Control of a crispr CAS reaction

Abstract

The invention pertains to a method for controlling a reaction of a CRISPR Cas effector protein with a target, an associated CRISPR Cas effector protein and associated uses for detection, optionally detection of a nucleic acid in a biological sample or in a sample derived from a biological material.

Description

[0001] CONTROL OF A CRISPR CAS REACTION

[0002] TECHNICAL FIELD OF THE INVENTION

[0003] The current invention pertains to a method for controlling a reaction of a CRISPR Cas ef fector protein with a target , a corresponding CRISPR Cas ef fector protein and associated uses for detection and / or optionally for modi fication of a nucleic acid .

[0004] DESCRIPTION OF THE RELATED ART

[0005] CRISPR is a powerful diagnostic tool with high speci ficity, and rapid adaptability to di f ferent targets . However, the enzyme kinetics that drive CRISPR-based diagnostics are slow, necessitating lengthy diagnostic tests and typically a nucleic acid ampli fication step to increase the speed and decrease the detection limit of the assay . An implementation of additional ampli fication steps increases the cost of the reagents for the assay, the time and complexity of the assay, installs potential error sources , and increases the complexity of microfluidic chips and associated devices used to run detection assays based on the CRISPR technology . These limitations hamper the use of the CRISPR technology for af fordable and rapid molecular diagnostics .

[0006] Current techniques to accelerate CRISPR Cas reactions include the use of two guide RNAs to target one piece of activating DNA in conj unction with the use of algorithms to investigate the resulting increase in slope . Another technique includes nucleic acid ampli fication methods to raise the concentration of the activating DNA. However, when CRISPR Cas reactions are run simultaneously to the nucleic acid ampli fication reaction, such as in the CRISPR Cas l2 / RPA one-pot detection assay, nucleic acid ampli fication often fails because the CRISPR Cas protein destroys the nucleic acid target while it is being ampli fied . This issue can be overcome by retarding the CRISPR Cas reaction with either light activated guide RNAs or viscous layers that increase the di f fusion times of the amplicon derived from the target ampli fication techniques to the CRISPR Cas reaction .

[0007] SUMMARY OF THE INVENTION

[0008] It is the obj ective underlying the present invention to provide an ef ficient , optionally an improved, simple and / or fast method for controlling a reaction based on CRISPR technology, the reaction in particular being part of a CRISPR Cas based detection assay, optionally an improved, simple and / or fast method for modi fying nucleic acids .

[0009] This task is solved by a method with the features of claim 1 . Further embodiments of the method, CRISPR Cas ef fector protein as well as a use are defined by the features of further claims .

[0010] In a first aspect , the present invention is directed to a method for controlling, in particular delaying, a reaction of a CRISPR Cas ef fector protein with a target comprising the steps :

[0011] ( i ) providing a Cas complex comprising a guide nucleic acid, optionally guide RNA, and a CRISPR Cas ef fector protein;

[0012] ( ii ) providing a target suitable for activating the Cas complex ;

[0013] ( iii ) combining the Cas complex and the target under conditions suitable for activating the Cas complex ; wherein the CRISPR Cas ef fector protein is covalently bound to an oligomer or polymer, optionally via a sul fhydryl group, optionally sul fhydryl group of cysteine , optionally via a carboxylate group, optionally a carboxylate group of an aspartic acid or glutamic acid, optionally via a hydroxyl group, optionally a hydroxyl group of a tyrosine , a serine or a threonine , optionally via an imidazole group, optionally an imidazole group of a histidine , optionally via a thioether group, optionally a thioether group of a methionine, optionally via an amine group, optionally an amine group of a lysine, arginine, histidine or tryptophan, optionally via an azido group, an alkyne group, an alkene group, a nitrile group, an epoxide group or a ketone group, optionally an azido group, an alkyne group, an alkene group, a nitrile group, an epoxide group or a ketone group of a non-canonical amino acid, the oligomer or polymer comprises 5 to 2000 or 1000, optionally 10 to 500 or 25 to 400 monomers, and the oligomer or polymer has a positive or negative net charge and a fraction of charged monomers in the oligomer or polymer is from 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% to 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% under physiological conditions and / or at a pH of 7.0 to 9.5, optionally wherein a fraction of positively charged monomers is from 2% to 20% or 2% to 70% and the oligomer or polymer has a positive net charge, or a fraction of negatively charged monomers is from 5% to 100% or 20% to 100% and the oligomer or polymer has a negative net charge.

[0014] As used herein, the oligomer or polymer has a positive or negative net charge and a fraction of charged monomers in the oligomer or polymer is F = [SUM (net charged monomer] / [SU (all monomers) ] . In an example, the oligomer or polymer has a positive net charge and the fraction of positively charged monomers is Fp = [SUM (net positively charged monomer] / [SUM (all monomers) ] . In an example, the oligomer or polymer has a negative net charge and the fraction of negatively charged monomers is Fn = [SUM (net negatively charged monomer] / [SUM (all monomers) ] . The charge of the monomers refers to the net charge of the monomers.

[0015] In an exemplary embodiment, the fraction of charged monomers refers to those monomers contributing to the net charge of the oligomer or polymer. In other words, there may be more charged monomers than the fraction indicates, which charged monomers are "cancelled out" by monomers of opposing charges. In other words, if there are, e.g., 3 negatively charged monomers and 2 positively charged monomers, then there are 2 monomers with opposing charges which cancel each other out and only one negatively charged monomer contributes to the net charge of the oligomer or polymer. Hence, in this example, the fraction of charged monomers contributing to the net charge is 1 / 5, i.e. 20% .

[0016] For example, the fraction of positively charged monomers can be the fraction of positively charged monomers contributing to the positive net charge of the oligomer or polymer, or the fraction of negatively charged monomers can be the fraction of negatively charged monomers contributing to the negative net charge of the oligomer or polymer. In an example, the monomers of the oligomer or polymer are either not charged, have a single positive charge or a single negative charge, or have a single positive and negative charge (zwitterion) .

[0017] For example, the oligomer or polymer disclosed herein can be a random oligomer or polymer (i.e. an oligomer or polymer where all monomers are polymerized at the same time and their order in the oligomer / polymer structure is not controlled) , or the oligomer or polymer disclosed herein can be a block cooligomer or block copolymer (i.e. an oligomer or polymer where monomers are polymerized at separate times, i.e. in separate synthesis phases or reactions, and the monomer order in the polymer structure is partially or totally controlled) . For block cooligomers or block copolymers the fraction of negatively charged monomers can, e.g., be lower than for random oligomers or polymers, because the charges can be more concentrated within the polymer structure. For example, for the oligomer or polymer disclosed being a block copolymer having a negative net charge, the fraction of negatively charged monomers can be from 5% to 100% , and the charged monomers are arranged in blocks in the oligomer or polymer ; or for the oligomer or polymer disclosed herein being made by random monomer polymeri zation, the oligomer or polymer can have a negative net charge , the fraction of negatively charged monomers is from 20% to 100% , and the charged monomers are randomly distributed within the oligomer or polymer .

[0018] In an example , a block copolymer can be made of 90 neutral monomers in a first block and 10 negatively charged monomers in a second block . The polymer has a fraction of negatively charged monomers of 10% . In an example , block copolymers with a fraction of negatively charged monomers of 5% can have at least 100 monomers . In an example , block copolymers with a fraction of negatively charged monomers of 10% have at least 50 monomers .

[0019] In an example which can be combined with all aspects and embodiments disclosed herein, an oligomer or polymer with a negative net charge only comprises negatively charged monomers and optionally monomers with a net zero charge ; and an oligomer or polymer with a positive net charge only comprises positively charged monomers and optionally monomers with a net zero charge .

[0020] All definitions , examples and explanations provided herein are valid for all aspects and embodiments of the present invention i f not speci fically indicated otherwise or in contradiction .

[0021] Controlling a reaction of a CRISPR Cas ef fector protein with a target in particular means controlling the onset , progress , speed, ending point and / or result of a reaction between a CRISPR Cas ef fector protein and a suitable target . In particular, controlling a reaction means controlling the onset (point of time ) of the reaction and / or controlling a modi fication of the target , optionally a nucleic acid .

[0022] As used herein, any reference to influencing a reaction speed, e . g . delaying a reaction of a CRISPR Cas ef fector protein with a target , in particular delaying an onset of this reaction, further in particular delaying the kinetics of any aspect of the reaction such as cis cleavage , means that the reaction of the CRISPR Cas ef fector protein covalently bound to an oligomer or polymer as defined herein is slower or starts at a later time point compared to the same CRISPR Cas ef fector protein without the oligomer or polymer as defined herein . In other words , the comparison is made with the same reagents ( in particular Cas complex ( i . e . CRISPR Cas ef fector protein type and guide nucleic acid ( guide RNA) and target ) and under the same conditions ( concentrations , further components present , temperature , solvent system, overall reaction time , etc . ) ) with the di f ference that the CRISPR Cas ef fector protein to which the comparison is made is not covalently bound to the oligomer or polymer but is the same CRISPR Cas ef fector protein apart from the absence of the oligomer or polymer .

[0023] A suitable assay for comparing the CRISPR Cas ef fector protein covalently bound to the oligomer or polymer to the same CRISPR Cas ef fector protein not covalently bound to the oligomer or polymer is provided in Example 6 below .

[0024] For Example , a delay or a delayed onset of a reaction or kinetics is considered a delay or delayed onset i f the reaction is slower by at least 10 % , or the onset is delayed by at least 20 s .

[0025] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the fraction of positively charged monomers is the fraction of positively charged monomers contributing to the positive net charge of the oligomer or polymer, the fraction of negatively charged monomers is the fraction of negatively charged monomers contributing to the negative net charge of the oligomer or polymer, optionally wherein the fraction of positively charged monomers is from 2 % to 40% or 2 % to 20% and the oligomer or polymer has a positive net charge , or wherein the fraction of negatively charged monomers is from 5% to 100% or 20% to 100% and the oligomer or polymer has a negative net charge .

[0026] The above embodiment can, e . g . , particularly apply to oligomers or polymers which comprise both, positively charged and negatively charged monomers . In an embodiment which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the fraction of positively charged monomers is the fraction of positively charged monomers contributing to the positive net charge of the oligomer or polymer, and / or the fraction of negatively charged monomers is the fraction of negatively charged monomers contributing to the negative net charge of the oligomer or polymer, optionally wherein the fraction of positively charged monomers is from 2 % to 40% or 2 % to 20% and the oligomer or polymer has a positive net charge , or wherein the fraction of negatively charged monomers is from 5% to 100% or 20% to 100% and the oligomer or polymer has a negative net charge , i f the oligomer or polymer comprises negatively and positively charged monomers .

