer (NK) cells. The membrane 120 may be a hollow fiber membrane 120. The hollow fiber membrane 120 is a type of separation membrane in the shape of a thin, self-supporting tube or fiber. Further, the membrane 120 may be made of porous material and used for filtration and purification processes in various applications. The porousmaterial may comprise multiple pores. The pores may be openings in the membrane 120 that allow the movement of molecules therethrough, i.e., between the first chamber 112 and the second chamber 122.
[0102] Further, fluid communication may take place between the first chamber 112 and the second chamber 122 through the membrane 120. According to various embodiments, the membrane 120 may be sized or configured to block transfer of the biological material 400 from the second chamber 122 to the first chamber 112. As such, the membrane 120 may hold the biological material 400 within the second chamber 122 and limits a displacement of the biological material 400 from the second chamber 122. Further, the membrane 120 may be sized or configured to allow a transfer or displacement of the feed media 80 between the first chamber 1 12 and the second chamber 122. Tn other words, the membrane 120 may allow movement of the feed media 80 from the first chamber 112 to the second chamber 122, and also from the second chamber 122 to the first chamber 112. In various embodiments, the membrane 120 may also be sized or configured to allow diffusion of nutrients, reagents and metabolites in the feed media 80 between the first chamber 112 and the second chamber 122. In other words, nutrients, reagents and metabolites in the feed media 80 are allowed to move or displace from the first chamber 112 into the second chamber 122, or vice versa.
[0103] In various embodiments, the viral transduction device 100 may further include a pair of membrane ports, such as a first membrane port 124 and a second membrane port 126, coupled to the housing 110. The first membrane port 124 and the second membrane port 126 may be disposed on opposing ends of the membrane 120 along the longitudinal axis 92. The first membrane port 124 and the second membrane port 126 may be in fluid communication with the second chamber 122. Further, each of the first membrane port 124 and the second membrane port 126 may be independently sealable, for example by a respective cap, to cease a fluid communication with the second chamber 122. Therefore, it may be said that each of the firstmembrane port 124 and the second membrane port 126 is sealably communicable with the respective second chamber 122.
[0104] Referring to FIG. 3, in various embodiments, the viral transduction device 100 may comprise a plurality of membranes 120 disposed in the first chamber 112. Each of the plurality of membranes 120 may be spaced apart from each other in the first chamber 112. The plurality of membranes 120 may respectively define a plurality of second chambers 122. The plurality of membranes 120 may be a plurality of hollow fiber membranes. In an exemplary embodiment, each of the hollow fiber membrane may comprise an inner diameter equal to or smaller than 0.5 milimetres. The number, length, porosity, and pore configuration of membranes 120 may be varied or configured according to requirements, hence providing scalability to the viral transduction process.
[0105] In various implementations, the biological material 400 in each of the plurality of second chambers 122 may be one or more of: a plurality of T-cells, a plurality of iPSCs, and a plurality of NK cells. In various implementations, the biological material 400 in each of the plurality of second chambers 122 is of an identical type, for example, the same cell types. In various implementations, the biological material 400 in each of the plurality of second chambers 122 may be a plurality of T-cells.
[0106] Still referring to FIG. 3, in various embodiments, the plurality of membranes 120 may generally be disposed at a central region 121 of the first chamber 112, such that the plurality of membranes 120 are spaced apart from the interior wall 111 of the housing 110. The inlet port 1 14 and the outlet port 1 16 may be disposed on opposing sides of the housing 100 along the transverse axis 94 to enable a flow of the feed media 80 in the first chamber 112. Therefore, the first chamber 112 may generally surround the central region 121 and hence the plurality of membranes 120. This may aid in promoting feed media circulation within the first chamber 112. The membranes 120 may be collectively and fluidly coupled to each of the firstmembrane port 124 and the second membrane port 126. In alternative embodiments, each membrane 120 may be fluidly coupled to a respective pair of first and second membrane ports 124 / 126.
[0107] Referring to FIG. 4, in another exemplary embodiment, the housing 110 may be configured in a generally quadrilateral cross section. Similarly, the inlet port 114 and the outlet port 1 16 may be disposed on opposing sides of the housing 100 along the transverse axis 94 to enable a flow of the feed media 80 in the first chamber 112. The plurality of membranes 120 may be distributed substantially uniformly in the first chamber 112. This may aid in promoting diffusion of nutrients, reagents and metabohtes in the feed media between the first chamber 112 into the second chamber 122.
[0108] FIGs. 5 A to 7B illustrate a viral transduction system 50, a viral transduction device 100, and a method of viral transduction according to various embodiments of the disclosure. Referring to FIG. 5 A, the viral transduction system 50 may further include a pump 220 disposed in fluid communication between the feed source 210 and the inlet valve 212. The pump 220 may be a peristaltic pump or any other pumps suitable for use with the feed media. The pump 220 may provide a pressure head to the feed media from the feed source 210. Further, the viral transduction system 50 may also include a gas exchanger 230 in fluid communication between the inlet port 114 and the feed source 210. The gas exchanger 230 may provide oxygen / air to the feed media from the feed source 210 to provide an oxygenated feed media to the viral transduction device 100. In various embodiments, the gas exchanger 230 may be fluidly coupled to the pump 220. As examples, the gas exchanger 230 may include one or more of: a coiled gas permeable silicon tubing, a gas permeable membrane, an oxygenator. In various embodiments, the viral transduction device 100, the feed source 210 and the gas exchanger 230 may be disposed in a cell culture incubator or a cell culture incubator environment.
[0109] FIG. 5A and 5B illustrate a biological material loading step 50A of the method of viral transduction. The biological material loading step 50A may be an initial step of the method comprising loading biological material 400 into the viral transduction device 100. In various embodiments, the biological material 400 may comprise a plurality of cells 411 and a plurality of viral particles 421. In various embodiments, the plurality of cells 411may be a plurality of T-cells.
[0110] During loading of the biological material 400 (comprising cells 411 and viral particles 421) into the second chamber 122, a biological material source 410 / 420 be fluidly coupled to the second chamber 122. The biological material source 410 / 420 may be fluidly coupled to the first membrane port 124. For example, the biological material source 410 / 420 may comprise a mixture of a cell source 410 and a viral vector source 420, which includes a mixture of cells 411 and viral particles 421.
[0111] In another implementation, the cell source 410 and the viral vector source 420 may be serially connected to the first membrane port 124, i.c., the second chamber 122, the cell source 410, and the viral vector source 420 are in series in a fluid connection.[001 12] In addition, a negative pressure source 430 may be fluidly coupled to the second membrane port 126. The negative pressure source 430, such as a vacuum pump or a syringe, may form a negative pressure 431 in the second chamber 122 to aid in loading the biological material 400 into the second chamber 122. The negative pressure 431 may form a suction force / pressure to assist in loading the biological material 400 into the second chamber 122.[001 13] The term “negative pressure” may correspond to a fluid / liquid pressure below atmospheric pressure and / or below an environmental pressure of the viral transduction device 100. As such, negative pressure 431 in the second chamber 122 induces a “suction pressure” on the biological material source (cell source 410 and the viral vector source 420), to load the biological material 400.[00114J Alternatively, a cell source 410 and a viral vector source 420 may be independently coupled to the second chamber 122 one after another, such that the cells 411 and the viral particles 421 are loaded into the second chamber 122 sequentially. In an example, to load the cells 411 into the second chamber 122, the first membrane port 124 may be fluidly coupled to the cell source 410 and the second membrane port 126 may be fluidly coupled to the negative pressure source 430 to assist with loading the cells 41 1. This may be followed by fluidly coupling the viral vector source 420 to the first membrane port 124 to assist with loading the viral particles 421 into the second chamber 122.
[0115] During the biological material loading step 50A, the first chamber 112 and / or the second chamber 122 may be filled with feed media 80. In various embodiments, the inlet port 1 14 and the outlet port 1 16 may be closed to cease a feed media flow into or out of the first chamber 112. As an example, this may be done by closing both the inlet valve 212 and the outlet valve 312.
[0116] In alternative embodiments, during the biological material loading step 50A, the inlet port 114 and the outlet port 116 may be in fluid communication with the inlet side 200 and the outlet side 300 to allow circulation of feed media 80 during biological material loading.
[0117] Upon completion of the biological material loading step 50A, the biological material 400 may be held in the second chamber 122.
