Compounds and methods for modulation of treg cells

WO2026151816A3PCT designated stage Publication Date: 2026-08-27VANDERBILT UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/010507
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-07
Filing Date
2026-01-07
Publication Date
2026-08-27

AI Technical Summary

Technical Problem

The roles of selenoproteins in T cell development and function are largely unknown, leading to impairments in T cell homeostasis, TCR signaling, and regulatory T cell suppressive function, which can result in inflammation and autoimmunity.

Method used

Administration of compounds that modulate selenoproteins, specifically targeting Trsp, to enhance T cell function and regulatory T cell suppression, using formulas with varying substituents and pharmaceutically acceptable salts.

Benefits of technology

Enhances T cell function, improves T cell homeostasis, and stabilizes regulatory T cells, reducing oxidative stress and preventing autoimmunity and inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2026010507_27082026_PF_FP_ABST
    Figure US2026010507_27082026_PF_FP_ABST
Patent Text Reader

Abstract

A method of promoting T-cell function, comprising administering an effective amount of a compound of the present invention, including 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2-hydroxybenzylamine; or a pharmaceutically acceptable salt thereof.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOUNDS AND METHODS FOR MODULATION OF TREG CELLSSummary of the Invention

[0001] The present invention generally relates to promoting T-cell function, and methods of enhancing T-cell therapy.

[0002] Selenoproteins are involved in immune cell metabolism, yet the roles of these proteins in T cell development and function remain largely unknown. The Trsp gene encodes the selenocysteine tRNA (tRNASec) required for translation of all selenoproteins. The present inventors have discovered that Trsp was required for thymopoiesis, with the majority of tRNASec-deficient T cells not progressing beyond double negative 3 stage, with egressed thymocytes undergoing peripheral homeostatic expansion. Zr / -deficient CD4+T cells exhibited impairments in TCR and IL-2 signaling and did not cause inflammation in experimental models. On the other hand, 7 / '.s / ?-deficient regulatory T (Treg) cells exhibited defects in suppressive function in vitro and Treg-specific Trsp deletion using TrspaFoxp3'i P'Cre(Trsp^res) mice caused fatal autoimmunity similar to FOXP3-deficient mice. Reducing oxidative stress via 2-HOBA administration prolonged survival in these Trsp^ve&mice. The present invention shows that tRNASecis required for T cell homeostasis and may be therapeutic targets in inflammation or carcinoma.

[0003] Accordingly, an embodiment of the present invention is a method of promoting T-cell function, comprising administering an effective amount of a compound of the following formula:wherein:R.2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

[0004] Another embodiment of the invention is a method of modulating Treg cells, comprising administering an effective amount of a compound of the following formula:wherein:R2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

[0005] Another embodiment of the invention is a method of modulating selenoproteins, comprising administering an effective amount of a compound of the following formula:wherein:R2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

[0006] Another embodiment of the invention is a method of enhancing T-cell therapy. Particular examples of enhanced T-cell therapy methods of the present invention include those treating infection, autoimmunity, and cancer.Brief Description of the Figures

[0007] Figure 1: CD2+ cells require Trsp for thymopoiesis and T cell homeostasis. (A) Male Trspfl / flmice were crossed with female Trsjf^CdF mice to generate Trsp^Cd2c'ce(Trsp ACD2)mjceRepresentative photo of the thoracic cavity of a 5 -week-old control (TrspvACd2c’ce)' and TrspACD2mouse (age- and sex-matched). Arrows indicate thymus (black) and thymus remnant (blue). (B) Absolute cell count of live lymphocytes in the thymus acquired using automatic cell counter. Pooled data from 2 independent experiments. Unpaired t-test. (C) Representative FC plots (left) and quantification (right) of thymocytes. Pooled data from 2 independent experiments. Mixed model with post-hoc Si dak's multiple comparisons test.Lineageneg for thymocytes indicates the following markers:CD19negLy6CnegTCRY5nesNKl.lne8CDllcneg. (D) Representative FC plots (left) andquantification (right) of DN (CD4negCD8neg) thymocyte subsets. Pooled data from 2 independent experiments. Mixed model with post-hoc Sidak's multiple comparisons test. (E) FC histogram of CD2 expression in WT (TrspwtCD2wt) mouse CD45+LinnegCD4negCD8negdouble negative thymocyte subsets. Representative results of 2 independent experiments. (F) Thymocytes were flow-sorted (DN1: CD45+CD4negCD8negCD44+CD25neg; DN2:CD45+CD4negCD8negCD44+CD25+; DN3: CD45+CD4negCD8negCD44negCD25+; DN4:CD45+CD4negCD8negCD44negCD25neg) from WT mice for selenoprotein RT-qPCR. Normalized expression is 2-AC(t). Pooled data from 2 independent experiments with total n=6 biological replicates. (G) CellROX fluorescence in thymocyte subsets from control and TrspACD2 mice. Representative histograms (left) and quantification (right). Data from 2 independent experiments performed using the same protocol including the same antibodies, same cytometer (Cytek), and same cytometer settings. Mixed model with post-hoc Sidak's multiple comparisons test. (H) Annexin-V+ T cells gated and quantified into DN1-DN4 as in (D). Mixed model with post-hoc Sidak's multiple comparisons test. (I) Absolute cell count of live lymphocytes in the spleen acquired using automatic cell counter. Pooled data from 2 independent experiments. Unpaired t-test. (J) Representative FC plots (left) and quantification (right) for CD4 and CD8 in splenocytes from control and TrspACD2 mice. Pooled data from 2 independent experiments. Unpaired t tests. (K) Representative FC plots (left) and quantification (right) of splenic T cells (CD45+CD3+CD4+) from control and TrspACD2mice. Subsets defined as follows: TCM:CD44+CD62L+; Tnaives: CD44negCD62L+; TEM: CD44+CD62Lneg. Pooled data from 2 independent experiments. Unpaired t tests. (L-M) Immunoseq was performed on flow-sorted (L) thymic CD4+ SP cells (CD45+CD4+CD8neg) and (M) splenic naive T cells. Data from one experiment. Unpaired t-tests. * p<0.05; ** p<0.01; *** p<0.001; **** p<0.0001.