[0027] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein controlling the reaction is delaying the onset of the reaction, optionally the onset of an association of the target with the Cas complex, optionally wherein controlling the reaction is changing the rate of an interaction between the CRISPR Cas ef fector protein and the target , optionally wherein controlling the reaction is a reduction of the kinetics of the cis cleavage of the CRISPR Cas effector protein. Suitable methods for determining the kinetics of cis cleavage are described in the context of Example 7 below.

[0028] The term "Cas complex" as used herein is also commonly known as "CRISPR-Cas complex" or "ribonucleoprotein (RNP) " and these terms are used interchangeably. The Cas complex for use in the present invention can be any Cas complex having activity within the context of the CRISPR Cas technology and comprising a guide nucleic acid (e.g. guide RNA) and a CRISPR Cas effector protein.

[0029] In particular, any native and / or engineered and / or non-naturally occurring Type II (e.g. Cas9) , Type VI (e.g. Casl3a, Casl3b, Casl3c, Casl3d, or Casl3e) , Type V (e.g. a Casl2 protein such as Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl4a, Casl4b, Casl4c, Casl4d, Casl4e, Casl4f, Casl4g, or Casl4h) , and / or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) - CRISPR associated (Cas) (CRISPR-Cas) effector proteins, including thermophilic CRISPR-Cas effector proteins, are considered suitable in the context of the invention.

[0030] Some further exemplary Cas effector proteins include:

[0031] - casl2a, for example LbCasl2a, AsCasl2a, and FnCasl2a (J. Chen et al., Science (2018) , 360, 6387, 436-439) .

[0032] - casl2b, for example AacCasl2b, AapCasl2b, and BrCasl2b (L.T. Nguyen et al., eBioMedicine (2022) , 77, 103926) .

[0033] - casl3, for example LbaCasl3a, PsmCasl3b, LbuCasl3a, and CCaCasl3b (J.S. Gootenberg et al., Science (2018) , 360, 6387, 439-444) .

[0034] - casl4, for example casl4al, casl4bl, and casl4ul (L.B. Harrington et al., Science (2018) , 362, 6416, 839-842) .

[0035] - cas7, for example Cmrl, Cmr4, and Cmr6 (J. A. Steens et al., Nature Communications (2021) , 21, 5033)

[0036] - caslO, for example Cmr2 (J. A. Steens et al., Nature Communications (2021) , 21, 5033) - cas5, for example Cmr3 (J. A. Steens et al., Nature Communications (2021) , 21, 5033)

[0037] - casll, for example Cmr5 (J. A. Steens et al., Nature Communications (2021) , 21, 5033) .

[0038] The CRISPR Cas effector protein of the present invention is covalently bound to an oligomer or polymer, which oligomer or polymer comprises 2 to 10000, optionally 5 to 1000 or 2000, optionally 10 to 500 or 25 to 400 monomers. Of course, the number of the oligomers or polymers which are bound to the CRISPR Cas effector protein is not in any way limited to 1 - also more than 1, such as 1 to 200, 1 to 50, 1 to 20, 1 to 5 oligomers and / or polymers can be covalently bound to the CRISPR Cas effector protein.

[0039] The covalent binding can be a direct covalent binding, meaning that the Cas protein is directly covalently bound to a binding moiety (BM) on the oligomer or polymer, or it can occur via a linker or a spacer, for example comprising the BM, e.g. on at least one end of the linker or spacer. In the latter case, the covalent binding occurs both between the CRISPR Cas effector protein and the binding moiety (BM) on the linker or spacer and between the linker or spacer and the oligomer or polymer.

[0040] For example, the functional group of the CRISPR Cas effector protein, with which the binding moiety (BM) reacts to form a covalent binding, can be a group that naturally occurs in the CRISPR Cas effector protein, or it can be a group artificially introduced in the CRISPR Cas effector protein, e.g. by known synthetic or expression means. For example, when the sulfhydryl group of a cysteine is used to covalently bind the polymer to the CRISPR Cas effector protein, the cysteine can be a cysteine present in the native Cas effector protein, or a cysteine added in replacement of another amino acid. The number of conjugation sites per CRISPR Cas effector protein can be controlled by adding or reducing amino acids for conjugation, for example by replacing an inert amino acid with a cysteine or vice versa. One or more amino acids for conj ugation can also be added recombinantly at the termini of the protein .

[0041] In an embodiment , and notwithstanding the type of the covalent binding, none of the primary amino groups of the CRISPR Cas ef fector protein are involved in the covalent bond to the polymer or the oligomer, meaning that the CRISPR Cas ef fector protein is covalently bound to an oligomer or a polymer by any CRISPR Cas ef fector protein group di f ferent from primary amino groups .

[0042] For example , the term "CRISPR Cas ef fector protein is covalently bound to an oligomer or polymer" in the context of the present invention means that the oligomer or polymer was synthetically or by bioengineering attached to a CRISPR Cas ef fector protein which itsel f can be a natural or previously bioengineered Cas ef fector protein .

[0043] For example , in the context of the present invention, the polymer and / or the oligomer is not present in any naturally occurring CRISPR Cas ef fector protein . Hence , a person skilled in the art can conveniently determine whether a given, eventually modi fied, Cas ef fector protein is a Cas ef fector protein according to the invention by analyzing its composition and comparing it with the composition of a naturally occurring Cas ef fector protein, for example by analyzing the amino acid sequence of the Cas ef fector protein and by comparing the amino acid sequence of the Cas ef fector protein with the amino acid sequence of a naturally occurring Cas ef fector protein, or by mass spectrometric analysis .

[0044] In an embodiment , which may be combined with any of the preaddressed embodiments or aspects , or embodiments or aspects to be mentioned, unless in contradiction, the polymer and / or the oligomer is composed of monomers being amino acids and of monomers not being amino acids , only of monomers being amino acids , or only of monomers not being amino acids . In one embodiment, in which the polymer and / or the oligomer is composed of monomers being amino acids, the oligomer or polymer is composed of more than 2 or more than 5 amino acids, optionally 20 to 1500, optionally 40 to 500, optionally 80 to 250 amino acids, in particular the same or different amino acids. Particularly preferred amino acid monomers for making up the oligomer or polymer are selected from the group consisting of: aspartic acid, glutamic acid, arginine, lysine, histidine, glycine, proline, cysteine, serine, threonine, asparagine, glutamine .

[0045] In particular, the oligomer or polymer composed of amino acidic monomers may also be recombinantly added to the naturally occurring CRISPR Cas effector protein, in particular by expressing a modified genomic sequence defining the Cas effector protein. For example, a comparison between the genomic sequence from which the CRISPR Cas effector protein arises and a genomic sequence defining a naturally occurring CRISPR Cas protein allows a person skilled in the art for recognizing if the CRISPR Cas effector protein is one according to the invention. According to the invention, the oligomer or polymer has a fraction of charged monomers as defined herein under physiological conditions or at a pH of 7.0 to 9.5 In one embodiment, the oligomer (s) and / or the polymer (s) themselves have at least one side chain, preferably more than one side chain, extending from the main chain or the backbone of the polymer / oligomer , which are the side chain (s) of the monomers or side chain (s) post-added to the backbone of the polymer / oligomer and to which we refer as a "polymer or oligomer side chain (s)". In this case, the positive or negative charge is preferably located in such polymer or oligomer side chain (s) , in particular under physiological conditions or at a pH of 7.0 to 9.5 in an aqueous solution. A guide nucleic acid as used herein can be, e.g. a guide RNA which is also commonly known as a "gRNA". The guide nucleic acid (e.g. gRNA) for use in the present invention can be any nucleic acid sequence (e.g. RNA sequence) that can function as a guide for any CRISPR Cas effector protein. The guide nucleic acid can moreover be made of one or more nucleic acid molecules and comprises both a region which binds to the CRISPR Cas effector protein and a guide sequence suitable for binding to a target, such as for example a nucleic acid, in particular a DNA or an RNA.

[0046] Exemplary nucleic acid sequences suitable for a guide nucleic acid include the following guide RNAs :

[0047] - UAAUUUCUACUAAGUGUAGAUugaaguagauauggcagcac (SEQ ID NO: 1) , UAAUUUCUACUAAGUGUAGAUacaauaugugcuucuacaca (SEQ ID NO: 2) for Casl2, specifically LbCasl2a (J. Chen et al., Science (2018) , 360, 6387, 436-439) .

[0048] - GAAGGUGGUUAGCUACAGGCUGACCAGUGCAGUUGUGUCAUGUGCUACGGUGACCUAACACG UCACUCAGUCACAACGGCUAUCUAUAUUUCCACUAACCAAAGUUAGUGGAAAUGUAGAUGGU UAGCACCGAAGAACGCUGAAGCGCUG (SEQ ID NO: 3) for Casl2, specifically BrCasl2b (L.T. Nguyen et al., eBioMedicine (2022) , 77, 103926) .

[0049] - GACCACCCCAAAAATGAAG GGGACTAAAACATGCTTCT GTCCAGTGAGCATGG (SEQ ID NO: 4) for Casl3, specifically LbuCasl3a

[0050] - TGACTCCCTAGAACCACGACAGTTTGCCTTGTTGTAGA AGCTTATCGTTTGGATAGGTATGACAAC (SEQ ID NO: 5) for Casl3, specifically PsmCasl3a

[0051] - GTTGATGAGAAGAGCCCAAGATAGAGGGCAATAACACT CCCTAGAACCACGACAGTTTGCCTT (SEQ ID NO: 6) for Casl3, specifically LbaCasl3a (J.S. Gootenberg et al., Science (2018) , 360, 6387, 439-444) .

[0052] - TTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGATTAGAACTTGAG TGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTC GAAACAAATTCATTTgaaaGAATGAAGGAATGCAACacttgacacttaatgctcaa ( SEQ ID NO: 7) for Casl4, specifically Casl4al (L.B. Harrington et al. , Science (2018) , 362, 6416, 839-842) .