[0118] FIGs. 6A and 6B illustrate a perfusion and transduction step 50B according to various embodiments of the viral transduction method. The perfusion and transduction step 50B may follow on from the biological material loading step 50A. The perfusion and transduction step 50B may comprise holding the biological material 400 in the second chamber 122 and flowing / circulating feed media 80 into the first chamber 112.
[0119] In various embodiments, the inlet port 114 may be configured in fluid communication with the feed source 210 / pump 220 / gas exchanger 230. A flow pressure maybe provided to the feed source 210 to flow the feed media 80 from the feed source 210 to the first chamber 112 via the inlet port 114. In addition, the gas exchanger 230 may enhance a gaseous exchange between the feed media 80 and an environment of the viral transduction system 50. This enables the first chamber 112 to receive a supply 211 of oxygenated feed media 80 from the inlet port 114. In addition, waste or spent feed media 80 may also be expelled or flowed out from the first chamber 1 12 to an exterior of the housing 1 10 via the outlet port 1 16. In an example, the outlet port 116 may be in fluid communication with the waste collector 310 to expel 311 the waste / spent feed media 80 from the first chamber 112.
[0120] To hold the biological material 400 in the second chamber 122, the first membrane port 124 and the second membrane port 126 may be sealed or closed during the perfusion and transduction step 50B.
[0121] In the perfusion and transduction step 50B, the biological material 400 may be held in the second chamber 122 for a predetermined duration in a cell culture incubator condition. Concurrently, the feed media 80 may flow in the first chamber 112 and second chamber 122 to be circulated through the viral transduction system 50. During the circulation process, nutrients, reagents and oxygen from feed media 80 in the first chamber 1 12 may diffuse 1 13 across the membrane 120 or hollow fiber membrane into the second chamber 122. In addition, waste product from the cells 411 and / or viral particles 421 may diffuse 114 from the second chamber 122 to the first chamber 112 to be expelled 311 from the second chamber 122. This configuration allows the cells 411 and the viral particles 421 to be in close proximity, thus improves the cell-virus interactions, enhances transduction efficiency, and encourages viral transduction process. In addition, circulation of the feed media 80 allows waste to be removed from the second chamber 122, which is conducive to the viral transduction process and keeps the cells viable. During the perfusion and transduction step 50B, as the biological material 400(T cells and viral vectors) are held in close proximity, the cells may be attached or disposed on an interior surface of the second chamber 122.
[0122] In an exemplary embodiment, the membrane 120 may be a hollow fiber membrane which blocks transfer of biological material 400 (such as cells 411 and viral particles 421) from moving or displacing from the second chamber 122 to the first chamber 112 to hold the cells 41 1 and viral particles 421 in the second chamber 122, while allowing transfer of fluid media 80 between the first chamber and the second chamber. The cells 411 and viral particles 421 may be held in the second chamber 122 for a predetermined duration, such as more than 1 hour. The biological material 400 may also be held in the second chamber 122 under cell culture incubator condition, such as at 37 degrees Celsius, 90% relative humidity, and 5% CO2 concentration. In addition, the inner diameter of each membrane 120 (i.e., second chamber cross sectional diameter) may be around 0.5 millimetre (mm) or smaller, thus enabling close contact between the cells 411 and viral particles 421, increasing transduction efficiency.
[0123] FIGs. 7A and 7B illustrate a harvesting step 50C according to various embodiments of the viral transduction method. The harvesting step 50C may proceed when the perfusion and transduction step 50B is generally completed and / or when there are sufficient transduced cells produced.
[0124] During harvesling, one or more cell collectors 440 may be provided in fluid communication with the second chamber 122. In various embodiments, a cell collector 440 may be fluidly coupled to one of the first membrane port 124 and the second membrane port 126. For example, the cell collector 440 may be fluidly coupled to the second membrane port 126. In other embodiments, two cell collectors 440 may be fluidly coupled to the first membrane port 124 and the second membrane port 126, respectively.
[0125] Generally, the harvesting step 50C comprises ceasing feed media 80 flow out of the fust chamber 112, for example via the outlet port 116. This may be done concurrently with theremaining feed media 80 flow into the first chamber 112, for example via the inlet port 114. In various embodiments, the outlet port 116 of the first chamber 112 may be closed while the inlet port 114 remains in fluid communication with the feed source 210 / pump 220 / gas exchanger 230 such that feed media 80 is continuously supplied 211 to the first chamber 112.
[0126] Closing the outlet port 116 of the first chamber 112 may build up a first pressure in the first chamber 1 12, pushing the feed media 80 to flow from the first chamber 1 12 across the membrane 120 into the second chamber 122. The first pressure may be above atmospheric pressure and / or above an environmental pressure of the viral transduction device 100.
[0127] At this point, the biological material 400 which comprises transduced cells may generally be in suspension partially rested and / or adherent on a surface of the second chamber 122. For example, the transduced cells may be attached to a surface, such as a bottom surface or an interior surface, of the membrane 120. Responsive to closing the outlet port 116 of the first chamber 112, the feed media 80 may flow 115 or be pushed along a first direction 96 (such as a radial direction) from the first chamber 112 across the membrane 120 into the second chamber 122. The flow 115 of feed media 80 along the first direction may detach or dislodge the transduced cells from the membrane 120 or membrane walls, thus allowing the transduced cells to be in suspension or be resuspended in the second chamber 122. The dislodgement of transduced cells from the membrane walls / surfaces enhances transduced cell recovery during the harvesting step 50C.
[0128] In addition, the feed media 80 flowing 115 along the first direction 96 into the second chamber 122 enables or forms a fluid flow 1 16 in the second chamber 122 along a second direction 98 (such as an axial direction), to exit 441 the second chamber 122 into the cell collector 440. In some embodiments, the first direction 96 may be parallel to the transverse axis94, and the second direction 98 may be parallel to the longitudinal axis 92.
[0129] In addition, according to various embodiments, concurrently or sequentially with closing the outlet port 116, a further fluid pressure may be applied to the second chamber 122 and hence the fluid flow 116 from the first membrane port 124. In an example, a direct flow of feed media 80 may be provided along the second direction 98 via the first membrane port 124 into the second chamber 122. This process aids in increasing the fluid flow 116 for improving or enhancing the harvesting efficiency. Thereafter, the transduced biological material 402 may be collected or harvested from the second membrane port 126 via the cell collector 440.
[0130] The fluid flow 441 of the feed media 80 may bring along materials in the second chamber 122, such as the transduced biological materials 402, to exit the second chamber 122 via the second membrane port 126 to the cell collector 440. In various embodiments, the first direction 96 may be transverse to the second direction 98.
[0131] The harvesting step 50C allows the transduced biological materials 402 to be harvested and transported to the cell collector 440 in a relatively stable and consistent environment, such that the transduced biological materials 402 is not compromised due to an abrupt change in environment. As an example, the transduced biological materials 402 may be transported in the feed media 80 from the second chamber 122 to the cell collector 440 under a relatively constant temperature, pressure, pH, etc.
[0132] FIG. 8 is a flowchart illustrating a method of viral transduction 700, according to various embodiments of the disclosure. The method of viral transduction 700 comprises in 710, flowing a feed media into a first chamber of a housing, the first chamber being in fluid communication with an inlet port and an outlet port, the first chamber having a second chamber disposed therein, the second chamber defined by a hollow fiber membrane, the second chamber comprises a biological material disposed therein; and in 720, harvesting the biological material by closing the outlet port of the first chamber, wherein the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber,forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction.
[0133] In various embodiments, the hollow fiber membrane is configured to block transfer of the biological material from the second chamber to the first chamber, and to allow transfer of the feed media between the first chamber and the second chamber.
[0134] Tn various embodiments, wherein the hollow fiber membrane is configured to allow diffusion of nutrients, reagents and metabolites in the feed media between the first chamber and the second chamber.
[0135] In various embodiments, the method of viral transduction 700 further comprises in 730, loading the biological material into the second chamber by applying a negative pressure through one of a pair of membrane ports, the pair of membrane ports sealably communicable with the second chamber; and closing the pair of membrane ports, to hold the biological material in the second chamber.
[0136] In various embodiments, the method of viral transduction 700 further comprises in 740, applying a fluid pressure to the fluid flow from one of the pair of membrane ports; and collecting the biological material from another of the pair of membrane ports.
[0137] In various embodiments, the method of viral transduction 700 further comprises in 750, closing the outlet port of the first chamber to build up a first pressure in the first chamber, causing the feed media to flow from the first chamber across the hollow fiber membrane into the second chamber. In various embodiments, the first pressure in the first chamber forms a pressure differential across the hollow fiber membrane relative to a second pressure in the second chamber.
