Biochip for spatial multi-omics analysis, preparation method therefor and application thereof

Abstract

Disclosed in the present invention are a chip for analyzing information of a biological sample, and a method for preparing the chip. The chip is suitable for analyzing spatial multi-omics information of a biological tissue sample. Further provided in the present invention is a method for analyzing spatial multi-omics information of a biological tissue sample. The method and device of the present invention can effectively obtain biological information, including spatial multi-omics information, in cells of tissue samples.

Description

Biosensor for spatial multi-omics analysis and preparation method and application thereof

[0001] The present application claims priority to the following Chinese patent application: Application No. 202410864954.0, filed on July 1, 2024, entitled “Biosensor for spatial multi-omics analysis and preparation method and application thereof”, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0002] The present application relates to the field of biology and medical devices. Specifically, the present application relates to a chip for analyzing multi-omics information of cells of a biological sample and a preparation method and application thereof, which is suitable for analyzing spatial multi-omics information of a biological tissue sample. BACKGROUND

[0003] The analysis of cellular organization and expression patterns of biological tissues is a milestone in biomedical research and diagnostics. Histocytology with various staining techniques has brought the possibility of studying protein distribution with immunohistochemistry and in situ hybridization of gene expression. New studies hope to characterize the transcriptome and / or genomic variations in tissues while preserving spatial information about the tissue.

[0004] In the prior art, chips are used to analyze nucleic acid information of cells of a biological sample, wherein methods for forming probes that recognize and bind nucleic acids of a biological sample on a substrate such as a glass slide are provided, as well as chip products carrying these probes.

[0005] There is still a need in the art for a chip for analyzing multi-omics information including nucleic acid information, protein information, etc. of cells of a biological sample and a preparation method thereof. SUMMARY

[0006] The present application provides a biosensor suitable for analyzing biological information of cells of a biological sample. The present application provides a method for preparing a biosensor having an array. The chip provided by the present application is suitable for analyzing spatial multi-omics information of a biological tissue sample.

[0007] In one aspect of the present application, the surface of the chip for analyzing information of a biological sample has probes forming an array, the probe array includes orthogonal rows and columns, and the probes in each array point of the array each have a different barcode sequence, which can be used to represent the spatial position of the array point.

[0008] Specifically, the present application provides a chip for analyzing information of a biological sample, wherein the surface of the chip has probes forming an array, the probe array includes orthogonal rows and columns, and the probes in each array point of the array each have a different barcode sequence,

[0009] wherein the probes comprise:

[0010] (a) nucleic acid probes that recognize and bind to target nucleic acids in a biological sample; and

[0011] (b) cellular probes that recognize and bind to target substances of cells in a biological sample.

[0012] In one aspect of the application, the cellular probes recognize and bind to target substances of cell nuclei.

[0013] In one aspect of the application, the barcode sequences of the probes in each spot of the array of the chip comprise a first barcode and a second barcode.

[0014] In yet another aspect of the application, each row of probes in the array of probes in the chip has the same first barcode and each column of probes has the same second barcode; each row of probes has a different second barcode and each column of probes has a different first barcode.

[0015] In one aspect of the application, each spot in the array of the chip has both the nucleic acid probes and the cellular probes.

[0016] In one aspect of the application, the nucleic acid probes and the cellular probes in each spot in the array of the chip have the same barcode sequences, e.g., the same first barcode and the same second barcode.

[0017] In one aspect of the application, the nucleic acid probes and the cellular probes in each spot in the array of the chip have different barcode sequences. For example, the same first barcode and different second barcodes, or different first barcodes and different second barcodes.

[0018] In one aspect of the application, the target nucleic acids are DNA or RNA, preferably mRNA.

[0019] In one aspect of the application, the target substances of the cells are cellular tissues, peptides, glycoproteins, lipoproteins, lipid molecules, DNA, RNA, PNA, nucleotides, or polysaccharides.

[0020] In one aspect of the application, the chip has chip surface linker nucleic acids on its entire surface.

[0021] In one aspect of the application, the 5' end of each nucleic acid and / or cellular probe in the array of probes of the chip is the chip surface linker nucleic acid.

[0022] In one aspect of the present application, each probe in the probe array of the chip further comprises a unique molecular identifier (UMI). Preferably, the nucleic acid probe and the cell probe in each array spot have the same UMI.

[0023] In one aspect of the present application, the sequence of each probe in the probe array of the chip comprises a primer segment at the 5' end for amplification reaction.

[0024] In one aspect of the present application, the 3' end of the chip surface adaptor nucleic acid has a ligation segment for ligation with a first barcode nucleic acid via a first single-stranded ligation nucleic acid, the 5' end of the first barcode nucleic acid has a ligation segment for ligation with the chip surface adaptor nucleic acid via the first single-stranded ligation nucleic acid, and the ligation segment at the 3' end of the chip surface adaptor nucleic acid and the ligation segment at the 5' end of the first barcode nucleic acid are respectively reverse-complement to the sequence at the two ends of the first single-stranded ligation nucleic acid. In one aspect of the present application, the 3' end of the first barcode nucleic acid of the chip has a first ligation segment for ligation with a second barcode nucleic acid via a second single-stranded ligation nucleic acid, the 5' end of the second barcode nucleic acid has a second ligation segment for ligation with the first barcode nucleic acid via the second single-stranded ligation nucleic acid, and the first ligation segment and the second ligation segment are respectively reverse-complement to the sequence at the two ends of the second single-stranded ligation nucleic acid.

[0025] In one aspect of the present application, the chip surface adaptor nucleic acid is fixed on the chip surface by chemical bond connection, such as any one selected from the group consisting of group connection of amino-aldehyde group reaction, and covalent cross-linking.

[0026] In one aspect of the present application, the sequence of each nucleic acid probe in the probe array of the chip comprises, from 5' end to 3' end, a first barcode, a second barcode, and a capture segment for recognizing and binding to a target nucleic acid in a biological sample.

[0027] In one aspect of the present application, the sequence of each cell probe in the probe array of the chip comprises, from 5' end to 3' end, the first barcode, the second barcode, and a ligand molecule for recognizing and binding to a target substance of a cell in a biological sample. In one aspect of the present application, the target substance and the ligand are non-specific binders or specific binders. In one aspect of the present application, the target substance and the ligand are antibody / antigen, antibody / hapten, enzyme / substrate, enzyme / inhibitor, enzyme / cofactor, binding protein / substrate, carrier protein / substrate, lectin / carbohydrate, receptor / hormone, receptor / effector, or repressor / inducer, lipid molecule / lipid molecule binding molecule.

[0028] In one aspect of the present application, the sequence of each cell probe in the probe array further comprises a cleavable linker at the 5' end. In one aspect of the present application, the cleavable linker comprises a linker selected from the group consisting of: an enzymatically cleavable linker; a nucleophile / base sensitive linker; a reduction sensitive linker; a photo-cleavable linker; an electrophile / acid sensitive linker; a metal-assisted cleavage sensitive linker; an oxidation sensitive linker; and a combination of two or more of the foregoing.

[0029] In one aspect of the present application, the ratio of the nucleic acid probe to the cell probe in each spot of the array is about 1:10 3 -10 3 :1, or about 1:10-10:1. 2 -10 3 :1, or about 1:10-10:1.

[0030] In one aspect of the present application, the ratio of the nucleic acid probe to the cell probe in each spot of the array is about 5:1-1:5, or about 3:1-1:3, or about 1:1.

[0031] In one aspect of the present application, the probe density of the spots of the chip is about 10 3 -10 5 μm 2 .

[0032] The present application also provides a method for preparing a biochip.

[0033] In one aspect of the present application, the biochip is a chip for analyzing information of a biological sample.

[0034] Specifically, in the present application, a method for preparing a biochip with an array is provided, which comprises the following steps:

[0035] Step 1. Providing a chip;

[0036] Step 2. Applying a first group of barcoded nucleic acids to the surface of the chip through a plurality of parallel microfluidic channels to form a plurality of first barcoded bands in a first direction, wherein the first group of barcoded nucleic acids comprises a plurality of first barcoded nucleic acids with different barcode sequences, one first barcoded nucleic acid is immobilized on each first barcoded band, and the first barcoded nucleic acid immobilized on each first barcoded band has a different barcode sequence;

[0037] Step 3. A second set of barcoding nucleic acids, which comprises a plurality of second barcoding nucleic acids with different barcode sequences, is applied to the chip surface through a plurality of microfluidic channels arranged in parallel in a second direction to form a plurality of second barcode bands, each of which has one second barcoding nucleic acid, and the second barcoding nucleic acid immobilized on each second barcode band has a different barcode sequence.