[0053] - CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGA GUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCU CGAAACAAAUUCAUUUGGAAUGCAACGAAUGAAGGAAUGCAACUCAACUAAUGUAACU (SEQ ID NO: 8) for Casl4, specifically Casl4al (J. Hu et al. , Chemical Communications (2021) , 57, 10423-10426) .

[0054] - AUUGCGACCACACAAUCGAAGCGCAGUAAGGAUGGCUAGUGUAACU (SEQ ID NO: 9) for Crm#, such as Cas5, Cas7, CaslO, Casll (J. A. Steens et al. , Nature Communications (2021) , 21, 5033) .

[0055] A target as used herein is a molecular target suitable for activating the Cas complex and may be for example a nucleic acid molecule, such as an RNA or a DNA. With "activating the Cas complex" we mean inducing an activity of the Cas complex with respect to the target. Such an activity may be for example binding, cutting, degrading, activating, and / or repressing the target by the Cas complex.

[0056] After the Cas complex comprising a guide nucleic acid (e.g. guide RNA) and a CRISPR Cas effector protein has been provided in step (i) of the present method and a target suitable for activating the Cas complex has been provided in step (ii) , the Cas complex and the target are combined under conditions suitable for activating the Cas complex in step (iii) . The combination in step (iii) can be conducted either by adding the target to the Cas complex or by adding the Cas complex to the target, or by a simultaneous mixing of these compounds. In any case, the conditions under which the target and Cas complex are combined should allow the target to activate the Cas complex. With the wording "conditions" we mean the factors which may have an influence on a reaction, such as for example the temperature, the solvent, pH value, salt content, etc. , which can be routinely determined by a person skilled in the art. In one of the embodiments of the method, the Cas complex and the target are combined under physiological conditions, optionally at a temperature in the range of 1°C to 98°C optionally 1°C to 70°C, optionally 1°C to 40°C, optionally in an aqueous solution with a pH in the range of 7.0 to 9.5.

[0057] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, at least one of method steps (i) , (ii) and / or (iii) (and / or (iv) as described further below) , in particular method step (iii) , further in particular all method steps (i) to (iii) , or (i) to (iv) as described further below, is carried out together with a step of amplifying the target, in particular together with a step of a nucleic acid amplification for amplifying the target.

[0058] As used herein, the term "carried out together with" means that the method step(s) disclosed herein is (are) carried out in the same reaction vessel and at the same time as, i.e. concomitantly with, the step of amplifying the target. For example, the method can be a detection assay wherein one or more method steps of the instant method are carried out in the same reaction vessel and at the same time as an amplification step to amplify the target. For example, this assay can be a one-pot assay in which these steps are carried out.

[0059] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the target is amplified by loop-mediated isothermal amplification (LAMP) , recombinase polymerase amplification (RPA) , helicase-dependent amplification (HDA) , strand displacement amplification (SDA) , nucleic acid sequencebased amplification (NASBA) , transcription mediated amplification (TMA) , nicking enzyme amplification reaction (NEAR) , rolling circle amplification (RCA) , multiple displacement amplification (MDA) , ramification (RAM) , circular helicase-dependent amplification (cHDA) , single primer isothermal amplification (SPIA) , signal mediated amplification of RNA technology (SMART) , self-sustained sequence replication (3SR) , genome exponential amplification reaction (GEAR) , polymerase chain reaction (PCR) , strand invasion based amplification (SIBA) , or isothermal multiple displacement amplification (IMDA) .

[0060] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the oligomer or polymer : has a mass-average molecular weight of 500 Da to 500 kDa, optionally 400 Da to 250 kDa, optionally 800 Da to 100 kDa or 6 kDa to 110 kDa; and / or is a synthetic polymer or a natural polymer, optionally is selected from the group consisting of polyacrylates, polymethacrylates, polyacrylamides, polymethacrylamides, polyvinyls, polystyryls, polyallyls, polyepoxides, polyethers, polyesters, polypropylenes, polyurethanes, polyacrylics and their copolymers, polysaccharides, optionally Q-amylose, cellulose, starch, mannosylated polyethyleneimine, chitosan, dextran, dextran derivatives, Cm-amylose, alginate or hyaluronic acid, polypeptides, optionally polylysine, polyarginine, polyasparagine, poly ( glutamic acid) , and low complexity domains, optionally poly(DEPQSG) .

[0061] In some of the embodiments, the oligomer, or the polymer, in particular all of the oligomers and / or all of the polymers comprise only one type of monomer and are thus referred to as a homopolymer or a homooligomer. In some other embodiments, the oligomer, or the polymer, in particular all of the oligomers and / or all of the polymers comprise at least two different types of monomers and are thus referred to as a copolymer or a cooligomer. Of course, the oligomers and the polymers can be linear or branched as it does not essentially influence their fraction of charged monomers.

[0062] For example, the polymer disclosed herein is not hydrophobic, in particular to the extent that the polymer does not aggregate in a physiological solution. For example, the polymer may comprise hydrophobic monomers but optionally only to the extent that the polymer is overall not hydrophobic and does not aggregate in a physiological solution, even when charged monomers are removed.

[0063] The oligomer or polymer is further defined by its mass-average molecular weight. The mass-average molecular weight of a given polymer or oligomer can be determined by standard means, including, e.g. gel permeation chromatography and light scattering, e.g. at 20 °C.

[0064] According to one of the embodiments, the mass-average molecular weight ranges from 500 Da to 500 kDa (i.e. 500.000 Da) . For example, the mass-average molecular weight of the oligomer or the polymer can be in the range of 500 Da to 500 kDa, optionally 800 Da to 400 kDa, optionally 1 kDa to 200 kDa, optionally 500 Da to 200 kDa or 6 kDa to 110 kDa. Further suitable mass-average molecular weights are summarized in Table 1 below.

[0065] Tab. 1: Exemplary mass-average molecular weights of a polymer or an oligomer. Values are given in kDa. The oligomer or polymer for use in the present invention can be a synthetic oligomer or polymer or a natural oligomer or polymer. Under a synthetic molecule we understand a molecule which was synthesized in a non-natural environment, for example in a chemical laboratory or a chemical plant. Herein, a naturally occurring molecule is also considered natural if it was not extracted from any natural environment but was synthetically synthesized, e.g. by a chemist. Under a natural oligomer or polymer, we understand a molecule which was synthesized by nature, and obtained, for example, from an organic material such as cells, a plant tissue, animal tissue, soil, sea, etc. Examples of natural polymers are proteins, cellulose, chitin, polypeptides, or polysaccharides.

[0066] In one of the embodiments, which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the monomer or the oligomer, or the polymer comprise a side chain, which side chain is listed under point A, point B or point C, wherein:

[0067] Point A comprises the following side chains:

[0068]

[0069] Point C comprises the following side chains:

[0070] wherein m is a number in the range of 1 to 10 .

[0071] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the oligomer or polymer is block copolymer having a negative net charge , the fraction of negatively charged monomers is from 5% to 100% , and the charged monomers are arranged in blocks in the oligomer or polymer ; or the oligomer or polymer is made by random monomer polymeri zation, the oligomer or polymer has a negative net charge , the fraction of negatively charged monomers is from 20% to 100% , and the charged monomers are randomly distributed within the oligomer or polymer .

[0072] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the oligomer or polymer consists of positively charged monomers and optionally net neutral monomers ; consists of negatively charged monomers and optionally net neutral monomers ; or consists of negatively charged monomers , positively charged monomers and optionally net neutral monomers ; optionally wherein the fraction of positively charged monomers in the oligomer or polymer is from 2 % to 20% or from 2 % to 70% and the fraction of negatively charged monomers in the oligomer or polymer is from 5% to 100% ( in particular for block copolymers ) or from 20% to 100% ( in particular for random polymers ) . As noted above , the oligomer or polymer disclosed herein can be a random oligomer or polymer or a block cooligomer or block copolymer . For block cooligomers or block copolymers the fraction of negatively charged monomers can, e . g . , be lower than for random oligomers or polymers , because the charges can be more concentrated within the polymer structure . For example , for the oligomer or polymer disclosed being a block copolymer having a negative net charge , the fraction of negatively charged monomers can be from 5% to 100% , and the charged monomers are arranged in blocks in the oligomer or polymer ; or for the oligomer or polymer disclosed herein being made by random monomer polymeri zation, the oligomer or polymer can have a negative net charge , the fraction of negatively charged monomers is from 20% to 100% , and the charged monomers are randomly distributed within the oligomer or polymer .

[0073] The inventors have recogni zed that both a negative net charge and a positive net charge are suitable for controlling a reaction between the CRISPR Cas ef fector protein and the target . In one embodiment , an oligomer or polymer covalently bound to the CRISPR Cas ef fector protein and having a positive net charge with a fraction of charged monomers from 1 % or 2 % to 20% under physiological conditions or at a pH of 7.0 to 9.5 slows down the onset of said reaction.

[0074] In the event that the attached oligomers and / or polymers have net charges with different signs (i.e. some polymers / oligomers with a negative net charge and some polymers / oligomers with a positive net charge) , the overall net charge and its positive or negative sign influences the reaction.

[0075] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the CRISPR Cas effector protein is covalently bound to 1 to 50, optionally 1 to 30, 1 to 10 or 1 to 5 oligomers or polymers.

[0076] The oligomers or polymers can be bound at any point or Van der Waals surface area of the CRISPR Cas effector protein. In one embodiment only few, optionally 1 to 5 oligomers and / or polymers are covalently bound to the Cas effector protein. In an embodiment, the covalent binding is located in proximity of the guide nucleic acid (e.g. gRNA) binding domain of the Cas effector protein.

[0077] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the oligomer or polymer and / or the CRISPR Cas effector protein bound to the oligomer or polymer is soluble under physiological conditions or at a pH of 7.0 to 9.5 without liquid-liquid phase separation.

[0078] In one embodiment, the oligomer or polymer, in particular all oligomers or all polymers to be covalently bound and / or when bound to the CRISPR Cas effector protein (i.e. the CRISPR Cas effector protein according to the present invention) are soluble under physiological conditions and / or at a pH of 7.0 to 9.5 in an aqueous solution. With "soluble" we mean that there is essentially no liquid-liquid phase separation and the oligomer ( s ) or polymer ( s ) form a stable solution under physiological conditions and do not separate from this solution under the formation of another liquid phase or a solid precipitate . In particular, and in an embodiment which can be combined with all aspects and embodiments disclosed herein, the oligomer or polymer and / or the CRISPR Cas ef fector protein bound to the oligomer or polymer ( i . e . the CRISPR Cas ef fector protein according to the present invention and as defined herein) do not form any coacervates under physiological conditions and / or at a pH of 7 . 0 to 9 . 5 .