[0138] In various embodiments of the method of viral transduction 700, the first chamber may include a plurality of hollow fiber membranes disposed therein. Each of the plurality of hollow fiber membranes may be spaced apart from each other in the first chamber. The pluralityof hollow fiber membranes may define a plurality of second chambers. According to various embodiments, the biological material in each of the plurahty of second chambers is a plurality of cells and viral vectors. The biological material in each of the plurality of second chambers may be of an identical type.
[0139] Exemplary Implementation #1
[0140] The proposed viral transduction system and viral transduction device enables a scalable viral transduction in T cell manufacturing. FIG. 9 illustrates an exemplary implementation of the transduction device, with T cells and viral vectors contained in the intracapillary space of the hollow fiber, while feed medium (or media) with dissolved oxygen perfuses through the extracapillary space. The proposed setup allows for the extended culture of cells during the viral transduction process.
[0141] An implementation of the transduction system is depicted in FIGs. 10A and 10B. The main body / housing of the device comprises one or several parallelly connected hollow fiber (HF) cartridges, where the transduction process takes place in the intercapillary (IC) region of HF. The HF cartridge comprises several HF fibers with an inner diameter of 0.5 mm and a molecular weight cutoff of 500 kD on its membrane. This cutoff allows the fiber to effectively contain both cells and viral particles within the IC, while allowing efficient nutrient transfer between IC and extracapillary (EC). To integrate the HF cartridge into a closed transduction platform, the two side ports (inlet port and outlet port) of the HF cartridge are connected to a medium reservoir (containing fresh media) and a waste bottle (containing used media) respectively via gas permeable silicon tubing and male luer connectors. Between the HF cartridge and the medium reservoir, a portion of the connection tubing is carefully coiled to function as gas exchanger and maximize gas exchange between the perfusion media inside the tubing and the environment. This arrangement aids in enhancing the supply of dissolved oxygen to the cells and helps maintain the medium inside the HF at an appropriate pH level.Furthermore, the tubing is extended and affixed to a peristaltic pump to generate a flow of fresh media from media reservoir into EC space of the hollow fibers, allowing a continuous and efficient supply of nutrients and dissolved oxygen to the cells during the transduction process. The direction of the flow is visually represented in FIG. 10B.
[0142] Device usage and operation
[0143] Operation of the proposed system and device may be divided into three steps: T) Loading, II) Perfusion and transduction, and III) Harvesting as illustrated in FIG. 11.
[0144] I) Loading
[0145] Firstly, the system and device are assembled as shown in FIGs. 10A and 10B, with the cells and viral vectors prepared and mixed. Prior to loading, a first syringe is connected to feed port (first membrane port) of the HF cartridge (inlet) directly, and a second syringe without a plunger is connected to retentate port (second membrane port) of the HF cartridge (outlet) via a L-shape connector (FIG. 11 (step 1) and FIG. 12). The cell- virus mixture is pipetted into the second syringe and loaded into the HF cartridge by pulling the first syringe. This loading step is strategized and tested to effectively prevent the overloading or spilling of cell-viral vector mixture, reducing the potential ri ks associated with the process.
[0146] II) Perfusion and transduction
[0147] Once the loading of the transduction material (T cells and viral particles) is complete, both the inlet and outlet of HF cartridge are capped or closed. The entire device is relocated to the incubator, except the peristaltic pump and its tubing (FIGs. 13A and 13B). The perfusion of media in EC is then initiated and the flow rate adjusted to support effective nutrient transfer between the EC and IC without causing any potential shear damage to the HF membrane (FIG. 11 step 2). The duration of the perfusion process may vary depending on the cell types and viral vectors.
[0148] Harvesting
[0149] Once the transduction process has ended, the perfusion of feed media is halted and cells are harvested. The harvesting process involves simultaneously flushing the IC and perfusing EC with culture medium (FIG. 11 step 3). It is worth noting that one of the side ports is closed, allowing the medium from the EC to traverse the membrane and flow to the outlet. This strategic step aids in resuspending cells in the IC, detaching them from the membrane and enhancing cell recovery. The cells are then directed to the outlet and be collected. The flushing rate in IC, perfusion rate in EC and total harvesting time may be adjusted and optimized based on cell types and protocols. With all three steps completed, the cells are successfully transduced and ready for further cell processing steps.
[0150] Verification and Validation study
[0011] The verification and validation studies were performed with a system prototype that uses HF model (C02-E500-05-S, Repligen, US). Periphery blood mononuclear cells (PBMCs) that are 3 days post activation are used as the cell model.
[0152] Concept test and parameter optimization
[0153] Cell recovery
[0154] Cell loss from the transduction process negatively impacts the total number of cells that can be used for next step manufacturing. Thus, a goal of the proposed system and device is to maximize cell recovery rate and mitigate the impact from cell loss.
[0155] The recovery rate of cells in 24-well plates (conventional system) and the proposed hollow fiber system (HF) after overnight perfusion were compared. Briefly, 6.6xl05T-cells (3 days post activation) from 3 different donors were seeded in 200 ul in both 24-well plate and HF, followed by being incubated for 18 hours at 37°C and 5% CO2. Afterwards, the cells from the HF were harvested with a flow rate of 13 ml / min for IC flushing and 6 ml / min for EC perfusion for 1 minute, and from 24-well plate using pipetting. Thereafter, a trypan blue staining was performed for live cell counting with a hemocytometer. The results showed insignificantdifference in cell recovery rate between the two platforms, indicating the harvesting protocol works well for the setup (FIG. 14A). However, the difference between the 24-well plate and HF remained non-negligible. It was hypothesized that an increase in cell seeding number might reduce the cell recovery gap between the two platforms.
[0156] Test were performed on two cell seeding numbers, 6.6xl05cells and 1.32xl05cells, denoted as low seeding (LS) cell number and high seeding (HS) cell number in the FIG. 14B. The experiment was repeated 3 times with the same donor cell source, and the experiment procedures were the same as the previous experiment. The results revealed that cell recovery decreased in 24-well plate, but remained unchanged in the HF, when HS was used. At HS, the cell recovery difference between the two platforms was insignificant. There is reason to believe that this is because cell growth at HS is adversely impacted in 24-well plate but not for HF. It was reasonable to anticipate further improvements of cell recovery in HF compared to 24-well plate when even higher cell numbers are used.
[0157] Impacts of surface area to volume (SA:V) ratio on transduction efficiency and viral titer determination
[0158] During viral transduction, freely floating viral particles reach individual cells by Brownian motion, and a reduction in the distance that the virus needs to travel would lead to enhanced interaction between viral particles and cells thus transduction efficiency. The selection of HF as the transduction platform is at least partially due to a high surface area-to- volume ratio of HF and could thus bring cells and viruses into proximity and facilitate the cellvirus interaction. This was tested by mediating media height inside the well of culture plates to create culture spaces with different surface area to volume (SA:V) ratio. Lower media height corresponds to higher SA:V for cell culture and is expected to enhance cell transduction efficiency.
[0159] To perform viral transduction, a suitable Multiplicity of Infection (MOI) was identified to prevent potential transduction saturation, which could potentially mask the observation of impacts of transduction platforms on transduction efficiency.
[0160] An experiment was conducted with four MOI values (0.5, 1, 2, and 4) with overnight transduction using T-cells, and employed four media height settings (1mm, 2.5mm, 4mm, and 6mm). Briefly, 1.056xl05T-cells (D3 post activation) were pre-mixed with virus particles at the desired MOI mentioned and topped up with fresh media to achieve the desire media height before seeded into a 96-well plate on DO, followed by overnight transduction at 37°C and 5% CO2. On DI, cells were harvested and centrifuged at 300 x g for 10 minutes to remove any unbound virus, and further cultured for an additional three days. On D4, the transduction efficiency was evaluated using FACS analysis. The experiment was performed with 2 technical repeats from the same donor source.
[0161] As results shown, with MOI setting of 0.5, 1 and 2, medium height and transduction efficiency was inversely correlated (FIG. 15). This aligned with a hypothesis that lower medium height (thus higher SA:V) can enhance cell transduction. However, the result with MOI 4 was contradictor}' to the hypothesis. The transduction efficiency peaked at media height of 2.5mm instead of 1mm. The results demonstrated that the inverse correlation between transduction efficiency and media height held true only within specific ranges of MOI. In addition, the high MOI and low media height in general work synergistically to enhance the transduction efficiency at MOI range, with the exception at MOI 4 and media height lower than 2.5mm. The experiment results verified the working mechanism of the HF, that a high SA:V ratio can improve transduction efficiency.