[0038] Step 4. The second barcoding nucleic acid is ligated to the first barcoding nucleic acid at the position where the plurality of first barcode bands and the plurality of second barcode bands intersect on the chip surface under conditions that allow the first barcoding nucleic acid and the second barcoding nucleic acid to undergo ligation to form probes, and the position of the probes (i.e., the position where the plurality of first barcode bands and the plurality of second barcode bands intersect) constitutes the array points of the array, each of which has one probe with a different sequence.

[0039] In one aspect of the present application, the microfluidic device with a plurality of microfluidic channels arranged in parallel is used to deliver and immobilize the first set of barcoding nucleic acids or the second set of barcoding nucleic acids on the chip surface, wherein the side of the microfluidic channel in contact with the chip surface can be permeable to solutions or nucleic acids in solutions.

[0040] In one aspect of the present application, one first set of barcoding nucleic acids or one second set of barcoding nucleic acids with different barcode sequences is added to each microfluidic channel of the microfluidic device.

[0041] In one aspect of the present application, step 2 comprises: immobilizing a chip surface adaptor nucleic acid on the chip surface; and applying the first set of barcoding nucleic acids to the chip surface through a plurality of microfluidic channels arranged in parallel in a first direction to form a plurality of first barcode bands under conditions that allow the chip surface adaptor nucleic acid and the first barcoding nucleic acid to undergo ligation.

[0042] In yet another aspect of the present application, the chip surface adaptor nucleic acid can be immobilized on the chip surface by chemical bonding. The chemical bonding can be any one selected from the group consisting of group bonding such as amino-aldehyde reaction, and covalent cross-linking. The surface of the chip can be coated with active groups such as amino, aldehyde, epoxy, isothiocyanate, thiol, silane, etc. by surface chemistry. The end of the chip surface adaptor nucleic acid (usually the 5' end) connected to the chip surface has a group that forms a chemical bond with the coated active group.

[0043] In yet another aspect of the present application, the chip surface adaptor nucleic acid can be physically adsorbed on the chip surface, for example, by hydrophobic interaction, electrostatic attraction, etc. For example, the chip surface can be modified with poly-L-lysine (PLL) or treated with a surfactant.

[0044] In yet another aspect of the present application, the 3' end of the chip surface adaptor nucleic acid has a ligation segment for ligation with a first barcode nucleic acid. In one embodiment of the present application, the ligation segment of the chip surface adaptor nucleic acid is ligated with the first barcode nucleic acid via a first single-stranded ligation nucleic acid; the 5' end of the first barcode nucleic acid has a ligation segment for ligation with the chip surface adaptor nucleic acid via the first single-stranded ligation nucleic acid; the ligation segment of the 3' end of the chip surface adaptor nucleic acid and the ligation segment of the 5' end of the first barcode nucleic acid are respectively reverse-complementary to the sequences at the two ends of the first single-stranded ligation nucleic acid.

[0045] In yet another aspect of the present application, the chip surface adaptor nucleic acid can have about 10-50 nucleotides, preferably less than 30 nucleotides, for example, less than 25 nucleotides.

[0046] In one aspect of the present application, the first barcode nucleic acid in the first set of barcode nucleic acids in the method comprises a first barcode segment. In yet another aspect of the present application, the 5' end of the first barcode nucleic acid in the first set of barcode nucleic acids has a ligation segment for ligation with the chip surface adaptor nucleic acid, and the 3' end has a first ligation segment for ligation with a second barcode nucleic acid.

[0047] In one aspect of the present application, the second barcode nucleic acid in the second set of barcode nucleic acids has a capture segment at the 3' end for recognizing and binding to a target nucleic acid in the biological sample (for example, a segment for recognizing and binding to mRNA or cDNA, for example, a poly-T sequence) and a second barcode segment.

[0048] In one aspect of the present application, the second barcode nucleic acid in the second set of barcode nucleic acids in the method further has a unique molecular identifier (UMI).

[0049] In one aspect of the present application, the 3' end of the first barcode nucleic acid in the method has a first ligation segment for ligation with a second barcode nucleic acid via a second single-stranded ligation nucleic acid, and the 5' end of the second barcode nucleic acid has a second ligation segment for ligation with the first barcode nucleic acid via the second single-stranded ligation nucleic acid, and the first ligation segment and the second ligation segment are respectively reverse-complementary to the sequences at the two ends of the second single-stranded ligation nucleic acid.

[0050] In one aspect of the application, the probes formed in step 4 of the method comprise nucleic acid probes that recognize and bind to target nucleic acids in the biological sample; and (b) cell probes that recognize and bind to target substances of cells in the biological sample.

[0051] In one embodiment, the nucleic acid probes comprise, from 5' end to 3' end, the chip surface adaptor nucleic acid, a first barcode, a second barcode, and a capture fragment that recognizes and binds to target nucleic acids in the biological sample.

[0052] In one embodiment, the cell probes comprise, from 5' end to 3' end, the first barcode, a second barcode, and a ligand molecule that recognizes and binds to target substances of cells in the biological sample. The target substance and the ligand are either non-specific or specific binding partners. For example, the target substance and the ligand are antibody / antigen, antibody / hapten, enzyme / substrate, enzyme / inhibitor, enzyme / cofactor, binding protein / substrate, carrier protein / substrate, lectin / carbohydrate, receptor / hormone, receptor / effector, or repressor / inducer, lipid molecule / lipid molecule binding molecule, etc.

[0053] In one aspect of the application, the sequence of the first barcode segment of each first barcode nucleic acid in the first set of barcode nucleic acids and / or the sequence of the second barcode segment of each second barcode nucleic acid in the second set of barcode nucleic acids is specified.

[0054] In one aspect of the application, the sequence of the first barcode segment and the second barcode segment of the probes is specified.

[0055] In one aspect of the application, the chip surface adaptor nucleic acid is applied to the surface of the chip in step 2 of the method at a concentration of about 0.1-100 uM / L, for example, about 1-20 uM / L.

[0056] In one aspect of the application, the concentration of nucleic acids in the flow channel in step 3 of the method is about 0.1-100 uM, for example, about 1-20 uM.

[0057] In one aspect of the application, the concentration of nucleic acids in the flow channel in step 4 of the method is about 0.1-100 uM, for example, about 1-20 uM.

[0058] In one aspect of the application, the width of each microchannel of the parallelly arranged microchannels in steps 3 and 4 of the method is about 2-200 μm, preferably about 5-50 μm, most preferably about 5-25 μm, for example, about 5 μm, 10 μm or 50 μm.

[0059] In one aspect of the application, the spacing between each adjacent microfluidic channel of the parallel microfluidic channels in step 3 and step 4 of the method is about 5-400 μm, preferably about 10-100 μm, and most preferably about 10-50 μm, such as about 20 μm, 50 μm or 100 μm.

[0060] In one aspect of the application, the density of probes on the spots of the chip produced by the method is about 10 3 -10 5 probes per μm 2 .

[0061] In one aspect of the application, the uniformity of the probes on the spots of the chip produced by the method is less than 20%, preferably less than 10%, and more preferably less than 6%.

[0062] In one aspect of the application, the uniformity of the size of the spots of the chip produced by the method is less than 10%, preferably less than 5%, and more preferably less than 2%.

[0063] The chip as described above or produced by the method as described above can be used for intracellular molecule analysis of tissue samples, in particular tissue sections, including nucleic acid and protein analysis, such as by PCR, mass spectrometry, next generation sequencing, or ELISA, to obtain expression and spatial information.

[0064] The application provides a method for analyzing spatial transcriptomic information of a biological tissue sample using a chip having an array, the method comprising contacting the probe array of the chip as described above with the tissue sample, the probes on the array recognizing and binding to nucleic acids, in particular mRNA, of cells in the tissue, and the cellular probes on the array recognizing and binding to target substances of cells in the tissue.

[0065] In one aspect of the application, the nucleic acids of the cells in the tissue are released from the cells by permeabilizing the tissue when the tissue is fixed and embedded. In another aspect of the application, the nucleic acids of the cells in the tissue are released from the cells by permeabilizing the tissue when the tissue is not fixed and embedded.

[0066] In another aspect of the application, the method further comprises performing a reverse transcription reaction.

[0067] In another aspect of the application, the method further comprises isolating and purifying the cDNA after collecting the tissue / cells, such as by lysing the tissue / cells and isolating and purifying the nucleic acids in a container after separating the tissue from the chip.

[0068] In another aspect of the application, the method further comprises amplifying the cDNA molecules.

[0069] In yet another aspect of the application, the method further comprises library construction / sequencing of the amplified nucleic acids.

[0070] In one aspect of the application, the method further comprises the step of detaching the cell probes on the chip from the chip surface (e.g. cleaving and releasing the probes on the chip) into contact with the tissue and cells. In yet another aspect of the application, the method further comprises the step of allowing the probes to pass through the cell membrane and contact the nucleus of the cells.