[0079] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the polymer or the oligomer comprises : at least one polymer or oligomer side chain having a net charge , optionally a negative or positive net charge , and / or at least one polymer or oligomer side chain having a net charge equal 0 .

[0080] As already mentioned above , in some embodiments the polymer and / or the oligomer comprise at least one side chain, referred to as the "polymer or oligomer side chain" , synonymous with the "polymer side chain" or "oligomer side chain" . Such polymer or oligomer side chains can be present in the polymer or the oligomer right from the beginning, i . e . before covalently binding the polymer or oligomer to the CRISPR Cas ef fector protein, for example as part of the monomers constituting the polymers , or they can be introduced after the polymer or oligomer has been covalently bound to the protein . Also , a polymer or oligomer having a side chain can be formed on the protein, for example by polymeri zing a monomer with the respective later "polymer or oligomer side chain" onto an oligomer already covalently bound to the CRISPR Cas effector protein, for example by a condensation reaction, or by recombinantly adding chains of amino acids to the protein.

[0081] According to one embodiment, at least one of the polymers and / or oligomers has at least one polymer or oligomer side chain having a net charge, optionally under physiological conditions or at a pH of 7.0 to 9.5. Suitable examples of such side chains are known to those skilled in the art and some exemplary structural motifs of such side chains were previously listed under the points A and B, the examples under point A being for a negatively net charged polymer or oligomer side chain and the examples under point B being for a positively net charged polymer or oligomer side chain.

[0082] However, the polymer or oligomer can also have a side chain without any net charge, i.e. wherein the net charge is equal 0 under physiological conditions or a pH of 7.0 to 9.5 in an aqueous solution. Suitable candidates for such neutrally charged side chains were previously listed under point C. For example, if the polymer or oligomer can also or exclusively feature a charge in the backbone structure of the polymer or oligomer, in particular when a side chain has a net charge of 0. Alternative candidates for such neutrally charged side chains are positively or negatively charged side chains that are paired, meaning that are neutralized by an oppositely charged side chain in the oligomer or polymer.

[0083] In one embodiment the oligomer or polymer side chain is covalently bound to the oligomer or polymer backbone (e.g. its main or longest chain) for example via an ester bond, an amine bond, or a thioester bond. The side chain can be part of at least one monomer constituting the oligomer or polymer before the oligomer is formed (e.g. by polymerization of the monomers) , as for the following exemplary monomers:

[0084] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the Cas ef fector protein is covalently bound to the oligomer or polymer via a binding moiety (BM) , the binding moiety (BM) being located at a terminus of the oligomer or polymer and / or between the termini of the oligomer or polymer .

[0085] As already mentioned, the covalent binding between the CRISPR Cas ef fector protein, in particular the amino acid side chains of the CRISPR Cas ef fector protein, and the oligomer or polymer occurs via a binding moiety (BM) of the oligomer or polymer, which binding moiety for example is a reactive functional group of the oligomer or polymer . In one embodiment , the binding moiety (BM) is present in the oligomer or polymer right from the beginning, i . e . immediately after the polymer has been obtained from its monomers , e . g . by a polymeri zation reaction, and remains unreacted as a part of the oligomer or the polymer . Herein, the BM can be a group on a side chain of the oligomer or polymer, or a group resulting from a polymeri zation initiator, optionally a group resulting from a RAFT polymeri zation initiator, optionally : polymerization initiator, optionally from a RAFT polymerization initiator, through a linker as described later.

[0086] In another embodiment, the binding moiety (BM) is introduced in the polymer or the oligomer after the polymer or oligomer has already been formed, for example via a linker or a spacer, for example a heterobifunctional linker.

[0087] In an embodiment which may be combined with any embodiments or aspects previously addressed or to be addressed, the linker or spacer is a combination of more than one linker, such as two, three, four, five, six, seven, eight, nine, ten, or more than ten linkers, meaning that it comprises or is composed of more than one linker, such as two, three, four, five, six, seven, eight, nine, ten, or more than ten linkers, in particular linkers including the BM.

[0088] Example of linkers including exemplary BMs for all aspects and embodiments disclosed herein are: wherein n is a number in the range of 1 to 30 .

[0089] In some embodiments , the linker and / or the spacer comprises two or more units , e . g . a molecular unit and a charged metal or two molecular units , which two or more units interact with each other forming the linker or the spacer as an af finity couple and / or a host-guest pair . Examples of af finity couples and hostguest pairs are streptavidin and biotin, avidin and biotin, Histidine tag and nickel-nitriloacetic acid (Ni-NTA) complex, FLAG tag and anti-FLAG antibody, protein A and IgG Fc domain, carbohydrate and lectin, p-cyclodextrin and ferrocene .

[0090] In one embodiment , the binding moiety (BM) is located at a terminus of the oligomer or polymer and / or between the termini of the oligomer or polymer . Under a terminus we understand herein the terminal end of the main chain ( also referred to as backbone ) of said oligomer or polymer . In other words , the covalent binding between the Gas ef fector protein and the oligomer or polymer can occur either terminally with respect to the main chain of the polymer, or it can be located between the two ends of this main chain, i . e . at a position in between the two backbone termini . In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method is one wherein the binding moiety (BM) is selected from the group consisting of a sul fhydryl-reactive group, optionally a haloacetyl halide , optionally an iodoacetyl group, an alkyl halide , a maleimide , an aziridine , an acryloyl group, a vinylsul fone , a cisplatin, a tosyl group, an epoxide , an alkene , a carboxylate reactive group, optionally a diazoalkyl group, a diazoacetyl group, an amine , optionally an amine with carbodiimide and NHS or sul fo-NHS , or with N, N ' -Disuccinimidyl Carbonate , or with N, N ' -Carbonyl Diimidazole , a hydroxyl reactive group, optionally an amine , optionally an amine with N, N ' -Disuccinimidyl Carbonate or with N, N ' -Carbonyl Diimidazole , an epoxide , a imidazole reactive group, a thioether reactive group, optionally an oxaziridine group, an amine reactive group, optionally an isothiocyanate , an isocyanate , an acyl azide , a N- hydroxysuccinimide ester, a sul fonyl chloride , a tosyl ester, an aldehyde , a ketone , an epoxide , a carbonate , a haloacetyl halide , an imido ester, a carboxylate , optionally a carboxylate with carbodiimide (EDC ) , an alkyl— phosphate , optionally an alkyl phosphate with carbodiimide (EDC ) , an anhydride , a fluorophenyl ester, a hydroxybenzotriazole ester, a N-hydroxysuccinimide carbonate , an imidazole carbamate , an acyl imidazole , an azlactone , a cyanate ester, a cyclic imidocarbonate , a chlorotriazine , a photosensitive group, optionally an aryl azide , an alkyne reactive group, optionally an azido group, an azido reactive group, optionally an alkyne group and a dibenzocyclooctyne group, an alkene reactive group, a nitrile reactive group, an epoxide reactive group or a ketone reactive group .

[0091] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the method further comprises the step ( iv) of adding a reporter comprising a detection moiety covalently linked to a sequence of a nucleic acid, wherein the sequence of the nucleic acid is suitable for being cleaved by the Cas complex and the detection moiety is suitable for optical detection, optionally fluorescence , colorimetric, luminescence , electrochemical and / or UV-vis detection .

[0092] In particular, the addition of the reporter comprising a detection moiety enables the detection of the onset of the reaction, rate , kinetics , and / or the end point of the reaction as the cleaved moiety causes e . g . an optical change of the reaction mixture .

[0093] In an embodiment of the method according to the present invention which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the target is a nucleic acid such as DNA or RNA.

[0094] There are di f ferent types of nucleic acids which are suitable targets in the present invention, such as for example a right handed DNA, in particular A-DNA, B-DNA, or D-DNA, a left handed DNA, in particular C-DNA or Z-DNA, cDNA ( complementary DNA) , mRNA, rRNA, tRNA, ncRNA, miRNA (micro RNA) , snoRNA ( small nucleolar RNA) , snRNA ( small nuclear RNA) , siRNA ( smallinterfering RNA) , or piRNA ( PlWI-interacting RNA) .

[0095] In a second aspect , which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a CRISPR Cas ef fector protein covalently bound to an oligomer or polymer as defined herein, optionally a Cas complex comprising a guide nucleic acid ( e . g . gRNA) and a CRISPR Cas ef fector protein covalently bound to an oligomer or polymer, optionally wherein the oligomer or polymer has a negative net charge , in particular a fraction of negatively charged monomers of 2 % , 5% , 10% , 15% , 20% , 25% , 30% , 35% , 40% , 45% , 50% , 55% , 60%, 65%, 70%, or 75% to 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%, optionally of 40% to 60% or 20% to 100%, under physiological conditions and / or at a pH of 7.0 to 9.5, or optionally wherein the oligomer or polymer has a positive net charge, in particular a fraction of positively charged monomers of 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% to 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%, optionally of 2% to 20%, under physiological conditions and / or at a pH of 7.0 to 9.5, optionally wherein the oligomer or polymer has a positive or negative net charge and a fraction of charged monomers in the oligomer or polymer is from 2% to 100%, optionally wherein a fraction of positively charged monomers is from 2% to 70% and the oligomer or polymer has a positive net charge, or a fraction of negatively charged monomers is from 5% to 100% and the oligomer or polymer has a negative net charge.

[0096] It is expressly noted that all definitions and examples provided above in the context of the method apply mutatis mutandis to the CRISPR Cas effector protein and the features noted in the context of this protein.