[0008] Figure 2: T cells require Trsp for TCR activation and pathogenicity (A) Cd4Cre-ERT2; ROSAlox-stop-lox-tdTomato; Trspwt / wt (control) and Cd4Cre-ERT2; ROSAlox-stop-lox-tdTomato; Trspfl / fl (TrspACD4) mice were gavaged with 8 mg tamoxifen on days 0, 1 and 3. Naive T cells (CD45RBhigh) were then flow-sorted and intraperitoneally injected into sex-matched Ragl- / - mice. (B) Frequency of ROSA+ T cells in sorted cells prior to injection into Ragl- / -recipients. Pooled data from 3 independent experiments. Within each experiment, samples were pooled per genotype prior to sorting; each datapoint represents 3-6 mice. Mann-Whitney U test. (C) Representative histology (left) and quantification (right) of colitis across 3 independentexperiments 7 weeks after injection of naive T cells. Mann-Whitney U test. (D) Frequency of splenic T cells in mice that received Trsp-deficient or -sufficient naive T cells. Measured at experimental endpoint. Mann-Whitney U test. (E) Representative FC plots (left) and quantification (right) of splenic T cells restimulated with PMA / ionomycin for 5 hours in the presence of Golgi-Stop and stained for fFNy. Mann-Whitney U test. (F) Baseline-normalized weight curves for control and TrspACD4 mice gavaged with tamoxifen (8 mg x 3 doses) that subsequently received 3.5% DSS in their drinking water for 5 days followed by 5 days regular water, after which mice were euthanized. Mann-Whitney U test. (G) Colon length at experimental endpoint. Mann-Whitney U test. (H) Representative histology (left) and colitis score (right). Mann-Whitney U test. (I) CD4+ T cells were magnetically enriched from spleen and mLN of control and TrspACD4mice and stimulated using plate-bound aCD3 and soluble aCD28 for 2 hours, then lysed and subjected to a T cell phosphoprotein assay. Shown are the fold changes comparing Trsp-deficient to -sufficient T cells. n=9 per genotype; one experiment. (J) Western blot of control and TrspACD4 CD4+ T cells stimulated as in (I) for 15 minutes for LCK, MEK1, pLCKTyr394, pMEKlSer298, and vinculin (loading control). Representative data from 2 independent experiments. (K) Representative FC plots (top) and quantification (bottom) of control and TrspACD4CD4+ T cells stimulated with IL-2 for 15 minutes and stained for pSTAT5. Subsets defined as follows: TCM: CD44+CD62L+; Tnaives: CD44negCD62L+; TEM: CD44+CD62Lneg. Representative data from 2 independent experiments. Mann-Whitney U tests. (L) ELISA for IL-2 on supernatant of control and TrspACD4CD4+ T cells after 2 days in culture. Unpaired t test. * p<0.05; ** p<0.01; *** p<0.001; **** p<0.0001.

[0009] Figure 3: Treg cells in TrspACD2mice have an activated phenotype and reduced suppression. (A) Representative FC plots (top) and quantification (bottom) of splenic T cells from control and TrspACD2 mice. Pooled data from 2 independent experiments. Unpaired t-test. (B) Representative FC gating plots (top) and quantification (bottom) of splenic Treg cells from control and TrspACD2 mice. Pooled data from 2 independent experiments. Unpaired t tests. (C) Schematic (left), representative FC histograms (middle), and quantification (right) of in vitro Treg cell suppression using flow-sorted CD25+ T cells from control and TrspACD2mice and naive T cells from control mice in a 1:1 ratio of Treg: naive T cells. Each pair of dots (i.e. control and TrspACD2-derived Treg cells) represents one individual experiment. One-sided paired t test. * p<0.05; ** p<0.01; *** p<0.001; **** p<0.0001.