[0071] In yet another aspect of the application, the method further comprises single cell library construction / sequencing of the cells of the tissue.

[0072] In yet another aspect of the application, the method further comprises dissociating the cells of the tissue and obtaining the nuclei.

[0073] In one aspect of the application, each array spot of the array of the chip has the nucleic acid probes and the cell probes, preferably, the nucleic acid probes and the cell probes of each array spot of the array are used to analyze the same tissue sample, and the biological information obtained from the nucleic acid probes and the cell probes are linked respectively using the barcode information of the nucleic acid probes and the cell probes.

[0074] In one aspect of the application, the biological sample is a tissue sample from a subject, for example, a surgical resection tissue sample, preferably a thin section of tissue processed by microtomy. In one aspect of the application, the tissue sample is fixed and embedded (e.g. embedded in paraffin) and attached to a support such as a glass slide. In one aspect of the application, the nucleic acids of the cells in the fixed tissue are released from the tissue after permeabilization and bind to the probes on the chip.

[0075] In one aspect of the application, the thin section of tissue can be subjected to morphological analysis and / or histological analysis by H&E staining, IHC staining, ISH staining, and FISH staining.

[0076] In one aspect of the application, the analysis of the one or more biomolecules is performed by PCR, mass spectrometry, next generation sequencing, or ELISA.

[0077] In one aspect of the application, the subject is selected from an animal, a farm animal, a pet, a human subject.

[0078] In one aspect of the present application, the analyte further comprises one or more of a non-human cell, a human cell, a non-native protein, a nucleic acid, or a small molecule, a dye, a virus, a bacterium, a parasite, a protozoan, or a chemical. The small molecule includes a hapten, a peptide tag, a protein tag, a fluorescent tag, a nucleic acid tag, and combinations thereof.

[0079] The chip of the present application can be used to analyze a tissue sample. The tissue sample includes a sample selected from the group consisting of one or more pre-malignant or malignant cells, cells from a solid tumor, a soft tissue tumor or metastasis, tissue or cells from a surgical margin, histologically normal tissue, one or more circulating tumor cells (CTC), normal adjacent tissue (NAT), a blood sample from the same subject with or at risk of having a tumor, or a FFPE sample. BRIEF DESCRIPTION OF DRAWINGS

[0080] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings described below are some embodiments of the present application.

[0081] FIG. 1 is a flow diagram of exemplary steps of a method for preparing a chip according to the present application.

[0082] FIG. 2 is an exemplary embodiment of a device with multiple parallel microfluidic channels used in the method of the present application.

[0083] FIG. 3 is a schematic diagram of nucleic acid probes and cell probes on a spot of a chip according to the present application.

[0084] FIG. 4 shows the evaluation of the formation of nucleic acid probes and cell probes on the prepared chip according to the observation of fluorescent signals. In the same spot of the chip, both the fluorescent signal of Cy3 carried by the first set of barcode nucleic acids (left) and the fluorescent signal of modified FITC carried by the second set of barcode nucleic acids (right) are included.

[0085] FIG. 5 shows a HE staining of mouse brain tissue.

[0086] FIG. 6 shows the microscopic examination (trypan blue staining) of the nuclei after the tissue is lysed and the nuclei are collected.

[0087] FIG. 7 is a visualized barcode space distribution map of spatial group analysis of mouse brain tissue by the biochip according to the present application.

[0088] FIG. 8 is a Gene heat map and numerical distribution map of spatial group analysis of mouse brain tissue by the biochip according to the present application.

[0089] FIG. 9 is a gene cluster analysis result chart of spatial group analysis of mouse brain tissue by the biochip provided by the present application.

[0090] FIG. 10 is a single cell barcode-space cell barcode correspondence matrix of spatial group analysis of mouse brain tissue by the biochip provided by the present application. The first column is the single cell barcode, the second column is the spatial barcode carried by the single cell from the collected cell nucleus, the third column is the corresponding spatial position row number, and the fourth column is the corresponding spatial position column number. DETAILED DESCRIPTION

[0091] To make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are some but not all of the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0092] Embodiment 1

[0093] The present application provides a biochip suitable for analyzing biological information of cells in a biological sample. The present application provides a method for preparing a biochip with an array. The chip provided by the present application is suitable for analyzing spatial multi-omics information of a biological tissue sample.

[0094] The present application provides a chip for analyzing information of a biological sample. In one aspect of the present application, the chip for analyzing information of a biological sample is prepared by the aforementioned method. In one aspect of the present application, the surface of the chip for analyzing information of a biological sample has a probe array formed thereon, the probe array comprising orthogonal rows and columns, and each probe in each array point of the array has a different barcode sequence, which can be used to represent the spatial position of the array point.

[0095] In one aspect of the present application, the probe in each array point of the array comprises:

[0096] (a) a nucleic acid probe for recognizing and binding to a target nucleic acid in a biological sample; the target nucleic acid can be DNA or RNA, preferably mRNA;

[0097] and

[0098] (b) a cell probe for recognizing and binding to a target substance of a cell in a biological sample. The target substance of the cell can be a cell tissue, a peptide, a glycoprotein, a lipoprotein, a lipid molecule, DNA, RNA, PNA, a nucleotide or a polysaccharide.

[0099] In one aspect of the present application, the cell probe recognizes and binds to a target substance of a cell. The cell probe penetrates into the cell through the cell membrane and specifically or non-specifically recognizes and binds to a target substance of the cell nucleus.

[0100] In one aspect of the present application, the barcode sequence of the probe in each array point of the array comprises a first barcode and a second barcode. In one embodiment, each row of probes of the probe array has the same first barcode and each column of probes has the same second barcode; each row of probes has different second barcodes and each column of probes has different first barcodes.

[0101] In one aspect of the present application, each array point of the array has the nucleic acid probe and the cell probe.

[0102] In one embodiment, the nucleic acid probe and the cell probe in each array point have the same barcode sequence. For example, the same first barcode and the same second barcode.

[0103] In one embodiment, the nucleic acid probe and the cell probe in each array point have different barcode sequences. For example, the same first barcode and different second barcodes. For another example, different first barcodes and different second barcodes.

[0104] In one aspect of the present application, the probe of the chip comprises a first barcode and a second barcode. In yet another aspect of the present application, each row of probes of the probe array has the same first barcode and each column of probes has the same second barcode; each row of probes has different second barcodes and each column of probes has different first barcodes.

[0105] In yet another aspect of the present application, the sequence of the probe in the probe array comprises, from 5' end to 3' end, a first barcode, a second barcode, a capture fragment for recognizing and binding to a target nucleic acid in a biological sample or recognizing and binding to a target substance of a cell in a biological sample. In yet another aspect of the present application, the sequence of the probe in the probe array comprises a primer fragment at the 5' end for amplification reaction. In yet another aspect of the present application, the sequence of the probe in the probe array further comprises a unique molecular identifier (UMI).

[0106] In one aspect of the present application, the chip for analyzing information of a biological sample has a chip surface linker nucleic acid on the entire surface thereof.

[0107] In another aspect of the invention, the 5' end of the probes in the probe array is the chip surface linker nucleic acid. In yet another aspect of the invention, the sequence of the probes in the probe array, from the 5' end to the 3' end, includes the chip surface linker nucleic acid, a first barcode, a second barcode, and a capture fragment for recognizing and binding target nucleic acids in a biological sample or for recognizing and binding target substances of cells in a biological sample.

[0108] In another aspect of the invention, the 5' end of each probe in the probe array is a chip-surface linker nucleic acid. In yet another aspect of the invention, the sequence of each nucleic acid probe in the probe array, from its 5' end to its 3' end, includes the chip-surface linker nucleic acid, a first barcode, a second barcode, and a capture fragment for recognizing and binding target nucleic acids in a biological sample. In yet another aspect of the invention, the sequence of each probe in the probe array includes a primer fragment at its 5' end for an amplification reaction. The sequence of each cell probe in the probe array, from its 5' end to its 3' end, includes the chip-surface linker nucleic acid, a first barcode, a second barcode, and a ligand molecule for recognizing and binding target substances to cells in a biological sample. The target substance and the ligand are either non-specific or specific binders to each other. For example, the target substance and the ligand are antibodies / antigens, antibody / haptens, enzymes / substrates, enzymes / inhibitors, enzymes / cofactors, binding proteins / substrates, carrier proteins / substrates, lectins / carbohydrates, receptors / hormones, receptors / effectants, or inhibitors / inducers, lipid molecules / lipid-binding molecules, etc. In one aspect of the invention, the sequence of each cell probe in the probe array further includes a cleavable linker at its 5' end. The cleavable linker includes linkers selected from: enzymatically cleavable linkers; nucleophilic / base-sensitive linkers; reduction-sensitive linkers; photocleavable linkers; electrophilic / acid-sensitive linkers; metal-assisted cleavage-sensitive linkers; oxidation-sensitive linkers; and combinations of two or more of the foregoing.