[0162] Culture with the tested MOI range did not result in transduction saturation except for culture with medium height of 1mm (FIGs. 16A to 16D). Under the transduction conditions of a 1mm media height, the transduction efficiency seemed to be saturated at an MOI of 4 with nosignificance difference to that at MOI of 2. Generally, the transduction efficiency at 1mm media height was higher than that at all other media height for MOIs 0.5, 1, and 2. However, at MOI of 4, the transduction efficiency at the 2.5mm media was the highest among all medium heights. Data was analysed by one-way ANOVA followed with Tukey test to determine the significance between each group (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). Transduction with increased MOI in general yielded augmented transduction efficiency. In conclusion, MOI of 0.5 was obviously free from transduction saturation concern and chosen for subsequent device validation.
[0163] Transduction protocol
[0164] The general transduction protocol and timeline for the system validation is illustrated in FIG. 17 unless otherwise mentioned. For all experiments, RPMI xl 640 supplemented with 10% FBS, lx GlutaMAX and 50 lU / ml of IL-2 was used as the culture medium and pLenti CMV GFP Puro viral vector (Addgene, #17448) was used for the virus transduction.
[0165] Cell preparation: 3 Davs
[0166] Frozen PBMCs were thawed, activated with ImmunoCult™ Human CD3 / CD28 T Cell Activator (Stemcell), and cultured for 3 days.
[0167] Seeding: Dav 0
[0168] 1.32x106 T-cells (Day 3 post activation) were pre-mixed with virus particles with MOI of 0.5 into a mixture volume of 200 ul. Then, the mixture was seeded into the 1C of HF (following the “seeding” protocol as described above). Subsequently, the perfusion process was initiated (following the “transduction and perfusion” protocol as described above) at perfusion flow rate 0.1 ml / min and cells were incubated for 18 hours.
[0169] Harvest: Dav 1 (DI)
[0170] The transduced cells were harvested (following the “harvesting” protocol as described above), resuspended with 2 ml of fresh media, seeded into 24-well plate and cultured for an additional 2 days.
[0171] FACS analysis: Dav 3 (D3)
[0172] Cells were har vested, and the transduction efficiency of T cells was assessed by using FACS. GFP and CD3 marker were used to analyse the transduction efficiency of T cells specifically.
[0173] Device validation with aβ3 T cells
[0174] The exemplary device may amplify the transduction efficiency of immune cells. To evaluate the performance of the device, a comparison was performed for a[3 T cell transduction between the exemplary device (termed as HF hereafter) and 24-well plate (current gold standard) under varying transduction durations and MOIs.
[0175] Transduction test with different transduction durations
[0176] Through conducting of various tests, it was determined that the proposed device can enhance transduction efficiency in addition to reducing the required transduction time, thereby expediting the overall manufacturing process.
[0177] Briefly, 1.32xl06T-cells (Day 3 post activation) were pre-mixed with virus particles at MOI of 0.5 and topped up with fresh media to achieve a total volume of 200 pl (for HF transduction and 24-well plate transduction at 1mm media height) or 500 pl (for 24-well group transduction at 2.5mm media height). MOI of 0.5 was chosen to avoid potential transduction saturation to cells (as suggested by previous results). Two transduction media heights, 1mm and 2.5mm, were chosen for the 24-well plate transduction to provide a more comprehensive comparison. 1 mm was chosen as it gave rise to highest transduction efficiency among all tested media height with MOI 0.5 (reported in the previous section), while 2.5 mm is a more commonly employed medium height for well plate-based transduction in practice.
[0178] Cell-virus mixtures were then seeded into HFs and 24-well plate, and transduction was conducted at 37°C and 5% CO2 for durations of 2, 4 or 18 hours. The HF group received perfusion with IL-2 supplemented fresh media at a flow rate of 0.1 ml / min. After the predetermined transduction duration, cells in both HFs and 24-well plate were harvested and counted. They were subjected to centrifugation at 300 x g for 10 minutes to remove any unbound virus (cells in HF groups were harvested with the method described earlier). Cells were then resuspended and further cultured until D3. On D3, cells were counted and the transduction efficiency was evaluated by using FACS.
[0179] HF group exhibited comparable cell recovery and post-transduction cell expansion compared to 24-well plate groups
[0180] All experimental groups exhibited similar cell recovery rates at the point of harvesting. A positive correlation between cell recovery and incubation period was observed (FIGs. 18A to 18D). The cell recovery is directly proportional to the duration of culture after seeding. Each dot represents data from an individual sample group. (The calculation of cell recovery: Number of live cells harvested I Number of live cells seeded on DO * 100%, and the data was analysed by one-way ANOVA followed with Tukey test to determine the significance between each group (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). Longer incubation periods resulted in higher recovery rates, which could be due to more cell expansion. The cell growth post transduction was comparable between the studied groups, as evidenced by a similar fold change in cell number (approximately 3.5-fold) post transduction from DI to D3 regardless of transduction duration (FIGs. 19A to 19C).
[0181] HF promoted CD3 expression after 18 hours transduction
[0182] The extended incubation duration in HF led to the promotion of the CD3+ T cell population. As illustrated in FIGs. 20A to 20C, the HF group that subjected cells to 18 hours’ transduction displayed a notably high CD3+ percentage (averaging 94.95%), surpassing thecells transduced in the 24- well plate ( <90%). The HF groups with 18 hours’ incubation duration enriched the CD3 population by nearly 5% compared to 24- well plate groups. Data was analysed by one-way ANOVA followed with Tukey test to determine the significance between each group (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). The observed enrichment of the T cells population in the HF group was intriguing and may be attributed to the sustained provision of fresh nutrients and interleukin-2 (IL-2) during the overnight perfusion.
[0183] HF successfully enhanced transduction efficiency and shortened transduction duration compared to the conventional well plate-based practices
[0184] For short-duration transduction (2 hours and 4 hours), as depicted in FIGs. 21A and 21B, HF demonstrated a superior transduction efficiency compared to the 24-well plate with 2.5 mm media height, but not 24-well plate with 1 mm media height. (HF: 14.41 %, 24-wp 2.5mm:9.97, 24-wp 1mm: 16.87% for 2 hours transduction; HF:20.44%, 24-wp 2.5mm 16.73%, 24-wp 1mm: 26.96% for 4 hours transduction). In contrast, with an 18-hour transduction, HF achieved the highest transduction efficiency among all three groups with significant difference (HF: 42.25%, 24-wp 1mm: 28.81% & 24-wp 2.5mm: 28.37%, FIG. 21C). HF consistently showed higher transduction efficiency than 24-well plate with 2.5 mm media height, but not 24-well plate with 1 mm media height.
[0185] Additionally, FIG. 21 D presented the investigation data on whether HF could shorten the transduction duration. With a 2 hours transduction, the transduction efficiency in HF already approached the value of the 24-well plate with 2.5 mm media height and 4 hours of transduction. Overall, the experiment validated the role of HF in enhancing transduction efficiency and shortening transduction duration. Data was analysed by one-way ANOVA followed with Tukey test to determine the significance between each group (*p < 0.05; **p < 0.01; ***p < 0.001;****p < 0.0001).[00186 J Transduction efficiency comparison between HF and 24-well plate with different viral dose
[0187] A further test was conducted to investigate whether the application of HF can reduce the viral dose to reduce the risk associated with viral vector exposure and cut the cost of the manufacturing process.
[0188] Briefly, 1.32xl06T cells (Day 3 post activation) were pre-mixed with the virus particles at MOI of 0.5 for HF and 4 difference MOI for 24-well plate (0.5, 1, 2 and 4). They were topped up with fresh media to achieve a total volume 200 pl for HF and 500 pl for 24- well plate group (to achieve media height of 2.5mm). Subsequently, the mixtures were seeded into HFs and 24-well plate respectively, and transduction was conducted at 37°C and 5% CO2 for 18 hours. The HF group received perfusion with IL-2 supplemented fresh media at a flow rate of 0.1 ml / min. On Day 1, cells in both HFs and 24-well plate were harvested and subjected to centrifugation at 300 x g for 10 minutes to remove any unbound virus (Cells in HF groups were harvested as the method described earlier). The collected cells were further cultured until Day 3. On Day 3, the transduction efficiency was evaluated by using FACS.