[0097] In one embodiment, the oligomer or polymer to which the CRISPR

[0098] Cas effector protein is covalently bound is not

[0099] In one embodiment, the oligomer or polymer to which the CRISPR Cas effector protein is covalently bound is not hyaluronic acid or alginate. In one embodiment , the CRISPR Cas ef fector protein is covalently bound to an oligomer or polymer, optionally via a sul fhydryl group, optionally sul fhydryl group of cysteine , optionally via a carboxylate group, optionally a carboxylate group of an aspartic acid or glutamic acid, optionally via a hydroxyl group, optionally a hydroxyl group of a tyrosine , a serine or a threonine , optionally via an imidazole group, optionally an imidazole group of a histidine , optionally via a thioether group, optionally a thioether group of a methionine , optionally via an amine group, optionally an amine group of a lysine , arginine , histidine or tryptophan, optionally via an azido group, an alkyne group, an alkene group, a nitrile group, an epoxide group or a ketone group, optionally an azido group, an alkyne group, an alkene group, a nitrile group, an epoxide group or a ketone group of a non-canonical amino acid, the oligomer or polymer comprises 5 to 2000 , optionally 25 to 400 monomers , and the oligomer or polymer has a fraction of charged monomers of 1 % or 2 % to 100% under physiological conditions or at a pH of 7 . 0 to 9 . 5 , optionally the oligomer or polymer has a positive or negative net charge and a fraction of charged monomers in the oligomer or polymer is from 2 % to 100% under physiological conditions and / or at a pH of 7 . 0 to 9 . 5 , optionally wherein a fraction of positively charged monomers is from 2 % to 70% and the oligomer or polymer has a positive net charge , or a fraction of negatively charged monomers is from 5% to 100% and the oligomer or polymer has a negative net charge .

[0100] In an embodiment , which may be combined with any of the previous embodiments and aspects or any embodiments and aspects to be mentioned unless in contradiction, no primary amine groups ( -NH2) of the CRISPR Cas ef fector protein are involved in the covalent binding of the oligomer or polymer to the CRISPR Cas ef fector protein . In this embodiment , the CRISPR Cas ef fector protein is covalently bound to an oligomer or a polymer by any CRISPR Cas ef fector protein group di f ferent from -NH2. In an embodiment , which may be combined with any of the previous embodiments and aspects or any embodiments and aspects to be mentioned unless in contradiction, only thiol groups ( -SH) of the CRISPR Cas ef fector protein are involved in the covalent binding of the oligomer or polymer to the CRISPR Cas ef fector protein . In this embodiment , the CRISPR Cas ef fector protein is covalently bound to an oligomer or a polymer only by CRISPR Cas ef fector protein thiol groups .

[0101] In some of the embodiments , the oligomer, or the polymer, in particular all of the oligomers and / or all of the polymers comprise only one type of monomer and are thus referred to as a homopolymer or a homooligomer . In some other embodiments , the oligomer, or the polymer, in particular all of the oligomers and / or all of the polymers comprise at least two di f ferent types of monomers and are thus referred to as a copolymer or a cooligomer .

[0102] In a third aspect , which may be combined with any of the embodiments and aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a use of the inventive method and / or the inventive Cas complex for detecting and / or modi fying a nucleic acid in and / or isolated from a biological sample , in particular in a one-pot detection assay together with an ampli fication of the target .

[0103] It is expressly noted that all definitions and examples provided above in the context of the method and the CRISPR Cas ef fector protein apply mutatis mutandis to the use of the method and / or the CRISPR Cas ef fector protein and the features noted in the context of these .

[0104] Herein, the biological sample is a biological material that is or was obtained from or secreted by a living or deceased organism . For example , the biological sample includes but is not limited to bacteria, protozoa, algae and other microorganisms, fungi, viruses, eukaryotic cells, for example cancer cells, plant and animal tissues, human biological materials, for example blood, semen, vaginal fluids, urine, faeces, saliva, mucus, sweat, bacteria discharge, genetic samples and any copies of the original genetic samples, or any cell line containing copies of the original genetic samples. The use is however not in any way limited to a detection directly in a biological sample - also extracts extracted from biological samples, such as cell extracts, or nucleic acid extracts fall within the scope of the present invention. In particular, nucleic acids extracted from biological samples fall within the scope of the present invention. Examples of extracts are lysates of biological samples, nucleic acids isolated and / or concentrated from biological samples, for example after lysis of the biological s amp 1 e .

[0105] BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Embodiments of the current invention are described in more detail in the following with reference to the figures. These are for illustrative purposes only and are not to be construed as limiting. It shows:

[0107] Fig. 1 a) a schematic depiction of the Cas complex; b) a schematic depiction of exemplary binding possibilities between the Cas effector protein and the polymer / oligomer;

[0108] Fig. 2 CRISPR Cas effector protein conjugate examples

[0109] Fig. 3 Results of the binding of polymers to LbCasl2a through primary amine and thiol groups;

[0110] Fig. 4 Comparison of the CRISPR reaction kinetics using LbCasl2a bound to polymers;

[0111] Fig. 5 Impact on the CRISPR reaction of polymers with different fractions of charged monomers; Fig. 6 Impact of the Cis- and Trans-cleavage rates of LbCasl2a conjugates on the one-pot reaction;

[0112] Fig. 7 Characterization of the CRISPR and one-pot reactions obtained with conjugated and unconjugated LbCasl2a for different targets.

[0113] Fig. 8 Impact on the CRISPR reaction kinetics of polymers with different sizes

[0114] Fig. 9 Impact on the CRISPR reaction kinetics of polymers with uncharged neutral side chains

[0115] Fig. 10 Impact on the CRISPR reaction kinetics of negatively charged polymers without neutral monomers

[0116] Fig. 11 Impact on the CRISPR reaction kinetics of negatively charged block copolymers

[0117] Fig. 12 Impact on the CRISPR reaction kinetics of positively charged polymers

[0118] Fig. 13 Impact of negatively charged polymers on the CRISPR reaction kinetics of different Cas proteins

[0119] Fig. 14 Comparison of the CRISPR reaction kinetics using native LbCasl2a and modified LbCasl2a with negatively charged polymers

[0120] Fig. 15 Impact on the one-pot reaction kinetics of negatively charged polymers at low DNA copy numbers

[0121] Fig. 16 Clinical performance of the one-pot reaction using Cas complexes according to the invention on Chlamydia trachomatis samples

[0122] Fig. 17 Times-to-result of the one-pot reaction using Cas complexes according to the invention, and of standard

[0123] PCR. Fig. 18 Clinical performance of the one-pot reaction using Cas complexes according to the invention on Human Papillomavirus 16 samples

[0124] Fig. 19 Performance of the one-pot reaction using Cas complexes according to the invention after lyophilization

[0125] DETAILED DESCRIPTION OF THE DRAWINGS

[0126] Figure 1 a) schematically shows a Cas complex (0) with its binding domain, schematically represented by an indentation in the body of the CRISPR Cas effector protein (1) . In the depicted example, a guide nucleic acid (e.g. gRNA) (2) is interacting with the binding domain and polymers (3 ) and / or oligomers (3) are attached / covalently bound to the CRISPR Cas effector protein (1) . The fraction of charged monomers is not depicted for better clarity .

[0127] Figure 1 b) schematically shows three binding possibilities between the CRISPR Cas effector protein (abbreviated in the Figure as "protein") and the polymer. Even though only a polymer binding is shown, for the person skilled in the art it is clear that also oligomers can be bound in the same way. In all possibilities that are shown, the Cas effector protein side chain reacts with a binding moiety (BM) under the formation of a covalent bonding between the Cas protein and the polymer or the oligomer. Such bonding can be a direct covalent bond (top scheme) , a covalent bond with a linker (or spacer) in between, wherein all bonds between the Cas protein and the polymer are covalent bonds (middle scheme) , or a bond wherein the linker comprises two fragments (symbolized by the circle and the halfmoon) . In the latter example (bottom scheme) , the first linker fragment is covalently bonded to the Cas protein and the second linker fragment is covalently bonded to the polymer or oligomer. The fragments interact with each other based on a chemical, an electrostatic, or host-guest affinity (bottom scheme) . Figure 2 schematically shows five CRISPR Cas effector protein examples: a) Polymers and / or oligomers (thick lines) conjugated to the CRISPR Cas effector protein's natural domains. Depicted are linear polymers or oligomers, however, also branched polymers or oligomers fall within the scope of the present invention; b) Polymers and / or oligomers (thick lines) conjugated to the CRISPR Cas effector protein's natural N- and C- termini; c) Polymers and / or oligomers (thick lines) recombinantly added to the CRISPR Cas effector protein's natural N- and C- termini; d) Polymeric and / or oligomeric chains (thick lines) conjugated to polymers and / or oligomers (thin lines) recombinantly added to the CRISPR Cas effector protein's natural N- and C- termini - the unit composed of the polymeric or oligomeric chain (thick line) and the polymer or oligomer (thin line) is an exemplary polymer or oligomer according to the invention. One of the two depicted exemplary polymers or oligomers is marked by a dashed box; e) Polymers and / or oligomers (thick line, directly connected to the CRISPR Cas effector protein) conjugated to CRISPR Cas effector protein's natural domains and polymeric and / or oligomeric chains (thick lines) conjugated to polymers and / or oligomers (thin lines) recombinantly added to the CRISPR Cas effector protein's natural N- and C- termini. One of the four depicted exemplary polymers or oligomers is marked by a dashed box.

[0128] Figure 3 shows an experimentally obtained HPLC chromatogram of two CRISPR Cas complexes. The complex obtained by functionalizing the protein's cysteines with polymers is more monodisperse than the one obtained by functionalizing the protein's primary amines.

[0129] Figure 4 shows CRISPR Cas reaction kinetics using LbCasl2a bound to polymers with a negative net charge. The onset of the CRISPR Cas reaction is delayed using negatively net charged polymers. Figure 5 shows experimental results on the impact on the CRISPR Cas reaction of polymers with di f ferent fractions of charged monomers - a) shows the impact of polymers when free in solution, i . e . not bound to the Cas ef fector protein . Polymers with fractions of negatively charged monomers of 50% or above slow down the reaction rate of the LbCas l2a but they do not delay the onset of the reaction ( reaction start ) . The diagram under b) shows the impact of the same polymers when bound to the Cas ef fector protein . Polymers with negative net charge bound to LbCas l2a delay the onset of the CRISPR Cas reaction, also when the polymers have fractions of negatively charged monomers below 50% .

[0130] Figure 6 shows experimental results on the impact of the Cisand Trans-cleavage rates of LbCas l2a complexes on a one-pot reaction - a) shows CRISPR Cas reaction results using di f ferent LbCas l2a complexes and b) shows the results of one-pot reactions using the LbCas l2a complexes as shown under point a) . The abbreviation "NC" stands for "net charge" . It is evident that the one-pot reactions work better with Cas complexes according to the invention and the one-pot reactions conducted with polymer-unconj ugated Cas ef fector proteins are much slower .