[0109] Methods for preparing biochips with arrays, which can be used in accordance with the present invention, are disclosed in WO2022135598A1 and WO2023116938A1. The entire contents of WO2022135598A1 and WO2023116938A1 are incorporated herein by reference.

[0110] Figure 1 is a schematic flowchart of an exemplary method for preparing a biochip with an array provided by the present invention.

[0111] As shown in Figure 1, the method mainly includes the following steps:

[0112] Step 1. Provide a chip, or called substrate; coat the chip surface with active groups such as amino, aldehyde, epoxy, isothiocyanate, thiol, silane, etc. by surface chemistry reactions in order to immobilize chip surface adaptor nucleic acids on the chip surface for the next step.

[0113] Step 2. Apply the first set of barcode nucleic acids to the chip surface through a plurality of microfluidic channels arranged in parallel to form a plurality of first barcode strips in the first direction, wherein the first set of barcode nucleic acids comprises a plurality of first barcode nucleic acids with different barcode sequences, and each first barcode strip immobilizes one first barcode nucleic acid, and the first barcode nucleic acid immobilized on each first barcode strip has a different barcode sequence.

[0114] In step 2, the first set of barcode nucleic acids can be directly immobilized on the chip surface. In another aspect of the present application, the first set of barcode nucleic acids is immobilized on the chip by ligation with the chip surface adaptor nucleic acids that have been immobilized on the chip surface. The chip surface adaptor nucleic acids can comprise a ligation fragment at the 3' end for ligation with the first barcode nucleic acids. In one embodiment of the present application, step 2 comprises: immobilizing chip surface adaptor nucleic acids on the chip surface, for example, on the surface of the whole chip; applying the first set of barcode nucleic acids to the chip surface through a plurality of microfluidic channels arranged in parallel under conditions that allow ligation between the chip surface adaptor nucleic acids and the first barcode nucleic acids to form a plurality of first barcode strips in the first direction.

[0115] Figure 2 shows one exemplary embodiment of applying a plurality of barcode nucleic acids to the chip surface through a plurality of microfluidic channels arranged in parallel, either directly immobilized on the chip surface or immobilized on the chip surface by ligation with chip surface adaptor nucleic acids on the chip surface. The bottom of the left panel of Figure 2 is the chip. The middle of the left panel of Figure 2 shows a microfluidic device with a plurality of microfluidic channels (microfluidic channel 1 to microfluidic channel n) arranged in parallel, wherein the side of the microfluidic channels that is in contact with the chip surface, i.e. the bottom of the microfluidic channels shown in the figure, is permeable to solutions or nucleic acids in solutions. For example, the side of the microfluidic channels that is in contact with the chip surface is free of microfluidic walls. The microfluidic device is overlaid on the chip surface in the first direction, and then the specified solutions, for example, solutions containing barcode nucleic acids, are introduced into the microfluidic channels. The top of the left panel of Figure 2 is an exemplary device that assists in introducing solutions, for example, a vacuum suction device that utilizes negative pressure, which can be placed at the outlet of the microfluidic channels. The right panel of Figure 2 shows that different barcode nucleic acids (barcode nucleic acids 1-n in the figure) with different barcode sequences are introduced into each microfluidic channel through the inlet. In one aspect of the present application, the barcode sequences of the barcode nucleic acids introduced into each microfluidic channel have known or specified nucleotide sequences.

[0116] As shown in FIG. 1, the 5' end of the first barcode nucleic acid has a ligation segment for ligation with the chip surface adaptor nucleic acid through a single-stranded ligation nucleic acid (first adaptor); the ligation segment at the 3' end of the chip surface adaptor nucleic acid and the ligation segment at the 5' end of the first barcode nucleic acid are respectively reverse complementary to the sequences at the two ends of the first adaptor.

[0117] Step 3. Remove the microfluidic channel in step 2, and apply a second set of barcode nucleic acid molecules to the chip surface in a second direction (usually perpendicular to the first direction) through another set of multiple parallel microfluidic channels to the first direction of the chip surface, forming multiple second barcode bands, the second set of barcode nucleic acid molecules including multiple second barcode nucleic acids with different barcode sequences, each second barcode band having one second barcode nucleic acid, and the second barcode nucleic acid immobilized on each second barcode band having different barcode sequences.

[0118] In the illustrated example, the 3' end of the first barcode nucleic acid has a first ligation segment for ligation with the second barcode nucleic acid through a single-stranded ligation nucleic acid (second adaptor), and the 5' end of the second barcode nucleic acid has a second ligation segment for ligation with the first barcode nucleic acid through the second adaptor, the first ligation segment and the second ligation segment being respectively reverse complementary to the sequences at the two ends of the second adaptor nucleic acid. Under conditions that enable the first barcode nucleic acid and the second barcode nucleic acid to undergo ligation reaction, the second barcode nucleic acid is ligated with the first barcode nucleic acid to form a probe at the chip surface where the multiple first barcode bands intersect with the multiple second barcode bands.

[0119] In one embodiment of the present application, each array point in the probe array has a nucleic acid probe and a cell probe. As shown in FIG. 3, each array point in the probe array has one nucleic acid probe and one cell probe. The second barcode segment of the probe (nucleic acid probe or cell probe) includes a 3' end poly-T sequence that recognizes and binds mRNA (for nucleic acid probes on chips of the present application) or a ligand molecule that recognizes and binds a target substance of cells in a biological sample, a unique molecular identifier (UMI), and a second barcode sequence segment (for cell probes on chips of the present application).

[0120] The second barcode segments of the two probes for the same array point of the chip can be mixed and added to each microfluidic channel in the parallel arrangement.

[0121] In one embodiment of the present application, each array point in the probe array on the chip has the nucleic acid probe and the cell probe, and the nucleic acid probe and the cell probe in each array point have the same first barcode sequence and the same second barcode sequence. In another embodiment, the nucleic acid probe and the cell probe in each array point can have different first barcode sequences and / or different second barcode sequences.

[0122] In one embodiment, the sequence of each nucleic acid probe in the probe array comprises, from 5' end to 3' end, a first barcode, a second barcode, a capture segment for recognizing and binding to a target nucleic acid in a biological sample, and the sequence of each cell probe comprises, from 5' end to 3' end, the first barcode, the second barcode, a ligand molecule for recognizing and binding to a target substance of a cell in a biological sample. The target substance and the ligand are antibody / antigen, antibody / hapten, enzyme / substrate, enzyme / inhibitor, enzyme / cofactor, binding protein / substrate, carrier protein / substrate, lectin / carbohydrate, receptor / hormone, receptor / effector, lipid molecule / lipid molecule binding molecule.

[0123] The sequence of each cell probe in the probe array further comprises a cleavable linker at the 5' end. The cleavable linker comprises a linker selected from the group consisting of: an enzymatic cleavable linker; a nucleophile / base sensitive linker; a reduction sensitive linker; a photocleavable linker; an electrophile / acid sensitive linker; a metal-assisted cleavage sensitive linker; an oxidation sensitive linker; and a combination of two or more of the foregoing.

[0124] Step 4. Removing the microfluidic channel in step 3 to obtain a biochip having a probe array on the surface. Each array point on the probe array corresponds to a position where the plurality of first barcode bands intersect with the plurality of second barcode bands. Each array point has a probe molecule comprising a first barcode sequence and a second barcode sequence. The combination of the first barcode sequence and the second barcode sequence of the probe molecule in each array point is different. In one aspect of the present application, the first barcode sequence and the second barcode sequence of the barcode nucleic acid introduced into each microfluidic channel are known or designated, so that the spatial position of each array point in the array on the chip surface can be known by the first barcode sequence and the second barcode sequence of the probe molecule in each array point.

[0125] The chip as a substrate in step 1 generally refers to a solid substrate on which chemical, biological, biophysical or biochemical processes, etc. can be carried out.

[0126] The chip can be made of any suitable material, exemplary types of chip materials include glass, modified glass, functionalized glass, inorganic glass, microspheres (including inert and / or magnetic particles), plastic, polysaccharide, nylon, nitrocellulose, ceramic, resin, silica, silica-based materials, carbon, optical fiber or fiber bundle, various polymers other than the materials exemplified above, and multi-well microtiter plates.