[0010] Figure 4: Treg cells require Trsp to prevent lethal autoimmunity.Trspfl / flFoxp3YFP-Cre mice were generated by crossing Foxp3YFP-Cre mice with Trspfl / fl mice. (A) Representative photo of control and Trspfl / flFoxp3YFP-Cre mouse at 4.7 weeks of age. (B) Survival curve of control, Trspfl / flFoxp3YFP-Cre, and Foxp3scurfy mice with Kaplan-Meier analysis. Pooled data from 5 independent experiments. n=22 control, n=9 Foxp3scurfy, n=6 Trspfl / flFoxp3YFP-Cre. Log-Rank (Mantel-Cox) test, p<0.0001. (C) Absolute cell count of live thymocytes from control and Trspfl / flFoxp3 YFP-Cre mice acquired using automatic cell counter at 4 weeks of age. Pooled data from 3 independent experiments. Unpaired t-test.(D) Representative histology of liver, skin and lung of control, Trspfl / flFoxp3 YFP-Cre, and Foxp3 scurfy mice. (E) Photo of spleen (left) and absolute cell count (right) of live splenic lymphocytes from control, Trspfl / flFoxp3 YFP-Cre, and Foxp3 scurfy mice. Representative data from 3 independent experiments. (F-J) FC phenotyping of (F) splenic T cells, (G) splenic B cells and serum IgE, and (H-J) splenic Treg cells. Pooled data from 4 independent experiments.Unpaired t-tests.(K) RNA-sequencing was performed on FC-sorted splenic Treg cells from control and Trspfl / flFoxp3 YFP-Cre mice. DESEQ2 was used to assess differentially expressed genes comparing Trspfl / flFoxp3 YFP-Cre versus control Treg cells. n=3 control and n=4 Trspfl / flFoxp3YFP-Cre. (L) Schematic representing bone marrow chimera experiment. Ragl- / -mice were sublethally irradiated (450 rads) and transplanted using a 1: 1 mixture of lineage-depleted bone marrow cells from Foxp3YFP-CreCD45.1 and Trspfl / flFoxp3YFP-CreCD45.2 mice. Control mice received a 1:1 mixture of cells from Foxp3YFP-CreCD45.1 and Foxp3YFP-CreCD45.2 mice. (M) Recipient mice were analyzed 6 weeks post-transplantation with the YFP+ fraction gated and the CD45.2+ / CD45.1+ ratio quantified. Data representative of 2 independent experiments with N=3-6. (N-Q) Trspfl / flFoxp3 YFP-Cre and control mice received 2-HOBA in the drinking water starting at postnatal day 1-2. (N) Representative photo of control and Trspfl / flFoxp3 YFP-Cre mice at indicated ages. (O) Survival curve of control and Trx / ifl / flFox / ?3YFP'Cremice treated without (same data from B) or with 2-HOBA from birth with Kaplan-Meier analysis. Log-rank (Mantel-Cox) test. n=22 control without 2-HOBA, n=6 Tr5 / ?fl flFox / ?3YFP'Crewithout 2-HOBA, n=62 control with 2-HOBA, n=12 TrspP'nFoxp3FP'Crewith 2-HOBA p<0.0001. (P) Representative histology of liver, skin and lung of control and Trsp^iaFoxp3vp'CTemice euthanized 58 days after 2-HOBA treatment.(Q) FC quantification of splenic Treg cells from control and Trspfl / flFoxp3YFP-Cre mice treated without (same data fromF) or with 2-HOBA from birth at the end of experiment. Mixed model with post-hoc Sidak's multiple comparisons test. p<0.05; ** p<0.01; *** p<0.001; **** p<0.0001.

[0011] Figure 5: Treg cells require Trsp for stability, suppression, and survival in an IL-2-dependent manner. (A) Fc>x 23eGFP'Cre'ERT2; Fo5a26lox'stop'lox'tdTomato; Tr52w't / '¥t(control) and Fo / ?3eGFP‘Cre'ERT2; Ao5a26lox‘stop'lox'tdTomato; Tr.s7?fl / flwere gavaged with 8 mg tamoxifen 8 times 4 days apart. (B) Splenic Treg cell frequency in mice from (A). Unpaired t-test. (C) Representative FC plots of ex-Treg cells (left) and quantification (right). Pooled data from 3 independent experiments. Unpaired t-test. (D) In vitro Treg cell suppression using flow-sorted GFP+tdTomato+ Treg cells from control andFox 23eGFP'Cre'ERT2; Fo5cz26lox'stop'lox dTomato; F'5 / 2fl'flmice and naive T cells from control mice in a 1:1 ratio of Tregmaive T cells. Pooled data from 2 independent experiments. Unpaired t-test. (E-G) Treg cells (ROSA+GFP+) were adoptively transferred into Ragl- / - mice. These mice did not develop colitis (not pictured). (E) Schematic showing experimental design. (F) Weight curve of Ragl- / - mice that received control naive T cells, control Treg cells, or Trsp^TegTreg cells. n=7-8 per condition. (G) Splenic Treg cell frequency in Ragl' ' mice that received control naive T, control Treg cells, or Trsp^regTreg cells at the experimental endpoint. Kruskal-Wallis test. (H-I) Splenic Treg cells from control and Fox / ?3eGFP'Cre'ERT2; Fo5rz26lox'stop'lox'tdTomato;7r5 / jfl / flmice were FC sorted and cultured in vitro with indicated concentrations of human recombinant IL-2 for 48 hours before (H) FC. One experiment. Mixed model with post-hoc Sidak's multiple comparisons test. (I) CellTiter glow quantification of cells in (H). Data was normalized to media only control. Representative data from two independent experiments. Mixed model with post-hoc Sidak's multiple comparisons test. * p<0.05; ** p<0.01; *** p<0.001; **** p<0.0001.

[0012] Figure 6 shows Cd2 is expressed by mouse DN1 thymocytes. A previously published single cell RNA-seq dataset of mouse DN thymocytes was analyzed similarly as described (see methods for details).27 (A) UMAP of clustered cells. DN1 cells were defined as expressing high Cd44 and Il7r and low Il2ra, Tcf7, Cd24, Notchl, and Bell lb. (B) Dot plot showing genes used to define clusters of cells representing DN1 thymocytes, i.e. cluster 2, 4, 10, 7, 24 in this analysis. Note that assigned cluster numbers are arbitrary and do not correspond to cluster numbers in the original manuscript.