[0131] Figure 7 shows experimental results on the characteri zation of CRISPR and one-pot reactions obtained with Cas complexes of LbCas l2a ( i . e . wherein the Cas ef fector protein is covalently bound to the polymer ) and LbCas l2a which are not bound to any polymers . The abbreviation "NC" stands for "net charge" . The diagrams under a) , b) and c) show that the onset of the CRISPR Cas reaction is success fully delayed for all examples when using the Cas complex of LbCas l2a . The targets used herein were selected from the nucleic acids of Tri chomonas vaginali s, HPV 16 and Nei sseria gonorrheae . The diagrams under d) , e) and f) show that a one-pot reaction is improved in all examples when using the Cas complex of LbCasl2a (i.e. wherein the Cas effector protein is covalently bound to the polymer) .

[0132] Figure 8 shows an experimental comparison of CRISPR Cas reaction kinetics using LbCasl2a bound to polymers of different sizes - a) shows the chemical composition of the polymer side chains and b) shows CRISPR Cas reaction results using the different LbCasl2a complexes. It is evident that the Cas complexes obtained with polymers of different sizes all exhibit a delay in the reaction on-set compared to the polymer-unconj ugated Cas effector protein. The abbreviation "DP" stands for "degree of polymerization" .

[0133] Figure 9 shows an experimental comparison of CRISPR Cas reaction kinetics using LbCasl2a bound to polymers with different neutral side chain chemistries, i.e. a morpholino group and a polyethylene glycol chain - a-b) show the chemical compositions of the polymer side chains, c-d) show CRISPR Cas reaction results using the different LbCasl2a complexes and e-f) show the results of one-pot reactions using the LbCasl2a complexes as shown under point c-d) . It is evident that the Cas complexes obtained with the negatively charged polymers all exhibit a delay in the reaction on-set. For all polymers, the one-pot reactions work better with Cas complexes according to the invention and the one-pot reactions conducted with polymer- unconjugated Cas effector protein are much slower.

[0134] Figure 10 shows an experimental comparison of CRISPR Cas reaction kinetics using LbCasl2a bound to a polymer with no neutral side chains, i.e. containing 35% positively charged side chains, and 65% negatively charged side chains, resulting in a fraction of negatively charged monomers of the polymer of 65% and in a fraction of negatively charged monomers contributing to the net charge of the polymer of 30% - a) shows the chemical composition of the polymer side chains, b) shows CRISPR Cas reaction results using the different LbCasl2a complexes and c) shows the results of one-pot reactions using the LbCas l2a complexes as shown under point b) . It is evident that the Cas complex obtained with the negatively charged polymer exhibits a delay in the reaction on-set . The one-pot reactions work better with Cas complexes according to the invention and the one-pot reactions conducted with polymer-unconj ugated Cas ef fector protein cannot detect the low DNA amount in solution .

[0135] Figure 11 shows an experimental comparison of CRISPR Cas reaction kinetics using LbCas l2a bound to negatively charged block copolymers - a) shows the chemical composition of the polymer side chains , b) shows CRISPR Cas reaction results using the di f ferent LbCas l2a complexes and c) shows the results of one-pot reactions using the LbCas l2a complexes as shown under point b) . Block polymer 1 and 2 both have a fraction of negatively charged monomers contributing to the net charge of the polymer of 30% , but di f fer in the distribution of the negatively charged monomers . Block polymer 1 is made of two blocks , the first block composed of 40 zwitterionic monomers ( i . e . 0 net charge ) , and the second block composed of 30 zwitterionic monomers ( i . e . 0 net charge ) and 30 negatively charged monomers ( randomly distributed within the second block) . Block polymer 2 is made of two blocks , the first block composed of 70 zwitterionic monomers ( i . e . 0 net charge ) , and the second block composed of 30 negatively charged monomers . It is evident that the Cas complexes obtained with the block copolymers exhibit a delay in the reaction on-set and a slower reaction . The one-pot reactions work better with Cas complexes according to the invention and the one-pot reactions conducted with polymer-unconj ugated Cas ef fector protein cannot detect the low DNA amount in solution .

[0136] Figure 12 shows an experimental comparison of CRISPR Cas reaction kinetics using LbCas l2a bound to positively charged polymers . It is evident that the Cas complexes obtained with positively charged polymers all exhibit a delay in the reaction on-set and for higher positive fractions, a significantly slower reaction compared to the polymer-unconj ugated Cas effector proteins .

[0137] Figure 13 shows an experimental comparison of CRISPR Cas reaction kinetics using two alternative Cas proteins bound to negatively charged polymers. The tested proteins are the Type V protein AsCasl2a (operating at 37°C) and a modified version of the thermophilic protein CasM.21526 (operating at 50-75°C) . The CasM.21526 modification consisted in substituting 4 alanine residues with 4 cysteine residues - a) shows CRISPR Cas reaction result using the different AsCasl2a complexes and b) shows CRISPR Cas reaction result using the different CasM.21526 complexes. It is evident that the Cas complexes obtained with negatively charged block copolymers all exhibit a delay in the reaction on-set. Moreover, the modified CasM.21526 performs strongly despite the modifications, demonstrating that the number of attachment sites can be tuned without significantly affecting the reaction performance of the Cas protein itself.

[0138] Figure 14 shows an experimental comparison of CRISPR Cas reaction kinetics using two different LbCasl2a proteins bound to negatively charged polymers. The proteins are different in the amount of polymer attachment sites, i.e. 10 in the native LbCasl2a and 6 in the modified LbCasl2a. The modification consisted in substituting 4 cysteine residues with 4 alanine residues - a) shows CRISPR Cas reaction result using the native LbCasl2a complexes and b) shows CRISPR Cas reaction result using the modified LbCasl2a complexes. It is evident that the Cas complexes obtained with negatively charged block copolymers all exhibit a delay in the reaction on-set, but the protein with more attachment sites exhibits a slower reaction. Moreover, the native and modified LbCasl2a perform similarly, demonstrating that the number of attachment sites can be changed to obtain the desired reaction kinetics without signi ficantly af fecting the reaction performance of the Cas protein itsel f .

[0139] Figure 15 shows an experimental comparison of one-pot reactions performed using LbCas l2a conj ugated ( CHECKR) and unconj ugated ( Standard CRISPR) to negatively charged polymers at low DNA copy numbers . Standard CRISPR returns a positive signal only at the highest analysed DNA concentration, while CHECKR returns a positive signal for all the three analysed DNA concentrations . This demonstrates the superior performance in terms of sensitivity and speed, of the one-pot reactions performed with Cas complexes according to the invention .

[0140] Figure 16 shows the results of one-pot reactions using Cas complexes according to the invention on clinical samples of Chlamydia trachoma ti s - a) shows on the left one-pot reaction fluorescence curves of one positive sample compared to the curves of the negative samples ( 10 samples measured in triplicates ) , on the right PCR fluorescence curves of the corresponding sample , and b) shows that the one-pot reactions success fully detected samples with Ct up to 33 . 3 in less than 6 minutes . The abbreviation "Ct" stands for "cycle threshold" , "PCR" for "polymerase chain reaction" .

[0141] Figure 17 shows the times-to-result of one-pot reactions using Cas complexes according to the invention ( CHECKR) and standard PCR on clinical samples of Chlamydia trachoma ti s . The method according to the invention allows results with PCR quality in a fraction of the time and without the need for precise thermocycling instrumentation . The abbreviation "Ct" stands for "cycle threshold" , "PCR" for "polymerase chain reaction" .

[0142] Figure 18 shows the results of one-pot reactions using Cas complexes according to the invention on clinical samples of HPV1 6. Four positives and negatives were analyzed in triplicates and results were in full agreement with the Roche Cobas results , the reference method . After lysis , the clinical samples were spiked directly into the reaction mixture, showing the resilience to inhibitors of the method according to the invention. The abbreviation "Ct" stands for "cycle threshold".

[0143] Figure 19 shows the results of one-pot reactions using Cas complexes according to the invention after lyophilization. It is evident that the lyophilization of the one-pot reaction reagents containing the disclosed Cas complexes does not decrease the reaction performance and that the resulting chemistry has potential to be integrated into diagnostic systems. REFERENCE SIGNS LIST

[0144] 0 Cas complex

[0145] 1 CRISPR Cas effector protein

[0146] 2 guide nucleic acid (e.g. gRNA)

[0147] 3 oligomer 3 polymer

[0148] Examples

[0149] Example 1: Polymers with the following structure were conjugated to LbCasl2a via its primary amines and cysteines. For the former, the polymer's terminal carboxyl group was functionalized with an NHS ester group via EDC / NHS chemistry and the functionalized polymer was reacted with the LbCasl2a. For the latter, the polymer's terminal carboxyl group was functionalized with a linker-BM conjugate with the following structure and the functionalized polymer was reacted with the LbCasl2a. The resulting conjugates were analyzed by sizeexclusion chromatography.

[0150] Example 2. Polymers with the following structures were separately conjugated to LbCasl2a via the protein's cysteines and the polymer' s carboxyl group using a linker- BM conjugate with the following structure

[0151] The reaction rates of the resulting conjugates in a CRISPR

[0152] Cas reaction were compared against the unconjugated LbCasl2a. The reaction was carried out at 37°C with 25 nM

[0153] Cas protein, 25 nM gRNA, 0.5 pM reporter ( FAM-CCCCCC-TAMRA,

[0154] SEQ ID NO: 10) , and 100 pM target. A clear delay in the reaction offset was observed for the LbCasl2a conjugated with polymers with a negative net charge.

[0155] Example 3 . Polymers with the following structures cysteines and the polymer' s carboxyl group using a linker-

[0156] BM conjugate with the following structure

[0157] The reaction rates of the resulting conjugates in a CRISPR Cas reaction were compared against the reaction rates of unconjugated LbCasl2a separately mixed with the polymers listed above. The reaction was carried out at 37°C with 25 nM Cas protein, 25 nM gRNA, 0.5 pM reporter (FAM-CCCCCC- TAMRA, SEQ ID NO: 10) , and 100 pM target. Similar reaction rates were observed for the unconjugated LbCasl2a without polymer and mixed with polymers with a fraction of negatively charged monomers of 40%, corresponding to a fraction of negatively charged monomers contributing to the net charge of the polymer of 40%. Decreasing reaction rates but no offset delay were observed for the unconjugated LbCasl2a mixed with free polymers with a fraction of negatively charged monomers of 50% or 60%, corresponding to a fraction of negatively charged monomers contributing to the net charge of the polymer of 50% or 60%, respectively. On the contrary, a delay in the reaction offset was observed for all reactions with conjugated LbCasl2a. Noticeably, just an offset delay and no significant decrease in reaction rate was observed for the LbCasl2a conjugated to polymers with a fraction of negatively charged monomers of 40%, corresponding to a fraction of negatively charged monomers contributing to the net charge of the polymer of 40%.