[0127] In the present invention, the probes have barcode sequences for use in subsequent high-throughput next generation sequencing (NGS) or sequencing by synthesis (SBS) analysis applications, such as in high-throughput sequencing analysis. In these sequencing applications, the barcode sequences are used to mark and identify the source of the nucleic acids whose sequences are obtained from sequencing. Barcode molecules are used to barcode nucleic acid molecules (e.g., RNA molecules) from biological particles (e.g., cells) to generate sequencing libraries, which are then sequenced to produce a plurality of sequencing reads. Some or all of the plurality of sequencing reads include a barcode sequence. In these sequencing applications, the cellular nucleic acids are typically amplified until the barcoded overlapping fragments in a subject constitute at least IX coverage, at least 5X, at least 10X, at least 20X, at least 40X, or higher coverage of a particular portion or the entire cellular genome. Once the barcoded fragments are generated, they can be sequenced directly on a suitable sequencing system, such as an Illumina system. The presence of the same barcode across multiple sequences can provide information about the origin of that sequence.

[0128] In the present invention, the probes contain two barcode sequences in the resulting probes. The two barcode sequences can help determine the position of the probe in the array on the chip surface (determining the X and Y dimensions, respectively). The barcode sequence on the probe can correspond to the array spot in the array on the chip, and can also indicate the location of the cell, including a single cell, on the tissue that it identifies, in the tissue sample. Examples of other molecules that can be coupled to the nucleic acid tag include antibodies, antigen binding domains, proteins, peptides, receptors, haptens, and the like.

[0129] In the present invention, the probes also include one or more unique molecular identifiers (UMIs). The UMIs act as a label or identifier for a particular analyte or a capture probe that binds to a particular analyte.

[0130] In the present application, the first set of barcode nucleic acids of step 2 can be directly immobilized on the chip surface. In another aspect of the present application, the first set of barcode nucleic acids are immobilized on the chip by ligation to chip surface adaptor nucleic acids that have been immobilized on the chip surface. The immobilization of the first set of barcode nucleic acids or the chip surface adaptor nucleic acids on the chip can be performed using any of the methods known in the art for immobilizing nucleic acids. Immobilization of nucleic acids refers to the direct or indirect attachment to the chip surface through covalent or non-covalent bonds. In one aspect of the present application, immobilization refers to the immobilization of nucleic acids on the chip surface under conditions that allow for subsequent reactions such as nucleic acid amplification and / or sequencing. In one aspect of the present application, nucleic acids immobilized on the chip surface can be released from the chip surface under specified conditions during subsequent reactions such as nucleic acid amplification and / or sequencing.

[0131] The ligation of the chip surface adaptor nucleic acids to the first barcode nucleic acid, and the ligation of the first barcode nucleic acid to the second barcode nucleic acid can be performed using any of the methods known in the art. For example, the ligation can be achieved by forming a combination of the three nucleic acid fragments (the first barcode nucleic acid, the second barcode nucleic acid, and the adaptor nucleic acid) under conditions that allow for ligation, by virtue of the complementarity of the sequences at the different ends of each of the three nucleic acid fragments to the other two nucleic acid fragments.

[0132] In one aspect of the present application, the 3' end of the first barcode nucleic acid has a first ligation segment for ligation to the second barcode nucleic acid. In another aspect of the present application, the 5' end of the second barcode nucleic acid has a second ligation segment for ligation to the first barcode nucleic acid. In yet another aspect of the present application, the first ligation segment and the second ligation segment form a complement to one end of the adaptor nucleic acid, and the combination of the first ligation segment and the second ligation segment to the adaptor nucleic acid under conditions that allow for ligation (e.g., in the presence of T4 ligase) results in the ligation of the first barcode nucleic acid to the second barcode nucleic acid.

[0133] The method of the present application for preparing a chip with an array of probes allows for the parallel synthesis of multiple chips with the same array of encoding regions on the same substrate. Multiple sets of the same first barcode band and second barcode band can be formed in the first direction and the second direction of the chip substrate as desired, thereby resulting in multiple chips with the same first barcode and second barcode sequence defining the probes at the corresponding array positions.

[0134] The chips prepared using the method of the present application can be used for the analysis of intracellular molecules, including nucleic acids and proteins, in tissue samples, particularly tissue sections, for example, by PCR, mass spectrometry, next generation sequencing, or ELISA, to obtain their expression and spatial information.

[0135] In use, the chip of the present application comprises contacting a tissue section with the array. The nucleic acid probes on the array can recognize and bind to nucleic acids, particularly mRNA, of cells in the tissue. Subsequent analysis includes reverse transcription and amplification, and can be analyzed by high-throughput next generation sequencing or sequencing by synthesis. The cellular probes on the array can recognize and bind to target substances of cells in the tissue. In one aspect of the present application, the cellular probes on the array dissociate from the chip into the tissue and bind to target substances of cells in the tissue. In yet another aspect of the present application, the cellular probes on the array can penetrate the cell membrane and bind to target substances of the nucleus. Subsequent steps can include isolating cells of the tissue for single cell analysis. Subsequent steps can also include extracting and enriching the nucleus for single cell analysis.

[0136] The method of the present application provides a chip that can be used for intracellular molecule analysis, including nucleic acid and protein analysis, of a tissue sample, particularly a thin section of tissue, for example by PCR, mass spectrometry, next generation sequencing, or ELISA, to obtain expression and spatial information.

[0137] The present application also provides a method for analyzing spatial transcriptomic information of a biological tissue sample, the method comprising contacting the array described above with the tissue sample. In this way, the nucleic acid probes on the array recognize and bind to nucleic acids of cells in the tissue, and the cellular probes on the array recognize and bind to target substances of cells in the tissue.

[0138] A "tissue sample" suitable for the present application includes tissue obtained from a subject, fixed, sectioned, and mounted on a planar surface. The tissue sample can be a formalin-fixed paraffin-embedded (FFPE) tissue sample or a fresh tissue sample or a frozen tissue sample, etc. The method of the present application can be performed before or after staining the tissue sample. For example, after hematoxylin and eosin staining, the tissue sample can be subjected to spatial analysis according to the methods provided herein. The method can comprise analyzing the histology of the sample (e.g., using hematoxylin and eosin staining) and then spatially analyzing the tissue. Formalin fixation and paraffin embedding (FFPE) of tissue sections typically involves fixing tissue obtained from a subject in formaldehyde (e.g., 3-5% formaldehyde in phosphate buffered saline) or Bouin's solution, embedding into wax, sectioning into thin sections, and then mounting on a planar surface, such as a microscope slide, for histology. The method of the present application comprises contacting the tissue section with the probe array on the chip, and the probes on the array can recognize and bind to nucleic acids, particularly mRNA, of cells in the tissue. Subsequent analysis includes reverse transcription and amplification, and can be analyzed by high-throughput next generation sequencing or sequencing by synthesis.

[0139] In one aspect of the present application, the method comprises a step of releasing nucleic acids from cells in the tissue into contact with the probes on the chip. When the tissue is a fixed and embedded tissue, the nucleic acids are released from cells by permeabilizing the tissue.

[0140] The method further comprises performing a reverse transcription reaction.

[0141] The method further comprises amplifying the cDNA molecules obtained by reverse transcription.

[0142] The method further comprises library construction / sequencing of the amplified nucleic acids.

[0143] In one aspect of the present application, the method comprises a step of cutting and releasing the probes on the chip into contact with cells in the tissue. When the tissue is a fixed and embedded tissue, the tissue is soaked.

[0144] The method further comprises dissociating the cells of the tissue.

[0145] The method further comprises extracting and / or enriching the nuclei of the cells of the tissue.

[0146] The method further comprises single-cell library construction / sequencing of the cells or nuclei of the tissue.

[0147] In the present application, each array point of the array of the chip has a barcoded nucleic acid probe and the cell probe. In one aspect of the present application, the nucleic acid probe and the cell probe of each array point of the array are used to analyze the same tissue sample, and the biological information of the cells obtained by the nucleic acid probe and the cell probe are associated using the barcoding information of the nucleic acid probe and the cell probe.

[0148] Example 2 Preparation of the chip

[0149] FIG. 1 is a flowchart of an exemplary embodiment of the method for preparing a biological chip provided by the present application.

[0150] In this embodiment, a glass slide is used as the chip substrate, and the surface of the chip is modified with active groups such as amino, aldehyde, epoxy, isothiocyanate, thiol, silane, etc. by surface chemical reaction.

[0151] In this embodiment, a commercially available optical epoxy-modified glass slide (Slide E) is used as the chip substrate. Slide E) is used as the chip substrate.