[0189] HF demonstrated comparable cell recovery from transduction and post-transduction cell growth compared to 24-well plate
[0190] FIG. 22A illustrates insignificant differences in cell recovery percentage observed between HF and 24-well plate groups. This finding substantiated the robustness of the proposed harvesting method for HF. Post-transduction cell growth was similar among all experimental groups (FIG. 22B), which was consistent with the observation from the previous experiment. Cell recovery from HF was similar to that from 24-well plate with the optimized harvest protocol. HF did not affect the cell growth negatively.
[0191] HF with 18 hours transduction enriched CD3+ population
[0192] Consistent with the outcomes observed in the previous experiment, cells transduced in HF demonstrated an enriched CD3+ population on Day 3 post transduction (94.89%) than cells transduced in 24-well plate (-90%) (FIG. 23). This attribute may represent a notable advantage in employing the HF for cellular transduction, wherein HF was able to enrich the CD3 population, thereby enhancing the purity of the resultant product. This could be especially valuable when a heterogeneous population such as PBMCs are used as the starting material and homogeneous T cells are expected as the final product. Additionally, the result revealed the increase in MOI did not yield discernible effects on the CD3 expression of the cell products after transduction in 24-well plates, which is also expected to be true for HF based transduction.
[0193] HF demonstrated the capability to enhance transduction efficiency by 34% and reduce viral dose by half
[0194] Finally, the transduction efficiency was determined by assessing the GFP+ population percentage within the CD3+ subunits. Cells transduced in HF achieved a 34% higher transduction efficiency compared to that in 24-well plate at same condition MOI (HF with MOI 0.5: 47.21%, 24-wp with MOI 0.5: 35.74%), which was consistent with the preceding findings. In addition, cells transduced in HF at MOI 0.5 exhibited transduction efficiencies similar to that in 24-well plate at MOI 1 (24-wp with MOI 1: 47.86%) (FIG. 24). HF demonstrated a higher percentage GFP+ population than 24-well plate at same MOI. Moreover, HF with MOI 0.5 was able to achieve the same GFP+ percentage as 24-well plate with MOI 1. The results affirmed the effectiveness of HF in enhancing the transduction efficiency and suggest a potential reduction in viral dose by half (from MOI 1 to 0.5) with HF to achieve an equivalent transduction efficiency as the current practices.
[0195] Overall, the experiments show the proficiency of HF in enhancing the transduction efficiency and supported HF as an effective solution for viral transduction in current cell therapy manufacturing process.[00196 J Exemplary Implementation #2
[0197] Another implementation of the proposed system and device is embodied in a Transduction Boosting Device (TransB) developed to address the limitations of existing transduction methods in immune cell therapy manufacturing. TransB leverages the high surface area-to-volume ratio of hollow fibers, creating an optimized microenvironment that enhances T cell-virus interactions and boosts transduction efficiency. The performance of TransB was evaluated by comparing cell recovery rates, transduction efficiency, and viral vector usage against conventional well-plate-based methods. Results demonstrate that TransB not only achieves comparable cell recovery rates but also significantly enhances transduction efficiency, particularly with extended transduction durations. These findings highlight the potential of TransB as a scalable and efficient platform for viral transduction, streamlining gene modification workflows and supporting the growing demand for T cell-based immunotherapies in both research and clinical settings.
[0198] Development of Transduction Boosting Device (TransB)
[0199] To support the manufacturing needs of immune cell therapy products, the proposed transduction system and device (TransB) was developed to achieve three key objectives: (1 ) efficient transduction at high cell densities, (2) reduced viral vector usage to lower production costs, and (3) shortened gene editing duration. Traditional static transduction platforms, such as culture plates or bags, are constrained by limited surface area and suboptimal mass transfer, resulting in reduced transduction efficiency particularly at scale due to poor interactions between cells and viral vectors. TransB was engineered to overcome these limitations and enhance the overall efficiency, consistency, and scalability of the transduction process.
[0200] TransB is a standalone, functionally closed, perfusion-based benchtop system that integrates seamlessly into both research and clinical manufacturing workflows. Its designemphasizes closed-system operation to reduce contamination risk, automation to improve reproducibility, and modularity to support scalability across different production volumes.
[0201] The core of the system comprises a single-use component incorporating a hollow fiber membrane module (C02-E500-05-S, Repligen, Waltham, Massachusetts, USA) with a molecular weight cutoff of 500 kD, a coiled silicone gas exchange, and a gas-permeable silicone tubing set. The hollow fiber membrane with a high surface area-to-volume ratio confines cells and viral vectors within the intra-capillary (IC) space, thereby increasing the frequency and intimacy of cell-virus interactions. The gas exchanger, positioned between the hollow fiber and the medium reservoir, enhances gas exchange and ensures a continuous supply of dissolved oxygen. The tubing set connects the hollow fiber module to a medium reservoir and a waste collection bottle via side ports, enabling controlled fluid circulation. A peristaltic pumping system drives perfusing the continuous perfusion of media through the extra-capillary (EC) space, delivering nutrients and supporting gas exchange to cells in the IC — thus maintaining cell viability throughout extended incubations without the need for manual media changes.
[0202] The spatial compartmentalization combined with continuous perfusion creates an optimized environment for transduction. Furthermore, the modular system architecture facilitates easy customization and scalability, enabling TransB to be suitable for both smallbatch experimentation and larger-scale manufacturing.
[0203] Prior to operation, the perfusion tubing set was sterilized by autoclaving and aseptically assembled with the sterile hollow fiber module inside a biosafety cabinet (BSC). The assembled single-use component was then mounted onto the pumping system, completing setup for cell viral transduction experiments.
[0204] Production of lentiviral vectors
[0205] 9 x 106293T cells (CRL-3216, ATCC, Manassas, Virginia, USA) were seeded in aT-75 flask and incubated at 37°C, 5% CO2for around 6 hours to allow adherence to the surface.13.5 pig of pLenti-CMV-GFP-Puro (#17448, Addgene, Watertown, MA, USA), 9 pg of pMDLg / pRRE (#12251, Addgene), 4.8 ug of pCMV-VSV-g (#8454, Addgene) and 3.3 pg of pRSV-Rev (#12253, Addgene) were mixed with FuGENE 6 (Promega, Madison, WI, USA) which diluted in DMEM (Thermo Fisher Scientific, Waltham MA, USA) and incubated for 15- 30 minutes. All culture media from the 293T culture flask were then removed and substituted with 9 ml fresh DMEM (Thermo Fisher Scientific). The mixture of DNA plasmids and FuGENE 6 were then added directly into the media and the cells were incubated at 37°C, 5% CO2for 18-20 hours. On the next day, full media change was performed, and cells were incubated for another 24 hours. Then the lentivirus contained supernatant were collected and filtered through 0.45 pm PVDF Filter (Sartorius AG, Gottingen. Germany) and concentrated 10 times using the HF (C02-E500-05-S, Repligen) by following the manufacturer’s protocol and stored at -80°C for the following experiments.
[0206] Cell preparation for transduction
[0207] Donor Peripheral blood mononuclear cells (PBMCs) (STEMCELL technologies, Vancouver, Canada) were thawed and activated with ImmunoCult™ Human CD3 / CD28 / CD2 T Cell Activator (STEMCELL Technologies) (25 pl / ml of cells with a concentration of 1 x 106cells / ml) and IL-2 (STEMCELL Technologies) (50 lU / ml) and cultured for 3 days with complete culture medium consisted of RPML1640 (Thermo Fisher Scientific), 10% heat inactivated Fetal Bovine Serum (FBS) (Hyclone, Logan, UT, USA) and 2 mM L-glutamine (Thermo Fisher Scientific) prior to transduction unless otherwise stated.
[0208] 24 well plate Transduction
[0209] PBMCs (STEMCELL technologies, Vancouver, Canada) (1.32 x 106cells), 3 days post-activation, were pre-mixed with viral vector at the indicated multiplicity of infection(MOI) prior to seeding into a 24-well plate. The MOI was defined as a 1: 1 virus-to-cell volumeratio, based on a cell concentration of 5 x io6cells / mL. The cell-virus mixture was then incubated at 37°C, 5% CO2for a specified duration.
[0210] Following transduction, the culture medium was centrifuged at 300 x g for 5 minutes to remove excess virus. The pelleted cells were then reseeded into a 24-well plate and cultured for an additional 3 days before assessing transduction efficiency.