[0013] Figure 7 shows Selenoproteins are expressed by human thymocytes. A previously published single-cell RNA-seq dataset of human thymocytes was analyzed for selenoprotein expression using the same clusters as in the original manuscript.

[0014] Figure 8 shows CD2+ cells require Trsp for T cell homeostasis. (A) Absolute cell count of live lymphocytes in mLN from control and Trsp^cmmice acquired using automatic cell counter. Pooled data from 2 independent experiments. Unpaired t-test. (B-G) FC of mLN lymphocytes from control and Trsp^cmmice. Unpaired t tests. Gating similar to gating described in Figure 1. Pooled data from 2 independent experiments. * p<0.05; ** p<0.01; *** p<0.001; **** p<0.0001.

[0015] Figure 9 shows validation of selenoprotein deletion in TrspACD4 CD4+ T cells(A) Representative FC plots (left) and quantification (right) of T cells from control and TrspACD4 mice for tdTomato. Data representative of >10 independent experiments. Unpaired t-test.(B) Capillary electrophoresis immunoassay (“Simple Western”) of control and TrspACD4 CD4+ T cells from spleen and mLN acquired using immunomagnetic negative selection for GPX4 (~22 kDa) or TXNRD1 (~55 kDa). As this automated system transfers an equal volume of the same sample into each capillary, B-actin (~42 kDa) was used as a loading control in separate capillaries. Samples were pooled from n=4-5 mice per genotype, and data are representative from 2 independent experiments.

[0016] Figure 10 shows phenotyping of FOXP3neg CD4+ T cells in TrspACD2 mice. FC quantification of splenocytes from control and TrspACD2 mice from Figure 3 with similar gating, showing frequencies of FOXP3negCD4+ T cells. Unpaired t tests. **p<0.01, ***p<0.001.

[0017] Figure 11 shows phenotyping of Trsp-deficient Treg cells. FC quantification of Annexin-V+ Treg cells from control and Trspfl / flFoxp3YFP-Cre mice. Mann-Whitney U test.

[0018] Figure 12 shows autoimmune inflammation in Foxp3scurtymice. Serum IgE ELISA in control and Foxp3 scurfy mice. Mann-Whitney U test.

[0019] Figure 13 shows phenotyping of FOXP3neg CD4+ T cells in Trspfl / flFoxp3YFP-Cre mice (A) FC quantification of splenocytes from control and Trspfl / flFoxp3YFP-Cre micefrom Figure 3 with similar gating, showing frequencies of FOXP3negCD4+ T cells. (B) Representative FC histograms (left) and quantification (right) of CellROX fluorescence of FOXP3negCD4+ T cells from control and Trspfl / flFoxp3YFP-Cre mice. Unpaired t tests.*p<0.05.

[0020] Figure 14 shows Left expression in Trsp-deficient Treg cells. FOXP3+ Treg cells from Trspfl / flFoxp3YFP-Cre and control mice were flow-sorted before RT-qPCR for Left normalized to Ubc. Unpaired t-test. One experiment.Description of the Invention

[0021] Before the present compounds, compositions, articles, systems, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.

[0022] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein can be different from the actual publication dates, which need to be independently confirmed.

[0023] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a functional group,” “an alkyl,” or “a residue” includes mixtures of two or more such functional groups, alkyls, or residues, and the like.

[0024] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0025] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0026] As used herein, the term “subject” refers to a target of administration. The subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.

[0027] As used herein, the term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially orcompletely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0028] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. As can be seen herein, there is overlap in the definition of treating and preventing.

[0029] As used herein, the term “diagnosed” means having been subjected to a physical examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by the compounds, compositions, or methods disclosed herein. As used herein, the phrase “identified to be in need of treatment for a disorder,” or the like, refers to selection of a subject based upon need for treatment of the disorder. For example, a subject can be identified as having a need for treatment of a disorder (e.g., a disorder related to inflammation) based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for the disorder. It is contemplated that the identification can, in one aspect, be performed by a person different from the person making the diagnosis. It is also contemplated, in a further aspect, that the administration can be performed by one who subsequently performed the administration.

[0030] As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat anexisting disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.

[0031] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired result or to have an effect on an undesired condition. For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition.

[0032] As used herein, the term “pharmaceutically acceptable carrier” refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, bythe use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption.Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.

[0033] As used herein, the term “scavenger” or “scavenging” refers to a chemical substance that can be administered in order to remove or inactivate impurities or unwanted reaction products. For example, the isoketals irreversibly adduct specifically to lysine residues on proteins. The isoketal scavengers of the present invention react with isoketals before they adduct to the lysine residues. Accordingly, the compounds of the present invention “scavenge” isoketals, thereby preventing them from adducting to proteins.

[0034] As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same ordifferent for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms “substitution” or “substituted with” include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.

[0035] The term “alkyl” as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, / / -butyl, isobutyl, s-butyl, / -butyl, / / -pentyl, isopentyl, s-pentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. The alkyl group can be cyclic or acyclic. The alkyl group can be branched or unbranched. The alkyl group can also be substituted or un substituted. For example, the alkyl group can be substituted with one or more groups including, but not limited to, optionally substituted alkyl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol, as described herein. A “lower alkyl” group is an alkyl group containing from one to six (e.g., from one to four) carbon atoms.