[0152] A universal chip surface linker nucleic acid with the following sequence is synthesized:

[0153] 5' amino-CTACACGACGCTCTTCCGATC-3'

[0154] A first set of 70 barcoded nucleic acids one for probes for detecting nucleic acids with the following sequence, 5' phosphorylated:

[0155] 5' phosphorylated-CCTGAGCAACAAC 12345678 GAGTGATTGC-3'

[0156] A first set of 70 barcoded nucleic acids two for probes for cell detection with the following sequence, 5' phosphorylated, U bases on the sequence can be cleaved by USER enzyme to form nucleic acid molecules with 5' P structure:

[0157] 5' phosphorylated-UUU GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNNNN CCAATGCGAC-3'

[0158] wherein "12345678" represents a barcode fragment with 8 nucleotides, wherein the sequence of the 8 nucleotides is known (specified). The sequences of the barcode fragments (referred to as first barcode) of the 70 first set of barcoded nucleic acids are different from each other, and the sequence of the first barcode of each first set of barcoded nucleic acids is known (specified). In this embodiment, the fluorescence modification of the barcode fragment and the fluorescence signal generated by detection are used to observe or quality control each step of adding the barcode fragment in the chip synthesis. In other embodiments, the barcode fragment can not be fluorescently modified.

[0159] A second set of 70 barcoded nucleic acids one for probes for detecting nucleic acids with the following sequence:

[0160] 5' phosphorylated-TGTCCATGTG 87654321 NNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3'

[0161] A second set of 70 barcoded nucleic acids two for probes for cell detection with the following sequence, 5' phosphorylated:

[0162] 5' phosphorylated-CAGATGCTCC 87654321 GCTTTAAGGCCGGTCCTAGCAA-3'

[0163] wherein "87654321" represents a barcode fragment having 8 nucleotides, wherein the sequence of the 8 nucleotides is known (specified), the sequences of the barcode fragments (referred to as second barcodes) of the 70 second set of barcode nucleic acids are each different, and the sequences of the second barcodes of each of the 70 second set of barcode nucleic acids are known (specified).

[0164] Synthesized 1 first linker nucleic acid for nucleic acid detection having the following sequence:

[0165] 5'-GTTGCTCAGGAGATCGGAAG-3'

[0166] Synthesized 1 second linker nucleic acid for nucleic acid detection having the following sequence:

[0167] 5'-CACATGGACAGCAATCACTC-3'

[0168] Synthesized 1 first linker nucleic acid for cell detection having the following sequence:

[0169] 5'-CCAGTCACAAAAGATCGGAAG-3'

[0170] Synthesized 1 second linker nucleic acid for cell detection having the following sequence:

[0171] 5'-GGAGCATCTGGTCGCATTGG-3'

[0172] The cell culture chamber was adhered to a glass slide, and the chamber was pressed against the glass slide using a frame to improve the seal. A pipette was used to add 10-20 uM of the universal chip surface linker nucleic acid (dissolved in 300 mM sodium phosphate buffer pH 8.5) into the chamber, and after the chamber floor was covered, the glass slide was placed in a thermomixer, shaken at 40 °C, 800 rpm for 3 hours to mix the reaction. After the reaction was completed, the modified glass slide was sequentially washed with 0.1% Triton X-100, 1 mM HC1, 100 mM KC1, and then blocked using 0.1 M Tris pH 9.0, 50 mM ethanolamine, 0.1% SDS at 50 °C. After blocking, the substrate was rinsed with deionized water for 1 minute, and then the substrate was blown dry with nitrogen.

[0173] A device comprising a plurality of parallel microfluidic channels as shown in FIG. 2 was prepared by soft lithography process from polydimethylsiloxane (PDMS), with the bottom of the microfluidic channels open.

[0174] The device of microfluidic channels includes about 50-500 parallel microfluidic channels. The width of each microfluidic channel is about 2-200 μm, preferably about 5-50 μm, and most preferably about 5-25 μm, such as about 5 μm, 10 μm or 50 μm. The spacing between each adjacent microfluidic channel is about 5-400 μm, preferably about 10-100 μm, and most preferably about 10-50 μm, such as about 20 μm, 50 μm or 100 μm.

[0175] The PDMS microfluidic channel device is attached to a glass slide to seal the channels. A clamping tool is used to press the top of the channel and the base glass slide to improve the sealing. One end of the microfluidic channel is the solution inlet, and the other end is connected to a vacuum suction device through an interface.

[0176] After the microfluidic channel device is attached to the glass slide, buffer solution is introduced into the channel to remove the gas in the channel. Then 10-20 uM of a mixture of the first set of barcode nucleic acid one and the first set of barcode nucleic acid two mixed at a ratio of 7:3 is added to the channel: one first barcode nucleic acid (each first barcode nucleic acid in each channel has a different barcode sequence from the first barcode nucleic acid in other channels) and a first linker nucleic acid and T4 ligase are introduced into each channel. After filling the channel, the reaction is allowed to stand at 37°C for 30 minutes. After the reaction is completed, 1x PBS buffer and ultrapure water are used to clean the channel. Then the channel is removed, the substrate is rinsed with deionized water for 1 minute, and the substrate is dried with nitrogen.

[0177] Another PDMS microfluidic channel device is attached to the glass slide in a direction perpendicular to the channels of the first PDMS microfluidic channel device. After the buffer solution is introduced into the channel to remove the gas in the channel, 10-20 uM of a mixture of the second set of barcode nucleic acid one and the second set of barcode nucleic acid two mixed at a ratio of 7:3 is introduced into the channel: one second barcode nucleic acid (each second barcode nucleic acid in each channel has a different barcode sequence from the second barcode nucleic acid in other channels) and a second linker nucleic acid and T4 ligase are introduced into each channel. After filling the channel, the reaction is allowed to stand at 37°C for 30 minutes.

[0178] After the ligation reaction is completed, 1x PBS buffer and ultrapure water are used to clean the channel. Then the channel is removed, the substrate is rinsed with deionized water for 1 minute, and the substrate is dried with nitrogen. The ligation reaction of the second barcode nucleic acid and the first set of barcode nucleic acid at the intersection of the channels is completed, forming a barcode array, thereby completing the preparation of the chip.

[0179] In one experiment of this example, to detect the efficiency of probe formation on the chip, the underlined T base in the second set of bar code nucleic acids one of the probe for detecting nucleic acid was modified with Cy3, and the underlined T base in the second set of bar code nucleic acids two of the probe for detecting cell was modified with FITC. The finished chip was evaluated according to the observation of fluorescence signal to determine whether the prepared chip formed probe, and the intensity (density) and uniformity thereof. Figure 4 shows the observation chart of fluorescence signal of probe on the chip (locally). As shown in the figure, on the same array point of the chip, both the fluorescence signal of Cy3 carried by the first set of bar code nucleic acids one (left chart) and the fluorescence signal of modified FITC carried by the first set of bar code nucleic acids two (right chart) were included.

[0180] The prepared chip was vacuum packaged and stored at room temperature or 4°C in a refrigerator in the dark.

[0181] Example 3 Preparation and staining of tissue sample

[0182] (I) OCT embedding of tissue

[0183] Fresh mouse brain tissue sample was taken, and the surface of the tissue was quickly rinsed with pre-cooled PBS solution or normal saline to remove residual liquid, and then the liquid was absorbed with a clean absorbent paper. The tissue was placed in an embedding tank, and OCT embedding agent was added to completely cover the tissue. It was confirmed that there was no air bubble around the tissue, and the embedding tank was placed on dry ice until the OCT was completely frozen.

[0184] (II) Frozen sectioning

[0185] The temperature of the frozen sectioning machine was set to a tank temperature of -20°C and a sample head temperature of -10°C. The frozen tissue and the substrate were placed in the tank of the frozen sectioning machine at -20°C for more than 30 minutes before sectioning, and then the frozen sectioning was performed in the tank of the frozen sectioning machine at a thickness of 20 μm.

[0186] Two adjacent sections were taken, one of which was subjected to tissue fixation and HE staining. The other section was used for analysis on the bar code array modified substrate prepared in Example 2.

[0187] (III) Tissue fixation and HE staining

[0188] One of the two adjacent sections was attached to the substrate, and then placed in an incubator at 37°C for 1 minute. The attached tissue section was fixed with 4% paraformaldehyde at room temperature for 10 minutes. After the fixation was completed, the substrate was taken out, the back was wiped dry, 500 μl of isopropanol was added to the tissue section, and incubated at room temperature for 1 minute. After 1 minute, the isopropanol was removed, and then air-dried at room temperature for 5-10 minutes.

[0189] Add 1 ml of hematoxylin, evenly cover the tissue sections on the substrate, incubate at room temperature for 7 minutes. Remove the hematoxylin reagent, immerse the substrate into RNase-free Water for washing, and dry. Add 1 ml of bluing solution, incubate at room temperature for 2 minutes. Remove the bluing solution, immerse the substrate into RNase-free Water for washing, and dry the back of the substrate. Add 1 ml of eosin mixture, incubate at room temperature for 1 minute.