[0211] TransB Transduction
[0212] PBMCs (STEMCELL technologies, Vancouver, Canada) (1.32 x 106cells), 3 days post-activation, were pre-mixed with viral vector at the indicated MOI prior to introduction into TransB. The MOI was defined as a 1: 1 virus-to-cell volume ratio, based on a cell concentration of 5 x 106cells / mL.
[0213] The cell-virus mixture was introduced into the intracapillary (IC) space of the hollow fiber by loading the mixture through the outlet port while simultaneously drawing fluid from the inlet port using a syringe. The single-use consumable set was then loaded onto the pump system and incubated at 37°C, 5% CO? for a specified duration, with the pump positioned outside the incubator.
[0214] During transduction, IL-2-supplemented complete culture medium was continuously perfused through the extracapillary (EC) space of the hollow fiber at a flow rate of 0.1 mL / min.
[0215] Cells were harvested by flushing the IC space with 4 mL of complete culture medium at a flow rate of 13 mL / min, while simultaneously flushing the EC space at 6 mL / min for 1 minute. The harvested medium was then centrifuged at 300 x g for 5 minutes to remove excess virus. The pelleted cells were seeded into a 24-well plate and cultured for an additional 3 days before transduction efficiency was assessed.
[0216] Cell count and live cell recovery analysis
[0217] Cell count was performed on Countess automated cell counter (Thermo Fisher Scientifc) and live cell recovery rate was calculated based on the formula:
[0218] Transduction efficiency and cell phenotype analysis
[0219] Cells were stained with Viobility 405 / 452 Fixable Dye (130-130-404, Miltenyi Biotec, Bergisch Gladbach, Germany) and CD3-APC (130-113-135, Miltenyi Biotec) for GFP transduction efficiency measurement on T-cells. Cells were stained with CD3-VioBlue (130- 114-519, Miltenyi Biotec), CD8-VioBlue (130-110-683, Miltenyi Biotec), CD4-APC-Vio770 (130-113-223, Miltenyi Biotec), CCR7-PE (130-120-463, Miltenyi Biotec), CD45RA-PerCP- Vio770 (130-113-368, Miltenyi Biotec) for phenotype check. MACSQuant Analyzer 10 (Miltenyi Biotec) was used to acquire the data and MACSQuantify 2.13.3 software (Miltenyi Biotec) was used for analyses.
[0220] Quantitative real time PCR (qPCR) and Vector Copy Number (VCN) calculation
[0221] Genomic DNA (gDNA) was extracted from 3 x 106T-cells that were incubated 4 days after transduction with DNcasy Blood and Tissue Kit (69506, QIAGEN, Hildcn, Germany). 50 ng of the gDNA was used per qPCR reaction. eGFP was used as the vector gene target and RPL32 was used as the reference target.
[0222] eGFP Forward Primer: 5' - ACGTAAACGGCC ACAAGTTC - 3 ’
[0223] eGFP Reverse Primer: 5' - AAGTCGTGCTGCTTCATGTG - 3 ’
[0224] RPL32 Forward Primer: 5’ - CAAGGAAAGACGAGCTGTAGG - 3’
[0225] RPL32 Reverse Primer: 5’ - GGGCAGTTGCATCTTCATATTC - 3’
[0226] iTaq Universal SYBR Green Supermix (1725121 , Bio-Rad, Hercules, California, USA) was used for qPCR amplification, and the amplification and quantification was done by using the Bio-Rad CFX96 thermocycler (Bio-Rad) with the procedures of: an initial denaturation step at 95 °C for 5 min, followed by 36 cycles of denaturation at 95 °C for 5 s andannealing / extension at 60 °C for 30 s. The VCN per cell was calculated using following formula: ACt method: VCN per cell = 2’(Ct target"Ct ieference)x 2
[0227] Statistical Analysis:
[0228] All statistical analyses were performed using GraphPad Prism (GraphPad Software, La Jolla, CA, USA). Paired Student's two-tailed t-tests were conducted to assess the statistical significance of data sets with only one study group. For data sets with more than two study groups, one-way ANOVA followed by Tukey's test was used to determine statistical significance. (The significance level indicated by the asterisk: *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001)
[0229] Results and discussion
[0230] TransB achieved comparable live cell recovery without adverse effects on T cell viability or cell growth post transduction
[0231] Cellular stress during viral transduction may lead to cell loss, reduced viability, and impaired function — factors that critically affect overall cell yield for downstream manufacturing. Additionally, shear forces generated during cell loading, perfusion, and harvesting in the TransB system may further impact cell integrity. To assess whether TransB induces such effects, evaluation was performed to obtain the impact on live cell recovery, viability, and growth, independent of transduction.
[0232] To decouple the effects of device exposure from those of viral transduction, comparison of T cells incubated without virus was performed in both TransB and a 24-well plate. Two different initial seeding densities were tested: Low seeding (LS): 6.6 * 105day-3 activated T cells; High seeding (HS): 1.32 x 106day-3 activated T cells. After 18 hours of incubation, cells were harvested and analyzed for live cell recovery.
[0233] FIGs. 25A to 25F show the results from TransB according to an exemplary embodiment, wherein TransB is able to support comparable live cell recovery, cell growth, andviability to 24-well plate incubation, both with and without viral exposure. While a consistent degree of cell loss was observed in the TransB group, live cell recovery rates were not significantly different from the 24-well plate control (Figure 2A, n — 3). Notably, the difference in recovery between the two platforms decreased with higher initial seeding, suggesting that TransB performance improves with increasing input cell number. Interestingly, TransB showed increased cell recovery' with higher seeding density, whereas the 24-w'ell plate showed a decrease, highlighting TransB ’s advantage in handling larger cell numbers (FIG. 25A, n = 3).
[0234] To assess w'hether exposure to the TransB system affected downstream expansion, cells harvested after an 18-hour TransB incubation (without virus) 'ere cultured for 4 days in IL-2- supplemented medium. The results showed no observable differences in cell growth or viability when compared to the 24-well plate control, confirming that TransB does not compromise the cells’ proliferative capacity or viability (FIGs. 25B and 25C).
[0235] Upon confirming that TransB exposure alone does not negatively affect key cellular attributes, the next step proceeded to evaluate TransB -mediated viral transduction. Using the HS setup, day-3 activated T cells were transduced at an MOI of 0.5 for 18 hours in TransB, then assessed for live cell recovery, growth, and viability. Results demonstrated that all three parameters were comparable to those achieved using static transduction in a 24-well plate (FIGs. 25D to 25F).
[0236] Together, these findings confirm that the TransB transduction system supports T cell viral transduction without compromising cell recovery, growth, or viability, and performs on par with or potentially better than traditional well-plate methods, particularly when scaling to higher cell numbers.
[0237] TransB enhances the transduction efficiency w'hile reducing processing time and viral usage[00238 J To evaluate the impact of TransB on lentiviral transduction efficiency, viral vector usage, and processing duration, a series of experiments using donor T cells transduced with Lenti-GFP were conducted. Transductions were performed across varying incubation durations (2, 4, and 18 hours), multiplicities of infection (MOIs: 0.5, 1, and 2), and cell input densities — low seeding (LS): 6.6 x 105cells and high seeding (HS): 1.32 x 106cells — with static transduction in a 24-well plate serving as the benchmark.
[0239] FIGs. 26A to 26F show that TransB enhances lentiviral transduction efficiency of D3-activated T cells under various process conditions. Across all tested conditions, TransB consistently achieved a 1.3- to 1.9-fold improvement in transduction efficiency compared to static controls (FIGs. 26A to 26F). This represents a 30-90% increase in transduced cell yield, which has significant implications for manufacturing. Higher transduction efficiency can lower the initial cell input requirement, which is beneficial for patients with low leukapheresis yields, and may shorten the post-transduction expansion phase needed to reach therapeutic cell doses. These improvements support broader patient eligibility and faster manufacturing timelines, potentially reducing overall production costs.
[0240] Tn both TransB and 24-well plate systems, transduction efficiency increased with longer incubation times. However, TransB consistently outperformed static culture, delivering a 30^47% improvement in transduction efficiency across all time points (FIGs. 26A and 26B). Notably, TransB achieved similar transduction efficiency in 2 hours as the static system did in 4 hours, representing a 50% reduction in process time. This time-saving feature of TransB is particularly advantageous for rapid manufacturing workflows.
[0241] TransB demonstrated enhanced efficiency across all MOIs tested, with the most pronounced gains at lower MOIs — 1.91-fold at MOI 0.5, 1.73-fold at MOI 1, and 1.4-fold at MOI 2 (FIGs. 26C and 26D). It was observed that transduction at MOI 0.5 in TransB achieved similar efficiency to MOI 2 in the static system (36.6% vs. 36.1%). This threefold reduction inviral vector requirement is a major advantage, as viral vectors represent a substantial cost driver in gene-modified cell therapy manufacturing.