[0036] Throughout the specification “alkyl” is generally used to refer to both unsubstituted alkyl groups and substituted alkyl groups; however, substituted alkyl groups are also specifically referred to herein by identifying the specific substituent(s) on the alkyl group. For example, the term “halogenated alkyl” specifically refers to an alkyl group that is substituted with one or more halide, e.g., fluorine, chlorine, bromine, or iodine. The term “alkoxyalkyl” specifically refers to an alkyl group that is substituted with one or more alkoxy groups, as described below. The term “alkylamino” specifically refers to an alkyl group that is substituted with one or more amino groups, as described below, and the like. When “alkyl” is used in one instance and a specific term such as “alkylal cohol” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “alkylalcohol” and the like.

[0037] This practice is also used for other groups described herein. That is, while a term such as “cycloalkyl” refers to both unsubstituted and substituted cycloalkyl moieties, thesubstituted moieties can, in addition, be specifically identified herein; for example, a particular substituted cycloalkyl can be referred to as, e.g., an “alkyl cycloalkyl.” Similarly, a substituted alkoxy can be specifically referred to as, e.g., a “halogenated alkoxy,” a particular substituted alkenyl can be, e.g., an “alkenylalcohol,” and the like. Again, the practice of using a general term, such as “cycloalkyl,” and a specific term, such as “alkylcycloalkyl,” is not meant to imply that the general term does not also include the specific term.

[0038] The term “cycloalkyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, norbomyl, and the like. The term “heterocycloalkyl” is a type of cycloalkyl group as defined above, and is included within the meaning of the term “cycloalkyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. The cycloalkyl group and heterocycloalkyl group can be substituted with one or more groups including, but not limited to, optionally substituted alkyl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol as described herein.

[0039] The term “polyalkylene group” as used herein is a group having two or more CH2 groups linked to one another. The polyalkylene group can be represented by a formula — (CH2)a—, where “a” is an integer of from 2 to 500.

[0040] The terms “alkoxy” and “alkoxyl” as used herein to refer to an alkyl or cycloalkyl group bonded through an ether linkage; that is, an “alkoxy” group can be defined as — OA1where A1is alkyl or cycloalkyl as defined above. “Alkoxy” also includes polymers of alkoxy groups as just described; that is, an alkoxy can be a polyether such as — OA1— OA2or — OA1— (OA2)a— OA3, where “a” is an integer of from 1 to 200 and A1, A2, and A3are alkyl and / or cycloalkyl groups.

[0041] The terms “amine” or “amino” as used herein are represented by a formula NA'A2A3, where A1, A2, and A3can be, independently, hydrogen or optionally substituted alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein.

[0042] The term “hydroxyl” as used herein is represented by a formula — OH.

[0043] The term “nitro” as used herein is represented by a formula — NO2.

[0044] The term “pharmaceutically acceptable” describes a material that is not biologically or otherwise undesirable, i.e., without causing an unacceptable level of undesirable biological effects or interacting in a deleterious manner.

[0045] The present disclosure encompasses the preparation and use of salts of a compound of the present invention, including pharmaceutically acceptable salts. As used herein, the pharmaceutical "pharmaceutically acceptable salt" refers to salts or zwitterionic forms of a compound of the present invention. Salts of a compound of the present invention can be prepared during the final isolation and purification of the compounds or separately by reacting the compound with an acid having a suitable cation. The pharmaceutically acceptable salts of a compound of the present invention can be acid addition salts formed with pharmaceutically acceptable acids. Examples of acids which can be employed to form pharmaceutically acceptable salts include inorganic acids such as nitric, boric, hydrochloric, hydrobromic, sulfuric, and phosphoric, and organic acids such as oxalic, maleic, succinic, and citric. Nonlimiting examples of salts of compounds of the present invention include, but are not limited to, the hydrochloride, hydrobromide, hydroiodide, sulfate, bisulfate, 2-hydroxyethansulfonate, phosphate, hydrogen phosphate, acetate, adipate, alginate, aspartate, benzoate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerolphsphate, hemisulfate, heptanoate, hexanoate, formate, succinate, fumarate, maleate, ascorbate, isethionate, salicylate, methanesulfonate, mesitylenesulfonate, naphthylenesulfonate, nicotinate,2 -naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, picrate, pivalate, propionate, tri chloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, paratoluenesulfonate, undecanoate, lactate, citrate, tartrate, gluconate, methanesulfonate, ethanedi sulfonate, benzene sulfonate, and p-toluenesulfonate salts. In addition, available amino groups present in the compounds of the present invention can be quaternized with methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dimethyl, diethyl, dibutyl, and diamyl sulfates; decyl, lauryl, myristyl, and steryl chlorides, bromides, and iodides; and benzyl and phenethyl bromides. In light of the foregoing, any reference a compound of the presentinvention appearing herein is intended to include compounds of the present invention as well as pharmaceutically acceptable salts, hydrates, or solvates thereof. A preferred salt of the present invention is an acetate salt.