[0190] Remove the eosin, immerse the substrate into RNase-free Water for washing, and dry until the tissue is opaque. After incubating the slide at 37 °C for 5 minutes, perform brightfield imaging. The results are shown in FIG. 5.

[0191] Example 4 Reverse transcription reaction of tissue sample sections by the chip

[0192] Attach another tissue section in the two adjacent sections to the substrate with probe array prepared in Example 2, and then incubate at 37 °C for 1 minute.

[0193] Assemble the clamp chamber to the chip with the tissue, and make sure that the tissue is inside the corresponding chamber. Add 70 μl of reverse transcription mixture to the washed chamber. The reverse transcription mixture includes: lx first strand buffer, 5 mM DTT, 500 μM dNTP, 0.19 μg / μl BSA, 1% DMSO, 2.5 μM Template Switch Oligo, 20 U / μl Superscript III, and 2 U / μl RNase inhibitor.

[0194] The sequence of the Template Switch Oligo is as follows:

[0195] 5’ Biotin-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’

[0196] The 1st, 2nd, and 3rd bases from the end in the Template Switch Oligo are modified with riboguanine nucleosides.

[0197] After sealing the chamber with adhesive tape, place it on a temperature-controlled plate, and regulate it to about 50 °C for reverse transcription, for 16 hours.

[0198] After the reverse transcription is completed, remove the reverse transcription mixture in the chamber, and then add 100 ul of RNase-free Water for washing once.

[0199] After washing, 70 μΐ of USER enzyme reaction solution was added to the chamber, wherein the reaction solution comprises: 1 x Reaction Buffer, 3-5 U of USER enzyme, and 0.5 μΐ of ssDNA dye. After the chamber was sealed with adhesive tape, it was placed on a temperature control plate and regulated to 37°C for 30 min to perform the USER enzyme cleavage reaction. During the reaction, the cell probe was cleaved and released to the tissue section by the USER enzyme.

[0200] After the USER enzyme cleavage was completed, the reaction solution in the chamber was removed, and then 100 μΐ of RNase-free Water was used to wash once.

[0201] After washing, 200 μΐ of tissue nucleus lysis solution was added to the chamber, wherein the nucleus lysis solution comprises: 0.1% Triton X-100, 5 mM MgCl2, 25 mM KCl, 10 mM Tris-HCl, pH 8.0. The chamber was pipetted 3-5 times, and then the tissue section was placed on ice for lysis for 30 min. After the lysis was completed, the chamber was filtered with a 30 μm cell strainer, and the filtrate was collected and washed once. Then, the cells were subjected to density gradient centrifugation, and the cell nuclei were collected. After washing, the cell nuclei were examined under a microscope. As shown in FIG. 6 (stained with trypan blue), the obtained intact cell nuclei were full and round, and the edges of the nuclear membrane were smooth and flat.

[0202] After the tissue was lysed and the cell nuclei were collected, 70 μΐ of 0.08 M KOH was added to the chamber, and the chamber was incubated at room temperature for 5 min, and then 100 μΐ of RNase-free Water was used to wash once.

[0203] After washing, the chamber was added with a cDNA second strand synthesis reaction solution. The second strand synthesis reaction solution comprises: 1 x first strand buffer, 10 U of Klenow Exo - , and 2.5 μΜ of Second Strand Primer. After the chamber was sealed with adhesive tape, it was placed on a temperature control plate and regulated to about 37°C to perform the cDNA second strand synthesis, and the reaction was performed for 1 h.

[0204] The sequence of the Second Strand Primer is as follows:

[0205] 5'-AAGCAGTGGTATCAACGCAGAGTACAT-3'

[0206] After the reaction is completed, the double-strand synthesis reaction solution in the chamber is aspirated and discarded, and then 100 ul of RNase-free Water is added for cleaning once. Then 35 ul of 0.08M KOH is added to the chamber, and incubated at room temperature for 10 minutes. Prepare several new 1.5ml centrifuge tubes, and add 10 ul of Tris (1M, pH 7.0) to each. Transfer 35 ul of the sample in the chamber to the corresponding centrifuge tube containing Tris, and mix well, which completes the preparation of the double strand of cDNA.

[0207] cDNA amplification

[0208] Take a new 1.5ml centrifuge tube and place it on ice to prepare the PCR amplification reaction solution. The PCR reaction solution includes: 1x Kapa HiFi Hotstart ReadyMix, 0.8ul cDNA Forward Primer, 0.8ul cDNA Reverse Primer, 35ul cDNA template, total volume 100ul.

[0209] The sequence of the cDNA Forward Primer is:

[0210] 5'-CTACACGACGCTCTTCCGATC-3'

[0211] The sequence of the cDNA Reverse Primer is:

[0212] 5'-AAGCAGTGGTATCAACGCAGAG-3'

[0213] After amplification, the amplification product is purified using 0.6x AMpure XP Beads. The purified product is used for library construction and sequencing.

[0214] Example 5 Spatial transcriptome library construction and sequencing

[0215] Fragmentation, end repair, and A addition

[0216] Take a new PCR tube and place it on ice to prepare the fragmentation reaction solution. The fragmentation reaction solution includes: 5ul FEA Buffer V2, 10ul purified cDNA of Example 4, 25ul ddH2O, 10ul FEA Enzyme Mix V2, total volume 50ul. Place the PCR tube in a PCR instrument and run the following program:

[0217] In this way, the DNA is fragmented, the ends of the fragmented DNA are repaired, and the 5' end is phosphorylated and a dA tail is added to the 3' end.

[0218] Adapter ligation

[0219] Take a new PCR tube and place it on ice. Prepare the adapter ligation reaction solution. The adapter ligation reaction solution includes: 25 μl Rapid Ligation Buffer V2, 50 μl of the purified fragmented DNA from the previous step, 15 μl ddH2O, 5 μl Rapid DNA Ligase V2, 5 μl adapter (10 pM), and the total volume is 100 μl. Place the PCR tube in the PCR instrument and run the following program: Hot lid 105℃ On 20℃ 15 min 4℃ Hold

[0220] The adapter sequence is as follows:

[0221] 5' phosphorylated-GATCGGAAGAGCACACGTCTGAACTCCAGTCA*C-3'

[0222] 5'-GCTCTTCCGATC*T-3'

[0223] The last base in the adapter sequence is modified by thiol modification.

[0224] After the ligation reaction is completed, use 0.6*XP SPRIselect Beads to purify the ligation product.

[0225] Library amplification

[0226] Take a new PCR tube and place it on ice. Prepare the library amplification reaction solution. The library amplification reaction solution includes: 25 μl VAHTS HiFi Amplification Mix, 20 μl of the purified DNA with adapter ligation from the previous step, 5 μl Index PCR Primer Mix (10 pM each), and the total volume is 50 μl. Mix well using a pipette or vortex, and then centrifuge briefly to collect the reaction solution at the bottom of the tube. Place the PCR tube in the PCR instrument for amplification.

[0227] The Index PCR Primer sequence is as follows:

[0228] i5 index primer: 5'-AATGATACGGCGACCACCGAGATCTACAC-

i5 index

[0229] i7 index primer:

[0230] 5'-CAAGCAGAAGACGGCATACGAGAT-

i7 index

[0231] After the amplification reaction, the amplification product was purified using 0.9x AMpure XP Beads.

[0232] Library quality control

[0233] The constructed library was detected for concentration and length distribution using Qubit and Agilent Bioanalyzer High Sensitivity chip, respectively. As shown in Figure 6, the library concentration detected by Qubit was not less than 20 ng / μl. Length distribution detection: take 1 μl of library sample, according to the instrument and kit instructions, perform fragment distribution detection, and the measured library fragments should be distributed between 200-600 bp.

[0234] Sequencing

[0235] The library was sequenced using illumina NovaSeq 6000 for PE150.

[0236] Data processing and analysis

[0237] a) Extract UMI and barcodes in Read1 using data processing software such as umitools (version: 1.1.2).

[0238] b) Align read2 to mouse reference genome Mouse reference, mm10 (GENCODE vM23 / Ensembl 98) using data processing software such as STAR (version: 2.5.3a), and count the reads aligned to the genome using featureCounts (Version 2.0.3).

[0239] c) Generate spatial barcode-gene expression matrix using data processing software such as umitools (version: 1.1.2).

[0240] d) Convert barcode-gene expression matrix to visual barcode space distribution map (Figure 7) using Python (version: 3.10.8) program.

[0241] e) Compare barcode space distribution map with HE picture using Adobe illustrator, only keep barcode points under tissue, get barcode-HE map corresponding relationship table.

[0242] f) Using Seurat (version: 4.3.0) software, the barcode-gene expression matrix, barcode-HE graph correspondence table, and HE graph were processed to output gene heat map and numerical distribution graph (Figure 8), UMAP clustering graph (Figure 9).