[0242] In static 24-well plate conditions, transduction efficiency was similar across low and high cell densities, suggesting that within the tested range, cell density had limited impact. However, TransB showed a clear' density-dependent enhancement, with HS conditions yielding a 1 .91 -fold increase in transduction efficiency compared to static, versus 1 .7-fold at LS (FIGs. 26E and 26F). This indicates that TransB is particularly suited for high-density transduction, which is advantageous for clinical-scale manufacturing. The improved performance at higher densities may be attributed to TransB’ s high surface area to volume (SA:V) design and continuous media perfusion, which sustain nutrient and gas exchange and mitigate limitations encountered in static systems.
[0243] Together, the results demonstrate that the TransB system enhances lentiviral transduction efficiency of donor T cells, while shortens processing time and reduces viral vector consumption. This is in addition to the ability to support higher cell densities, faster turnaround, and lower reagent costs positions TransB as a promising platform for scalable, cost-effective, and efficient gene modification in T cell therapy manufacturing.
[0244] TransB consistently enhances transduction efficiency across multiple donors
[0245] To assess the robustness of TransB and transduction protocol, performance across D3-activated T cells derived from three independent donors were evaluated. Each donor’s cells were transduced for 18 hours at an MOI of 1, using a seeding density of 1.32 x 106cells. A comparison was performed across three experimental groups: (1 ) TransB transduction, (2) static transduction in a 24-well plate, and (3) static incubation in a 24-well plate with viral vector addition but no transduction.
[0246] FIGs. 27A to 27J show that the TransB transduction system consistently enhances the transduction process across different PBMCs donors. Across all donor samples, live cellrecovery, post-transduction expansion, and viability were comparable among the three conditions (FIGs. 27 A to 27C), confirming that the TransB system does not introduce cell stress or cytotoxicity and is robust in maintaining T-cell viability and growth.
[0247] Notably, T cells processed using the TransB transduction system exhibited an average -2% increase in the CD3+population compared to static transduction, with no detectable change in the CD4 / CD8 ratio (FTGs. 27D and 27E). Phenotypic analysis using CCR7 and CD45RA markers showed a trend toward a reduced proportion of central memory T cells (TCM; CCR7+CD45RA") and a corresponding increase in effector memory T cells (TEM; CCR7"CD45RA") in the TransB group, relative to the static group. However, these shifts were not statistically significant. No significant differences were observed in the proportions of naive T cells (T ; CCR7+CD45RA+) or terminally differentiated effector memory T cells (TEMRA; CCR7“CD45RA+) (FIG. 27F). It was hypothesized that continuous perfusion of IL-2- supplemented media in the TransB system may influence the phenotypic distribution of T-cell subsets, although further investigation is needed to elucidate the underlying mechanisms.
[0248] TransB enhanced overall transduction efficiency by an average of 1.5-fold compared to static transduction across all donors (FIG. 27G). This improvement was consistent across CD4+and CD8+subsets, with CD4+T cells displaying higher transduction rates than CD8+T cells in both conditions (FIG. 27H). A similar trend was observed across memory subsets (FIGs. 271 and 27J), suggesting that TransB improves lentiviral gene transfer efficiency without skewing T-cell subset distribution.
[0249] Lastly, the VCN per cell was assessed to ensure the increased transduction efficiency remained within safety parameters (FDA recommended threshold: VCN< 5). While VCN levels were elevated in the TransB group compared to static transduction, the VCN levels remained well below the safety threshold, supporting the system’s suitability for clinical translation. These findings indicate that TransB enhances gene integration efficiency without inducingexcessive VCN, which is a critical factor in mitigating genotoxic risks associated with insertional mutagenesis.
[0250] These findings demonstrate that TransB reproducibly enhances the efficiency of lentiviral transduction in primary T cells across multiple donors, without adversely affecting cell recovery, viability, phenotype, or VCN. Importantly, the data suggest that the performance of the TransB system is not significantly impacted by donor-to-donor variability.
[0251] TransB demonstrates potential for scalable cell transduction
[0252] The scalability of TransB can be achieved by utilizing longer or additional hollow fiber modules of the same configuration, thereby increasing processing volume without altering flow dynamics within the transduction space. The configuration allows for straightforward process scaling while maintaining the same operational protocol developed for small-scale configurations. To evaluate the scalability of TransB, transduction outcomes using a larger version of the system (TransB-L) was compared, which incorporates a longer hollow fiber membrane (HF) with the same molecular weight cutoff (C04-E500-05-S), against the small- scale version (TransB-S) used in previous experiments (FIG. 28A).
[0253] FIGs. 28A to 28L show the TransB transduction system supported efficient cell transduction at different scales. Post-transduction analysis showed no significant differences in live cell recover}' rates, cell expansion, or viability between TransB-S and TransB-L (FIGs. 28B to 28D). Additionally, the distribution of key immune cell subsets, including CD3+ T cells, CD4+ cells, CD8+ cells, and memory differentiation phenotypes (TN; CCR7+ CD45RA+, TCM; CCR7+ CD45RA , TbM; CCR7- CD45RA-; TEMRA; CCR7- CD45RA+) remained comparable between the two systems (FIGs. 28E to 28G). Crucially, transduction efficiency was consistent between TransB-S and TransB-L across all assessed T cell subtypes (FIGs. 28H to 28K), and both systems exhibited the same VCN per cell (FIG. 28L).
[0254] These results confirm the scalability of the TransB transduction system, demonstrating its potential to support the transition from small-scale benchtop research to large- scale clinical manufacturing. By maintaining process consistency across different scales, TransB facilitates the seamless progression of immune cell therapy from early-stage development to clinical application.
[0255] The TransB transduction system represents a significant advancement in viral transduction for immune cell therapy manufacturing. By integrating continuous perfusion with a high SA: V hollow fiber design, TransB enhances transduction efficiency, reduces viral vector consumption, and enables high-density cell processing while maintaining robust cell viability and phenotype. The system also demonstrates scalability, reproducibility, and compliance with safety parameters, making it a strong candidate for clinical translation.
[0256] In addition, it was observed that TransB did not impede cell growth or viability under various transduction conditions. FIGs. 29A to 291 shows the various cell recovery rate, cell growth, and cell viability using TransB with different transduction durations (2 hours, 4 hours, and 18 hours) and in different MOIs. FIGs 30A to 30F show the phenotypes of cells and transduction efficiency on different memory subsets for robustness test. FIGs. 31 A to 31 E show the phenotypes of cells and transduction efficiency on different memory subsets for scalability test.
[0257] All examples described herein, whether of apparatus, methods, materials, or products, are presented for the purpose of illustration and to aid understanding, and are not intended to be limiting or exhaustive. Modifications may be made by one of ordinary skill in the art without departing from the scope of the invention as claimed.
Claims
CLAIMS1. A method of viral transduction, the method comprising: flowing a feed media into a first chamber of a housing, the first chamber being in fluid communication with an inlet port and an outlet port, the first chamber having a second chamber disposed therein, the second chamber defined by a hollow fiber membrane, the second chamber comprises a biological material disposed therein; harvesting the biological material by closing the outlet port of the first chamber, wherein the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber, forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction; and applying a fluid pressure to the fluid flow from one of a pair of membrane ports, wherein the pair of membrane ports arc in fluid communication with the second chamber.
2. The method according to claim 1, further comprising: collecting the biological material from another one of the pair of membrane ports.
3. The method according to any one of claims 1 and 2, wherein applying the fluid pressure comprises providing a flow of feed media to the fluid flow along the second direction.
4. The method according to any one of claims 1 to 3, further comprising: applying the fluid pressure concurrently with the closing of the outlet port.
5. The method according to any one of claims 1 to 3, further comprising: applying the fluid pressure sequentially with the closing of the outlet port.
6. The method according to any one of claims 1 to 5, wherein the hollow fiber membrane is configured to block transfer of the biological material from the second chamber to the first chamber, and to allow transfer of the feed media between the first chamber and the second chamber.
7. The method according to any one of claims 1 to 6, wherein the biological material in the second chamber is in suspension, partially rested or adherent on a surface of the second chamber.
8. The method according to any one of claims 1 to 7, further comprising: loading the biological material into the second chamber by applying a negative pressure through one of a pair of membrane ports, the pair of membrane ports sealably communicable with the second chamber.