[0046] Compounds of the Invention

[0047] Embodiments of the present invention include compounds of the following formula, and their use, and pharmaceutically acceptable salts thereof:R5wherein:R2 is independently H, hydroxy, halogen, nitro, CF3, C1.6 alkyl, C1.6 alkoxy, C3-10 cycloalkyl, C3-8 membered ring containing C, O, S or N, optionally substituted with one or more R2, R3 and R4, and may cyclize with to one or more R2. R3, or Rs to form an optionally substituted C3-8 membered ring containing C, O, S orN;R3 is H, hydroxy, halogen, nitro, CF3, C1-6 alkyl, C1-6 alkoxy, C3-10 cycloalkyl, C3-8 membered ring containing C, O, S or N, optionally substituted with one or more R4, R2 and R3 may cyclize with to one or more R2 or R5 to form an optionally substituted C3-8 membered ring containing C, O, S orN;R4 is H, hydroxy, halogen, nitro, CF3, C1-6 alkyl, C1-6 alkoxy, C3-10 cycloalkyl, C3-8 membered ring containing C, O, S or N, optionally substituted with one or more R4, R2 and R3 may cyclize with to one or more R2, R3, or R5 to form an optionally substituted C3-8 membered ring containing C, O, S orN;Rs is a bond, H, hydroxy, halogen, nitro, CF3, C1-6 alkyl, C1-6 alkoxy, C3-10 cycloalkyl, C3-8 membered ring containing C, O, S or N, optionally substituted with one or more R4, R2 and R3 may cyclize with to one or more R2, R3, or R4 to form an optionally substituted C3-8 membered ring containing C, O, S or N;and stereoisomers and analogs thereof.

[0048] Examples of compounds that may be used with the methods disclosed herein also include, but are not limited to, compounds selected from the formula:wherein:R2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or un substituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

[0049] The compound may be also chosen from 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2 -hydroxybenzylamine. In a preferred embodiment, the compound is salicylamine (2-hydroxybenzylamine or 2-HOBA). A preferred example of the present invention is 2-HOBA acetate.

[0050] The compound may be also chosen from:or a pharmaceutically acceptable salt thereof.

[0051] The compounds or analogs may also be chosen from:or a pharmaceutically acceptable salt thereof.

[0052] The compounds may also be chosen from:COOHor a pharmaceutically acceptable salt thereof.

[0053] Methods of the Present Invention

[0054] One embodiment of the present invention is a method of promoting T-cell function, comprising administering an effective amount of a compound of the present invention. In another embodiment, the compound is preferably 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2 -hydroxybenzylamine; and pharmaceutically acceptable salts thereof.

[0055] Promoting CD8 T-cell function is important because functional T cells can recognize tumor antigens, expand (clonal proliferation) to meaningful numbers, infiltrate tumors, kill cancer cells (cytotoxicity), and persist as memory to prevent relapse.

[0056] Another method of the present invention is a method of modulating Treg cells, comprising administering an effective amount of a compound of the present invention. In another embodiment, the compound is preferably 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2 -hydroxybenzylamine; and pharmaceutically acceptable salts thereof.

[0057] Promoting regulatory T cell (Treg) function is beneficial to prevent immune responses from damaging your own tissues and help shut inflammation down once a threat is handled. It is known that stronger Treg activity can suppress autoreactive T cells that drive diseases like type 1 diabetes, MS, rheumatoid arthritis, lupus, psoriasis, and IBD (context-dependent). Further, Tregs limit inflammatory cytokine production and calm overactive immune cells (T cells, dendritic cells, macrophages), which can reduce tissue injury and symptoms. Also,enhancing Treg number / function can reduce rejection after organ transplant and mitigate GVHD after stem cell transplant.

[0058] Another embodiment of the present invention is a method of promoting T-cell therapy, comprising administering an effective amount of a compound of the present invention. In another embodiment, the compound is preferably 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2 -hydroxybenzylamine; and pharmaceutically acceptable salts thereof.

[0059] Adoptive T-cell therapies, including tumor-infiltrating lymphocyte (TIL) therapy and chimeric antigen receptor (CAR) T-cell therapy have been actively used for solid tumor treatment. Their efficacy relies in part on the ability of transferred T cells to survive. However, in many patients T-cell therapies show limited or transient responses, particularly in solid tumors, due in part to the hostile metabolic and oxidative conditions within inflamed or tumor microenvironments.

[0060] Within tumors and chronically inflamed tissues, T cells are exposed to nutrient depletion, hypoxia, and elevated levels of reactive oxygen species (ROS) derived from tumor cells, stromal cells, myeloid cells, and even activated T cells themselves.

[0061] Excessive or chronic ROS exposure has deleterious effects on T-cell biology. High ROS levels contribute to oxidative damage of proteins, lipids, and nucleic acids, mitochondrial dysfunction, and disruption of redox-sensitive signaling pathways. In the context of antitumor immunity, sustained oxidative stress can drive T-cell exhaustion, impair metabolic fitness, and limit the persistence and cytotoxic potential of tumor-reactive T cells. High ROS can impair T-cell receptor signaling, reduce interleukin-2 production, induce DNA damage and telomere erosion, and promote apoptosis or terminal exhaustion of T cells. Consequently, even when T-cell therapies deliver large numbers of tumor-specific cells, their functional lifespan and antitumor activity can be sharply curtailed by oxidative stress. Compounds of the present invention promote T-cell function and thus enhance T-cell therapy.

[0062] One aspect of this method is in connection with cancer treatment. For example, one embodiment is administration of a compound of the present invention can promote T cellfunction and augment the effectiveness of the cancer treating compound. Further, the compounds of the present invention can reduce immunotherapy-associated oxidated stress.

[0063] To date some of the most effective cancer therapies is to block inhibitory molecules PD-1 or CTLA-4 to enhance CD8 T cell effector function. Here, the invention of 2-HOBA may be effective as a standalone treatment or in conjunction with other combination therapeutic approaches (e.g., anti-CTLA-4, anti-PD-1).