[0158] Example 4. Polymers with the following structure were conjugated to LbCasl2a via the protein's cysteines and the polymer's carboxyl group using a linker-BM conjugate with the following structure

[0159] Several batches were made and resulted in LbCasl2a conjugates with slightly different behaviors according to the amount of polymer per protein and attachment sites of the polymer to the protein. The reaction rates of the resulting conjugates in a CRISPR Cas reaction were compared against the reaction rates of unconjugated LbCasl2a. The reaction was carried out at 37°C with 25 nM Cas protein, 25 nM gRNA, 0.5 pM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , 100 pM target. Different delays were observed for different conjugates. The LbCasl2a conjugates were then tested in a one-pot reaction. 0.48 pM forward and reverse primers, 2 pM reporter (FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , 25 nM unconjugated or conjugated LbCasl2a precomplexed for 1 hour with 25 nM gRNA and 38 copies of target were added to a 50 pL RPA kit (TwistDx Ltd) and the one-pot reaction was run at 40°C. All reactions containing the LbCasl2a conjugates had a significantly higher rate than the ones with the unconjugated protein.

[0160] Example 5. Polymers with the following structure were conjugated to LbCasl2a via the protein's cysteines and the polymer's carboxyl group using a linker-BM conjugate with the following structure

[0161] The reaction rates of the resulting conjugates in a CRISPR Cas reaction were compared against the reaction rates of unconjugated LbCasl2a. Different gRNAs were used in each reaction to check the versatility of the method to detect different targets, namely Neisseria gonorrheae, Thricomonas vaginalis, and Human papilloma virus 16. The CRISPR Cas reactions were carried out at 37°C with 25 nM Cas protein, 25 nM gRNA, 0.5 M reporter (FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. A delay in the reaction offset was observed for reactions with the LbCasl2a conjugates for all targets. The LbCasl2a conjugates were then tested in a one- pot reaction for the detection of the different targets. 0.48 pM forward and reverse primers, 2pM reporter (FAM- CCCCCC-TAMRA, SEQ ID NO: 10) , 25 nM unconjugated or conjugated LbCasl2a precomplexed for 1 hour with 25 nM gRNA and target (between 20 and 100 copies) were added to a 50 pL RPA kit (TwistDx) and the one-pot reaction was run at 40°C. Reactions containing the LbCasl2a conjugates had a significantly higher reaction rate than the ones with the unconjugated LbCasl2a for all targets.

[0162] Example 6. To compare reaction rates of Cas complexes with and without polymers or oligopolymers covalently bound to them, we performed a CRISPR Cas reaction and compared the measured fluorescence emissions. The Cas proteins and the gRNA were incubated for 3 hours to form the Cas complex. Then the reaction was prepared mixing Cas complex (50 nM) , fluorescence reporter (400 nM, FAM-CCCCCC-BHQ1 , SEQ ID NO: 10) and DNA target (40 pM) and run at 37°C on a plate reader to monitor fluorescence and compare the reaction rates .

[0163] Example 7. To estimate the rate at which the Cis-cleavage occurs, a method reported in literature can be used (see Anal. Chem. 2024, 96, 25, 10443-10450) . Target cleavage is studied under single-turnover conditions, with the concentration of the Cas complex in large excess (2 pM) over the target (20-80 nM) . Fluorescently tagged synthetic DNA target with a black hole quencher strategically placed on the complementary strand, ten bases downstream of the Casl2a double-stranded break site, is used. After successful cleavage, the quencher dissociates from the target, allowing kinetic rate of Cis-cleavage to be calculated from the measured fluorescence emission.

[0164] Example 8. Polymers with the following structures were conjugated to LbCasl2a via the protein's cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure

[0165] The reaction rates of the resulting conjugates in a CRISPR Cas reaction were compared against the unconjugated LbCasl2a. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 37°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. Delayed and slower reaction rates were observed for the LbCasl2a conjugated with the polymers . Example 9. Polymers with the following structures were conjugated to LbCasl2a via the protein's cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure

[0166] The reaction rates of the resulting conjugates in a CRISPR Cas reaction were compared against the unconjugated LbCasl2a. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 37°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. Delayed and slower reaction rates were observed for the LbCasl2a conjugated with the polymers. The LbCasl2a conjugates were then tested in a one-pot reaction for the detection of the different targets. 0.48 pM forward and reverse primers, 2pM reporter (FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , 25 nM unconjugated or conjugated LbCasl2a precomplexed for 3 hours with 25 nM gRNA and target (13 aM) were added to a 50 pL RPA kit (TwistDx) and the one-pot reaction was run at 40°C. Reactions containing the LbCasl2a conjugates had a significantly higher reaction rate than the ones with the unconjugated LbCasl2a.

[0167] Example 10. Polymer with the following structure was conjugated to LbCasl2a via the protein's cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure

[0168] The reaction rate of the resulting conjugate in a CRISPR Cas reaction was compared against the unconjugated LbCasl2a. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 37°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. Delayed and slower reaction rates were observed for the LbCasl2a conjugated with the polymers. The LbCasl2a conjugates were then tested in a one-pot reaction for the detection of the different targets. 0.48 pM forward and reverse primers, 2pM reporter (FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , 25 nM unconjugated or conjugated LbCasl2a precomplexed for 3 hours with 25 nM gRNA and target (2 aM) were added to a 50 pL RPA kit (TwistDx) and the one-pot reaction was run at 40°C. Reactions containing the LbCasl2a conjugate had a significantly higher reaction rate than the ones with the unconjugated LbCasl2a.

[0169] Example 11. Polymers with the following structures were conjugated to LbCasl2a via the protein' s cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure The reaction rates of the resulting conjugates in a CRISPR

[0170] Cas reaction were compared against the unconjugated LbCasl2a. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 37°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. Delayed and slower reaction rates were observed for the LbCasl2a conjugated with the polymers. The LbCasl2a conjugates were then tested in a one-pot reaction for the detection of the different targets. 0.48 pM forward and reverse primers, 2pM reporter (FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , 25 nM unconjugated or conjugated LbCasl2a precomplexed for 3 hours with 25 nM gRNA and target (2 aM) were added to a 50 pL RPA kit (TwistDx) and the one-pot reaction was run at 40°C. Reactions containing the LbCasl2a conjugates had a significantly higher reaction rate than the ones with the unconjugated LbCasl2a.

[0171] Example 12. Polymers with the following structures were conjugated to LbCasl2a via the protein's cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure The reaction rates of the resulting conjugates in a CRISPR Cas reaction were compared against the unconjugated LbCasl2a. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 37°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. Different reaction rates were observed for the LbCasl2a conjugated with the polymers.

[0172] Example 13. Polymer with the following structure was conjugated to AsCasl2a via the protein's cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure

[0173] The reaction rate of the resulting conjugate in a CRISPR Cas reaction was compared against the unconjugated AsCasl2a. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 37°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. A delay in the reaction offset was observed for the AsCasl2a conjugated with the polymer, showing that the method can be applied on different Cas proteins .

[0174] Example 14. CasM.21526 was modified by replacing four alanines with four cysteines. Polymer with the following structure was conjugated to the modified CasM.21526 via the protein's cysteines and the polymer' s terminal carboxyl group using a linker-BM conjugate with the following structure

[0175] The reaction rate of the native CasM.21526, the modified CasM.21526 and the modified CasM.21526 conjugate were compared. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reactions were then carried out at 63°C and pH 8.5 with 25 nM Cas complex, 400 nM reporter (ATTO488-TTTTTTTTTTTT-BHQ1 , SEQ ID NO: 11) , and 50 pM target. No change in the reaction rate was observed between the native and modified

[0176] CasM.21526, showing that cysteines can be introduced in the protein structure (for example in place of alanines) , to tune the number and location of the polymer binding sites in the protein. A delay in the reaction offset was observed for the modified CasM.21526 conjugated with the polymer compared to the modified CasM.21526 without polymer, showing that the method can be applied on different Cas proteins and works also at high reaction temperatures.

[0177] Example 15. LbCasl2a was modified by replacing four cysteines with four alanines. Polymer with the following structure was separately conjugated to the native and modified LbCasl2a via the protein's cysteines and the polymer's terminal carboxyl group using a linker-BM conjugate with the following structure

[0178] The reaction rate of the native LbCasl2a, the native LbCasl2a conjugate, the modified LbCasl2a, and the modified LbCasl2a conjugate were compared. The Cas complexes were formed incubating 500 nM Cas protein with 500 nM gRNA at 37°C for 3 hours. The reactions was then carried out at 37 °C and pH 8.5 with 25 nM Cas complex, 400 nM reporter (FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 50 pM target. No change in the reaction rate was observed between the native and modified LbCasl2a, showing that cysteines can be removed in the protein structure (for example replaced with alanines) , to tune the number and location of the polymer binding sites in the protein. A delay in the reaction offset was observed for both the native and modified LbCasl2a conjugated with the polymer. However, the reaction rate of the native Cas protein conjugate was slower than that of the modified Cas protein conjugate, showing that the extent of the delay and reaction rate change can also be fine-tuned by changing the number of the polymer binding sites (for example the number of cysteines in the protein) .