9. The method according to claim 8, further comprising: closing the pair of membrane ports, to hold the biological material in the second chamber.
10. The method according to claim 9, wherein the biological material in the second chamber is at a cell culture incubator condition of 37 degrees Celsius, 90% relative humidity, 5% CO2, for at least 1 hour.
11. The method according to any one of the above claims, further comprising: closing the outlet port of the first chamber to build up a first pressure in the first chamber, causing the feed media to flow from the first chamber across the hollow fiber membrane into the second chamber.
12. The method according to claim 11, wherein the first pressure in the first chamber forms a pressure differential across the hollow fiber membrane relative to a second pressure in the second chamber.
13. The method according to any one of the above claims, wherein the biological material comprises a plurality of cells, and at least one of: a plurality of viral particles, a plurality of mRNA molecules, and a plurality of nanoparticles.
14. The method according to claim 13, wherein the plurality of cells comprises at least one of: a plurality of T-cells, a plurality of iPSCs, and a plurality of NK cells.
15. The method according to any one of the above claims, wherein the first chamber comprises a plurality of hollow fiber membranes disposed therein, each of the plurality of hollow fiber membranes spaced apart from each other in the first chamber, the plurality of hollow fiber membranes defining a plurality of second chambers.
16. The method according to claim 15, wherein the biological material in each of the plurality of second chambers is at least one of: a plurality of T-cells, a plurality of iPSCs, and a plurality of NK cells.
17. The method according to any one of claims 15 and 16, wherein the biological material in each of the plurality of second chambers is of an identical type.
18. The method according to any one of the above claims, further comprising: providing a flow pressure to a feed source to flow the feed media from the feed source to the first chamber via the inlet port.
19. The method according to claim 18, further comprising: enhancing a gaseous exchange between the feed media and an environment.
20. The method according to any one of claims 18 to 19, further comprising: flowing the feed media in the first chamber to an exterior of the housing via the outlet port.
21. The method according to any one of the above claims, wherein the hollow fiber membrane is configured to allow diffusion of nutrients, reagents and metabolites in the feed media between the first chamber and the second chamber.
22. A viral transduction device comprising: a housing defining a first chamber for flowing a feed media, the first chamber being in fluid communication with an inlet port and an outlet port; a hollow fiber membrane, the hollow fiber membrane defining a second chamber in the first chamber, the second chamber for holding a biological material;wherein the hollow fiber membrane blocks transfer of the biological material from the second chamber to the first chamber, and allowing transfer of the feed media between the first chamber and the second chamber, wherein responsive to closing the outlet port of the first chamber, the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber, forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction wherein the fluid flow increases responsive to applying a fluid pressure to the fluid flow from one of a pair of membrane ports, wherein the pair of membrane ports are in fluid communication with the second chamber.
23. The viral transduction device according to claim 22, wherein the biological material in the second chamber is in suspension, partially rested or adherent on a surface of the second chamber.
24. The viral transduction device according to any one of claims 22 and 23, wherein the pair of membrane ports is sealably communicable with the second chamber.
25. The viral transduction device according to any one of claims 22 to 24, wherein the biological material comprises a plurality of cells, and at least one of: a plurality of viral particles, a plurality of mRNA molecules, and a plurality of nanoparticles.
26. The viral transduction device according to claim 25, wherein the plurality of cells comprises at least one of: a plurality of T-cells, a plurality of iPSCs, and a plurality of NK cells.
27. The viral transduction device according to any one of claims 22 to 26, further comprising a plurality of hollow fiber membranes disposed in the first chamber, each of the plurality of hollow fiber membranes spaced apart from each other in the first chamber, the plurality of hollow' fiber membranes defining a plurality of second chambers.
28. The viral transduction device according to claim 27, wherein the biological material in each of the plurality of second chambers is at least one of: a plurality of T-cells, a plurality of iPSCs, and a plurality of NK cells.
29. The viral transduction device according to any one of claims 27 and 28, wherein the biological material in each of the plurality of second chambers is of an identical type.
30. The viral transduction device according to any one of claims 22 to 29, further comprising a feed source in fluid communication with the inlet port of the first chamber.
31. The viral transduction device according to claim 30, further comprising a pump in fluid communication with the feed source.
32. The viral transduction device according to any one of claims 30 and 31, further comprising a gas exchanger in fluid communication between the inlet port and the feed source.
33. The viral transduction device according to claim 32, wherein the gas exchanger is any one of: a coiled gas permeable silicon tubing, a gas permeable membrane, an oxygenator.
34. The viral transduction device according to any one of claims 30 to 33, wherein the first chamber is in fluid communication with an exterior of the housing via the outlet port.
35. The viral transduction device according to any one of claims 22 to 34, wherein the hollow fiber membrane comprises an inner diameter equal to or smaller than 0.5mm.
36. The viral transduction device according to any one of claims 22 to 35, wherein the hollow fiber membrane is configured to allow diffusion of nutrients, reagents and metabolites in the feed media between the first chamber and the second chamber.
37. A viral transduction system, the viral transduction system comprising: a housing, the housing defining a first chamber for flowing a feed media therein, the first chamber being in fluid communication with an inlet port and an outlet port; and a hollow fiber membrane, the hollow fiber membrane defining a second chamber in the first chamber, the second chamber including a biological materialdisposed therein, wherein the hollow fiber membrane blocks transfer of the biological material from the second chamber to the first chamber, and allowing transfer of the feed media between the first chamber and the second chamber; wherein the system is configured to perform a method including: flowing the feed media into the first chamber; harvesting the biological material by closing the outlet port of the first chamber, wherein the feed media flows along a first direction from the first chamber across the hollow fiber membrane into the second chamber, forming a fluid flow in the second chamber along a second direction to exit the second chamber, the first direction being transverse to the second direction; and applying a fluid pressure to the fluid flow from one of a pair of membrane ports, wherein the pair of membrane ports are in fluid communication with the second chamber.
38. The viral transduction system according to claim 37, wherein the biological material in the second chamber is in suspension, partially rested or adherent on a surface of second chamber.
39. The viral transduction system according to any one of claims 37 and 38, wherein the method further comprises: loading the biological material into the second chamber by applying a negative pressure through one of the pair of membrane ports, the pair of membrane ports sealably communicable with the second chamber.
40. The viral transduction system according to claim 39, wherein the method further comprises: closing the pair of membrane ports, to hold the biological material in the second chamber.
41. The viral transduction system according to any one of claims 37 to 40, wherein the method further comprises: collecting the biological material from another of the pair of membrane ports.
42. The viral transduction system according to any one of claims 37 to 41, wherein the method further comprises: closing the outlet port of the first chamber to build up a first pressure in the first chamber, causing the feed media to flow from the first chamber across the hollow fiber membrane into the second chamber.
43. The viral transduction system according to claim 42, wherein the first pressure in the first chamber forms a pressure differential across the hollow fiber membrane relative to a second pressure in the second chamber.
44. The viral transduction system according to any one of claims 37 to 43, wherein the method further comprises: providing a flow pressure to a feed source to flow the feed media from the feed source to the first chamber via the inlet port.
45. The viral transduction system according to claim 44, wherein the method further comprises: enhancing a gaseous exchange between the feed media and an environment.
46. The viral transduction system according to any one of claims 44 and 45, wherein the method further comprises: flowing the feed media in the first chamber to an exterior of the housing via the outlet port.
47. The viral transduction system according to any one of claims 37 to 46, wherein the hollow fiber membrane is configured to allow diffusion of nutrients, reagents and metabolites in the feed media between the first chamber and the second chamber.
48. The viral transduction system according to any one of claims 37 to 47, wherein the method further comprises: collecting the biological material from another one of the pair of membrane ports.
49. The viral transduction system according to any one of claims 37 to 48, wherein applying the fluid pressure comprises providing a flow of feed media to the fluid flow along the second direction.
50. The viral transduction system according to any one of claims 37 to 49, wherein the method further comprises: applying the fluid pressure concurrently with the closing of the outlet port.51 . The viral transduction system according to any one of claims 37 to 49, wherein the method further comprises: applying the fluid pressure sequentially with the closing of the outlet port.
Citation Information
Patent Citations
Apparatus for efficient genetic modification of cells
US20190085280A1
Apparatus for modification of cells
US20230073620A1
Semi-automated hollow fiber system for viral transduction
US20230212495A1
Devices and processes for automated production of tumor infiltrating lymphocytes
WO2024011114A1