[0064] Another embodiment of the present invention is a method of promoting thymopoiesis, comprising administering an effective amount of a compound of the present invention. In another embodiment, the compound is preferably 2-hydroxybenzylamine, methyl-2 -hydroxybenzylamine, or ethyl-2-hydroxybenzylamine; and pharmaceutically acceptable salts thereof.

[0065] Another embodiment of the present invention is a method of modulating selenoproteins, comprising administering an effective amount of a compound of the present invention. In another embodiment, the compound is preferably 2-hydroxybenzylamine, methyl-2 -hydroxybenzylamine, or ethyl-2-hydroxybenzylamine; and pharmaceutically acceptable salts thereof.

[0066] T cells are a critical component of adaptive immunity and their dysregulation is associated with various pathologies including infection, autoimmunity, and cancer. Both the development and function of T cells are tightly regulated by their metabolic capacity.Specifically, degree of oxidative stress has been shown to regulate physiologic activity of T cells. For instance, low concentrations of reactive oxygen species (ROS) can promote T cell activation and proliferation, whereas higher ROS concentrations can inhibit transcription factors essential for T cell activation and subsequent downregulation of transcription of interleukin-2. One protein family that contributes to cellular metabolism and redox state is selenocysteine-containing proteins (selenoproteins), most of which are antioxidants. Translation of the 25 known selenoproteins in humans (24 in mice) requires the selenocysteine tRNA (tRNASec) encoded by TRU-TCAl-HTrsp along with specialized translation factors that collectively coordinate selenocysteine insertion. Thus, TRU-TCA1-1 / Trsp regulates the expression of the entire class ofselenoproteins. While human and murine T cells express selenoproteins, there is a preponderance for expression of specific family members, suggesting distinct cell-specific roles.

[0067] Selenoproteins are essential for normal growth and development and although there are no reported null mutations in TRU-TCA1-1, individuals with a single nucleotide polymorphism (650G) that reduces tRNASeclevels and activity in vitro exhibit thyroid hormone imbalances. In mice, deletion of Trsp is embryonic lethal. Therefore targeted deletion of Trsp in specific cell types is required to investigate selenoprotein function collectively, which is particularly important as individual selenoproteins can compensate for each other. In T cells, selenoproteins have previously been studied using LckCre-mediated excision of Trsp that revealed a reduction in the frequency of mature CD4+ / CD8+single positive (SP) T cells in the thymus as well as in the periphery (here defined as extrathymic) and reduced activation / proliferation ex vivo. While selenoproteins are known to be important for thymocyte development, it is currently unknown when selenoproteins are expressed during intrathymic T cell development and how this affects progression through each stage of thymopoiesis. Moreover, the metabolic requirements for T cells differ among various T cell subsets. Although physiological levels of ROS are required for IL-2 production in activated T cells, the regulatory roles of selenoproteins in T cell subtype function are not known. Thus, the present inventors determined the effect of en-bloc deletion of murine selenoproteins in T cells on thymopoiesis and T cell function both in vitro and in vivo.

[0068] Results

[0069] CD2+cells require Trsp for progression from DN3 to DN4 during thymopoiesis

[0070] To study the contributions of selenoproteins during thymopoiesis, mice deficient for Trsp in all T cells were generated by crossing 7 / '.s / ?llox lloxmice22with CD2iCremice (TrspΔCD2mice). Trspflox / floxmice have loxP sites flanking the Trsp gene that encodes tRNASec 23. Without tRNASec, selenoprotein transcripts are not translated.23To explore whether Trsp-deficiency affects T cell development, we examined the thymus in age-matched littermates. Compared to control mice, the thymus of Trsp^cmmice was nearly absent (Figure 1A), similar to what wasreported in using LckCre-mediated excision of Trsp24Correspondingly, the absolute number of thymocytes was decreased in Trsp4'2mice (Figure IB). Thus, Trsp expression in CD2+cells is required for thymopoiesis. To define which thymopoietic stages require Trsp, developing T cell subsets of control and Trsp14™2mice were defined by flow cytometry (FC). In the thymus, T cell development progresses through distinct stages before T cells become double positive (DP) and subsequently single positive (SP) CD4+or CD8+T cells. In Trsp^™2mice, the frequency of double negative (DN) thymocytes was increased with a concomitant decrease in the frequency of DP thymocytes (Figure 1C). This finding indicates that either the progression from DN to DP cells is dependent on Trsp expression, or that progression within the 4 distinct DN stages may be impaired when Trsp is absent in CD2+cells, ultimately resulting in fewer DP cells. Lineage negative (CD19negLy6CnegTCRy5negNK1.1negCD11cneg) DN thymocyte stages are distinguished based on cell-surface expression of CD25 and CD44: DN1 (CD44+CD25neg), DN2 (CD44+CD25+), DN3 (CD44lowCD25+), and DN4 (CD44negCD25neg) as reviewed in26. In Trsp4™2mice, the frequency of T cells at the DN3 stage was increased while cells at the DN4 stage were decreased compared to control mice (Figure ID). Collectively, these data suggest that Trsp expression is required for progression through DN stages of thymocyte development with fewer cells progressing from DN3 to DN4 in Trsp4™2mice.