[0179] Example 16 Polymer with the following structure was conjugated to LbCasl2a via the protein's cysteines and the polymer's carboxyl group using a linker-BM conjugate with the following structure

[0180] The resulting conjugate was used in one-pot reactions to analyze 20 clinical samples in triplicates, namely 10 positive to Chlamydia trachomatis and 10 negatives. 0.48 pM forward and reverse primers, 2pM reporter (FAM-CCCCCC- TAMRA, SEQ ID NO: 10) , 25 nM unconjugated or conjugated LbCasl2a precomplexed for 3 hours with 25 nM gRNA and 4 pL clinical sample were added to a 50 pL RPA kit (TwistDx) and the one-pot reaction was run at 40°C. All positive and all negatives were detected correctly (100% specificity, 100% sensitivity) with a time-to-result below 6 minutes, showing the performance of the method. Example 17. Polymer with the following structure was conjugated to LbCasl2a via the protein's cysteines and the polymer' s primary amine group using a linker-BM conjugate with the following structure

[0181] The reaction rate of the resulting conjugate in a CRISPR

[0182] Cas reaction was compared against the unconjugated LbCasl2a. The Cas complex was formed incubating 500 nM Cas protein with 500 nM gRNA at 37 °C for 3 hours. The reaction was then carried out at 37 °C and pH 8.5 with 25 nM Cas complex, 400 nM reporter ( FAM-CCCCCC-TAMRA, SEQ ID NO: 10) , and 100 pM target. A delay in the reaction offset was observed for the conjugated LbCasl2a compared to the unconjugated LbCasl2a.

Claims

CLAIMS1. A method for delaying a reaction of a CRISPR Cas effector protein (1) with a target, the method comprising the steps:(i) providing a Cas complex (0) comprising a guide nucleic acid (2) and a CRISPR Cas effector protein (1) ;(ii) providing a target suitable for activating the Cas complex (0) ;(iii) combining the Cas complex (0) and the target under conditions suitable for activating the Cas complex ( 0 ) ; wherein the CRISPR Cas effector protein (1) is covalently bound to an oligomer (3) or polymer (3 ) , optionally via a sulfhydryl group, optionally sulfhydryl group of cysteine, optionally via a carboxylate group, optionally a carboxylate group of an aspartic acid or glutamic acid, optionally via a hydroxyl group, optionally a hydroxyl group of a tyrosine, a serine or a threonine, optionally via an imidazole group, optionally an imidazole group of a histidine, optionally via a thioether group, optionally a thioether group of a methionine, optionally via an amine group, optionally an amine group of a lysine, arginine, histidine or tryptophan, optionally via an azido group, an alkyne group, an alkene group, a nitrile group, an epoxide group or a ketone group, optionally an azido group, analkyne group, an alkene group, a nitrile group, an epoxide group or a ketone group of a non-canonical amino acid, the oligomer (3) or polymer (3 ) comprises 5 to 2000, optionally 25 to 400 monomers, and the oligomer (3) or polymer (3 ) has a positive or negative net charge and a fraction of charged monomers in the oligomer (3) or polymer (3' ) is from 2% to 100% under physiological conditions and / or at a pH of 7.0 to 9.5, optionally wherein a fraction of positively charged monomers is from 2% to 70% and the oligomer or polymer has a positive net charge, or a fraction of negatively charged monomers is from 5% to 100% and the oligomer or polymer has a negative net charge.

2. The method according to claim 1, wherein the fraction of positively charged monomers is the fraction of positively charged monomers contributing to the positive net charge of the oligomer (3) or polymer ( 3 ' ) , and / or the fraction of negatively charged monomers is the fraction of negatively charged monomers contributing to the negative net charge of the oligomer (3) or polymer (3' ) , optionally wherein the fraction of positively charged monomers is from 2% to 40% or 2% to 20% and the oligomer (3) or polymer (3' ) has a positive net charge, or wherein the fraction of negatively charged monomersis from 5% to 100% or 20% to 100% and the oligomer or polymer has a negative net charge.

3. The method according to claim 1 or 2, wherein delaying the reaction is delaying the onset of the reaction, in particular reducing the kinetics of the cis cleavage of the CRISPR Cas effector protein (1) .

4. The method according to any one of claims 1 to 3, wherein at least one of the method steps, in particular method step (iii) , is carried out together with a step of amplifying the target, in particular together with a step of a nucleic acid amplification for amplifying the target .

5. The method according to claim 4, wherein the target is amplified by loop-mediated isothermal amplification (LAMP) , recombinase polymerase amplification (RPA) , helicase-dependent amplification (HDA) , strand displacement amplification (SDA) , nucleic acid sequence-based amplification (NASBA) , transcription mediated amplification (TMA) , nicking enzyme amplification reaction (NEAR) , rolling circle amplification (RCA) , multiple displacement amplification (MDA) , ramification (RAM) , circular helicase-dependent amplification (cHDA) , single primer isothermal amplification (SPIA) , signal mediated amplification of RNA technology (SMART) , self-sustained sequence replication (3SR) , genome exponential amplification reaction (GEAR) , polymerase chainreaction (PCR) , strand invasion based amplification(SIBA) , or isothermal multiple displacement amplification (IMDA) .

6. The method according to any of claims 1 to 5, wherein the oligomer (3) or polymer (3 ) has a mass-average molecular weight of 500 Da to 500 kDa, optionally 6 kDa to 110 kDa; and / or is a synthetic polymer or a natural polymer, optionally is selected from the group consisting of polyacrylates, polymethacrylates , polyacrylamides , polymethacrylamides, polyvinyls, polystyryls, polyallyls, polyepoxides, polyethers, polyesters, polypropylenes, polyurethanes, polyacrylics and their copolymers, polysaccharides, optionally Q-amylose, cellulose, starch, mannosylated polyethyleneimine, chitosan, dextran, dextran derivatives, Cm-amylose, alginate or hyaluronic acid, polypeptides, optionally polylysine, polyarginine, polyasparagine, poly ( glutamic acid) , and low complexity domains, optionally poly (DEPQSG) .

7. The method according to any of claims 1 to 6, wherein: the polymer (3' ) is block copolymer having a negative net charge, the fraction of negatively charged monomers is from 5% to 100%, and the charged monomers are arranged in blocks in the polymer; orthe polymer is made by random monomer polymerization, the polymer has a negative net charge, the fraction of negatively charged monomers is from 20% to 100%, and the charged monomers are randomly distributed within the polymer.

8. The method according to any of claims 1 to 7, wherein: the oligomer (3) or polymer (3' ) consists of positively charged monomers and optionally net neutral monomers; consists of negatively charged monomers and optionally net neutral monomers; or consists of negatively charged monomers, positively charged monomers and optionally net neutral monomers; optionally wherein the fraction of positively charged monomers in the oligomer (3) or polymer (3 ) is from 2% to 20% or from 2% to 70% and the fraction of negatively charged monomers in the oligomer (3) or polymer (3 ) is from 5% to 100% or from 20% to 100%.

9. The method according to any one of claims 1 to 8, wherein the CRISPR Cas effector protein (1) is covalently bound to 1 to 50, optionally 1 to 30, 1 to 10 or 1 to 5 oligomers (3) or polymers (3 ) .

10. The method according to any one of claims 1 to 9, wherein the oligomer (3) or polymer (3 ) and / or theCRISPR Cas effector protein (1) bound to the oligomer(3) or polymer (3 ) is soluble under physiologicalconditions or at a pH of 7.0 to 9.5 without liquidliquid phase separation.

11. The method according to any one of claims 1 to 10, wherein the oligomer (3) or polymer (3 ) comprises: at least one polymer or oligomer side chain having a net charge, optionally a negative or positive net charge, and / or at least one polymer or oligomer side chain having a net charge equal 0.

12. The method according to claim 11, wherein the Cas effector protein (1) is covalently bound to the oligomer (3) or polymer (3 ) via a binding moiety (BM) , the binding moiety (BM) being located at a terminus of the oligomer (3) or polymer (3 ) and / or between the termini of the oligomer (3) or polymer (3 ) .

13. The method according to claim 12, wherein the binding moiety (BM) is selected from the group consisting of a sulfhydryl-reactive group, optionally a haloacetyl halide, optionally an iodoacetyl group, an alkyl halide, a maleimide, an aziridine, an acryloyl group, a vinylsulfone, a cisplatin, a tosyl group, an epoxide, an alkene, a carboxylate reactive group, optionally a diazoalkyl group, a diazoacetyl group, an amine, optionally an amine with carbodiimide and NHS or sulfo- NHS, or with N, N ' -Disuccinimidyl Carbonate, or withN, N ' -Carbonyl Diimidazole, a hydroxyl reactive group, optionally an amine, optionally an amine with N,N'- Disuccinimidyl Carbonate or with N, N ' -Carbonyl Diimidazole, an epoxide, a imidazole reactive group, a thioether reactive group, optionally an oxaziridine group, an amine reactive group, optionally an isothiocyanate, an isocyanate, an acyl azide, a N- hydroxysuccinimide ester, a sulfonyl chloride, a tosyl ester, an aldehyde, a ketone, an epoxide, a carbonate, a haloacetyl halide, an imido ester, a carboxylate, optionally a carboxylate with carbodiimide (EDC) , an alkyl phosphate, optionally an alkyl phosphate with carbodiimide (EDC) , an anhydride, a fluorophenyl ester, a hydroxybenzotriazole ester, a N-hydroxysuccinimide carbonate, an imidazole carbamate, an acyl imidazole, an azlactone, a cyanate ester, a cyclic imidocarbonate, a chlorotriazine, a photosensitive group, optionally an aryl azide, an alkyne reactive group, optionally an azido group, an azido reactive group, optionally an alkyne group and a dibenzocyclooctyne group, an alkene reactive group, a nitrile reactive group, an epoxide reactive group or a ketone reactive group.

14. The method according to any one of claims 1 to 13, further comprising the step (iv) of adding a reporter comprising a detection moiety covalently linked to a sequence of a nucleic acid, wherein the sequence of the nucleic acid is suitable for being cleaved by the Cas complex (0) and the detection moiety is suitable foroptical detection, optionally fluorescence, colorimetric, luminescence, electrochemical and / or UV-vis detection.

15. The method according to any one of claims 1 to 14, wherein the target is a nucleic acid such as DNA or RNA.

16. A CRISPR Cas effector protein (1) covalently bound to an oligomer (3) or polymer (3 ) , optionally a Cas complex (0) comprising a guide nucleic acid (2) and a CRISPR Cas effector protein (1) covalently bound to an oligomer (3) or polymer (3 ) , as defined in any of claims 1 to 15, wherein the oligomer (3) or polymer (3' ) has a positive or negative net charge.

17. A use of the method according to any of claims 1 to 15 or the Cas complex (0) according to claim 16 for detecting a nucleic acid in and / or isolated from a biological sample, in particular in a one-pot detection assay together with an amplification of the target.

Images