[0243] Single cell nucleus library construction and sequencing

[0244] The nuclei collected and washed in Example 4 were subjected to single cell library construction and sequencing. Using 10xgenomics Chromium Single Cell 3' Reagent Kits v3 and Chromium Single Cell 3' Feature Barcode Library Kit, the mRNA and the above-mentioned labeled cell probes in the nuclei were respectively subjected to library construction and sequencing. The mRNA expression matrix of each nucleus (single cell nucleus mRNA library) and the corresponding spatial coordinate matrix (cell probe library) were obtained.

[0245] Sequencing

[0246] The libraries were subjected to PE150 sequencing using illumina NovaSeq 6000. The gene library and the position library were respectively sequenced.

[0247] Data processing and analysis

[0248] a) Using Python (version: 3.10.8) to write programs for data processing of the cell probe library obtained by sequencing, the single cell barcode-space barcode matrix was extracted.

[0249] Figure 10 is an exemplary single cell barcode-space cell barcode correspondence matrix, wherein the first column is the single cell barcode, the second column is the space barcode carried by the single cell from the collected nuclei, the third column is the corresponding space position row number, and the fourth column is the corresponding space position column number.

[0250] b) Using the cellranger software of 10x genomics company to process the single cell nucleus mRNA library obtained by sequencing, the single cell barcode-gene expression matrix was extracted.

[0251] c) Using Seurat software to jointly analyze the single cell barcode-space barcode matrix, the single cell barcode-gene expression matrix, and the visualized space barcode-gene expression matrix.

[0252] The spatial barcode-gene expression matrix contains continuous tissue transcriptome information, but cannot reach the single cell level due to slice tissue morphology and spatial resolution. The single cell barcode-gene expression matrix contains discrete single cell transcriptome information, but the obtained transcriptome data is generally discontinuous in the tissue, and the spatial position of the single cell cannot be confirmed. The mRNA capture barcode and the spatial single cell marker barcode are one-to-one corresponding, and the two sequences are inconsistent due to the difference between the captured and labeled objects, but the corresponding table has been matched one-to-one during custom primer and array production, and can be considered as two forms of spatial markers. The method and chip provided by the application can combine the low-resolution spatial transcriptome data and the discrete, position-unmarked single cell transcriptome data through the single cell barcode-spatial barcode matrix, can use the single cell transcriptome data of the same slice to accurately annotate the spatial transcriptome data, and the single cell transcriptome data also contains spatial position information. Through the single cell transcriptome data with spatial position information and the spatial transcriptome data, the cell interaction or tissue microenvironment can be more accurately described and explained, and the bias introduced by using data of different tissue samples is reduced.

[0253] The above merely describes preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A chip for analyzing information of a biological sample, wherein a surface of the chip has probes forming an array, the array of probes comprising orthogonal rows and columns, each spot of the array having probes each with a different barcode sequence, wherein the probes comprise: (a) nucleic acid probes that recognize and bind to target nucleic acids in the biological sample; and (b) cellular probes that recognize and bind to target substances of cells in the biological sample.

2. The chip of claim 1, wherein the cellular probes recognize and bind to target substances of cell nuclei.

3. The chip of claim 1 or 2, wherein each spot of the array has both the nucleic acid probes and the cellular probes.

4. The chip of any one of claims 1-3, wherein the target nucleic acids are DNA or RNA, preferably mRNA.

5. The chip of any one of claims 1-3, wherein the target substances of cells are cellular tissues, peptides, glycoproteins, lipoproteins, lipid molecules, DNA, RNA, PNA, nucleotides, or polysaccharides.

6. The chip of any one of claims 1-3, wherein the barcode sequence of the probes of each spot of the array comprises a first barcode and a second barcode.

7. The chip of any one of claims 1-3, wherein the chip has a chip surface linker nucleic acid across the surface of the chip.

8. The chip of any one of claims 1-3, wherein the sequence of each nucleic acid probe of the array of probes comprises, from 5' end to 3' end, a first barcode, a second barcode, a capture segment for recognizing and binding to target nucleic acids in the biological sample.

9. The chip of any one of claims 1-3, wherein the sequence of each cellular probe of the array of probes comprises, from 5' end to 3' end, the first barcode, a second barcode, a ligand molecule for recognizing and binding to target substances of cells in the biological sample, wherein the target substance and the ligand are either non-specific binders or specific binders to each other, for example, wherein the target substance and the ligand are antibody / antigen, antibody / hapten, enzyme / substrate, enzyme / inhibitor, enzyme / cofactor, binding protein / substrate, carrier protein / substrate, lectin / carbohydrate, receptor / hormone, receptor / effector, or repressor / inducer, lipid molecule / lipid molecule binding molecule. preferably, wherein the sequence of each cellular probe of the array of probes further comprises a cleavable linker at the 5' end, wherein the cleavable linker is, for example, a linker selected from the group consisting of: an enzymatic cleavable linker; a nucleophile / base sensitive linker; a reduction sensitive linker; a photo-cleavable linker; an electrophile / acid sensitive linker; a metal-assisted cleavage sensitive linker; an oxidation sensitive linker; and a combination of two or more of the foregoing.

10. The chip of any one of claims 1-3, wherein the ratio of the nucleic acid probes to the cellular probes in each spot of the array is about 5: 1 to 1:5, or about 3: 1 to 1:3, or about 1:

1. ​ 11. The method of claim 1-10, wherein the chip with array is used to analyze spatial multi-omics information of a biological tissue sample, the method comprising contacting the probe array of the chip with a tissue sample, the nucleic acid probes on the array recognizing and binding to nucleic acids of cells in the tissue, and the cell probes on the array recognizing and binding to target substances of cells in the tissue.

12. The method of claim 11, further comprising the step of releasing nucleic acids from cells in the tissue to contact the probes on the chip.

13. The method of claim 11, further comprising the step of performing reverse transcription reaction, optionally, further comprising the step of amplifying the cDNA molecules from reverse transcription. more preferably, further comprising the step of library construction / sequencing of the amplified nucleic acids.

14. The method of claim 11, further comprising the step of detaching the cell probes on the chip from the chip surface (e.g., cleaving and releasing the probes on the chip) into the tissue to contact the cells, preferably, further comprising the step of allowing the probes to pass through the cell membrane to contact the cell nucleus.

15. The method of claim 14, further comprising the step of single cell library construction / sequencing of the cells of the tissue.

16. The method of claim 14, further comprising the step of dissociating the cells of the tissue and obtaining cell nuclei.

17. The method of claim 14, wherein each spot of the array has the nucleic acid probes and the cell probes, preferably, each spot of the array has the nucleic acid probes and the cell probes for analyzing the same tissue sample, wherein the biological information of the cells obtained from the nucleic acid probes and the cell probes, respectively, are linked by the barcode information of the nucleic acid probes and the cell probes.

18. The method of preparing the chip for analyzing information of a biological sample of any one of claims 1-10, comprising the following steps: Step 1. Providing a chip; Step 2. Applying a first set of barcode nucleic acids to the chip surface through a plurality of microfluidic channels arranged in parallel to form a plurality of first barcode bands in a first direction, the first set of barcode nucleic acids comprising a plurality of first barcode nucleic acids with different barcode sequences, each first barcode band having a first barcode nucleic acid immobilized thereon, and the first barcode nucleic acid immobilized on each first barcode band having a different barcode sequence; Step 3. Applying a second set of barcode nucleic acids to the chip surface through a plurality of microfluidic channels arranged in parallel in a second direction to form a plurality of second barcode bands, the second set of barcode nucleic acids comprising a plurality of second barcode nucleic acids with different barcode sequences, each second barcode band having a second barcode nucleic acid immobilized thereon, and the second barcode nucleic acid immobilized on each second barcode band having a different barcode sequence; Step 4. joining the second barcode nucleic acids to the first barcode nucleic acids at the locations where the plurality of first barcode bands and the plurality of second barcode bands cross the chip surface under conditions such that the first barcode nucleic acids and the second barcode nucleic acids undergo a ligation reaction, forming probes, the locations of which constitute the spots of the array, each spot having a probe of one location-specific barcode sequence, Preferably, wherein in step 2 comprises: immobilizing the chip surface adaptor nucleic acids on the chip surface; applying the first set of barcode nucleic acids to the chip surface through a plurality of parallel microfluidic channels, forming a plurality of first barcode bands in a first direction on the chip surface under conditions such that the chip surface adaptor nucleic acids and the first barcode nucleic acids undergo a ligation reaction.

19. The method of claim 18, wherein the second set of barcode nucleic acids are delivered and immobilized on the chip surface using a microfluidic device having a plurality of parallel microfluidic channels, wherein the side of the microfluidic channels that contacts the chip surface is permeable to solutions or nucleic acids in solution.

Images