[0071] CD2 and selenoproteins are expressed throughout thymopoiesis

[0072] To determine whether CD2 expression temporally coincides with alterations in the frequency of DN3 and DN4 populations in Trsp4™2mice, we examined Cd2 expression across thymocyte stages in wild-type (WT) mice. We analyzed a previously published single-cell RNA-seq dataset of mouse DN thymocytes27and found that Cd2 expression was readily detected in putative DN1 thymocytes (Figure SOI). To confirm, CD2 expression was analyzed on thymic cells from WT mice. A bimodal distribution was observed, with CD2 being high in DN1, low / absent in DN2 and DN3, and high in DN4 (Figure IE). This CD2 expression pattern is congruent with the concept of CD2 being required for signaling through the pre-T cell receptor (TCR) complex, as DN3 is the first stage at which thymocytes start expressing TCR on their cell surface.

[0073] Since CD2 is expressed during DN1, we profiled selenoprotein expression throughout thymopoiesis. To this end, we employed real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR). Several selenoproteins were expressed during all DN stages, including DN1. The selenoproteins with the highest expression levels were Gpxl, Selenow, Selenoh, and Selenof. Interestingly, certain selenoproteins such as Gpxl, Selenow, and Selenof were highly expressed in DN1 / DN2 cells, whereas others (e.g., Selenoh) were only detected in later stages (Figure IF). To examine whether human thymocytes exhibited a similar expression pattern, we analyzed a single-cell RNA-seq dataset of human thymocytes and observed that some of the same selenoproteins were highly expressed in earlier DN stages (GPX1, SELENOH, SELENOF) compared with later stages (Figure S02). Thus, select selenoproteins are expressed by developing thymocytes in mice and humans and may be required for proper thymocyte development.

[0074] Thymocytes require Trsp to maintain physiological redox balance and prevent aberrant apoptosis

[0075] Having determined that Trsp^cmmice exhibit altered thymopoiesis, we next interrogated the potential mechanism underlying this observation. Most selenoproteins function by reducing oxidative stress, which can induce apoptosis (reviewed in32).Thymocyte apoptosis is central to thymopoiesis as T cells that do not receive a permissive TCR signal die instead of developing into DP cells. We hypothesized that selenoproteins function to reduce oxidative stress-induced apoptosis during thymopoiesis. First we measured ROS in 7 / '.s / ?ACD2mice by FC using CellROX. As expected, ROS levels were higher during all DN stages in Trspcmmice as compared to control mice (Figure 1G). Since the thymi in Trsp^cmmice were smaller than in WT controls, we hypothesized that this increase in ROS may drive aberrant apoptosis. As CellROX histograms did not segregate into distinct negative and positive populations (Figure 1G), we were not able to compare the frequency of Annexin-V+cells in cells with high versus low levels of ROS. Therefore, we examined which DN cells undergo apoptosis by measuring the frequency of Annexin- V+cells. In WT mice, the majority of Annexin-V+cells were in the DN4 stage, whereas in Trsp''cmmice most of the Annexin- V+cells were observed at the DN3 stage (Figure 1H), consistent with the tRNASec-deficient T cells not progressing beyond DN3. Collectively, thesedata suggest that CD2+cells require selenoproteins to maintain physiological redox state for appropriate thymocyte development through the DN stages.

[0076] tRNASec-deficient T cells that egress from the thymus of Trsp^cmmice undergo homeostatic proliferation

[0077] Having established that Trsp''cmmice have decreased thymic output, we wanted to determine if this leads to lymphopenia. We examined the spleen and mesenteric lymph nodes (mLN) of Trsp^cmmice and found a reduction in the absolute number of lymphocytes in the spleen of Trspcmmice with lower frequencies of CD4+T cells and higher frequencies of CD8+T cells compared to control mice (Figure 1I-J). We then examined CD4+T cell subsets, (i.e., naive T (TN), T effector memory (TEM) or T central memory (TCM) cells) and found that while TN frequency was reduced, both TEM and TCM frequencies were increased (Figure IK).Similar findings were observed in the mLNs, with the notable exceptions that there was no change in CD3+T cells, and there were no increases in CD8+T or TCM cell frequencies (Figure S03). This pattern of altered CD4+T cell subsets with increased memory T cells and decreased naive T cells is consistent with peripheral tRNASec-deficient CD4+T cells undergoing homeostatic proliferation.33Furthermore, the TCR repertoire during thymic development and post-egress determined via TCR CDR3 sequencing revealed that the number of productive TCRs in the CD4 SP thymocytes trended lower in tRNASec-deficient T cells (Figure IL) while the clonality of the splenic naive T cells was increased (Figure IM). This is consistent with a TCR repertoire of Trsp^cmmice that is less diverse than WT mice. These data indicate that selenoprotein-deficient T cells fail to undergo appropriate positive selection in the thymus and that the few T cells that successfully egress undergo homeostatic proliferation in the periphery.

[0078] Pathogenic CD4+T cells require Trsp

[0079] The present inventors observed that T cells require Trsp for proper T cell development. Since Trsp^cmmice have dysregulated CD4+ / CD8+T cells, we generated mice that allow for inducible deletion of selenoproteins specifically in CD4+T cells (Cd4CK'ERT2;?o5a26lox’stop'lox'tdToraato; Zr5 / 2fl / flmice). Repeated tamoxifen gavage resulted in >90% CD4+T cells expressing tdTomato, indicative of Cre-mediated recombination (Figure S04A). Weconfirmed the downstream consequences of Trsp deletion by Western blot for the selenoproteins glutathione peroxidase 4 (GPX4) and thioredoxin reductase 1 (TXNRD1), and observed marked reductions in GPX4 and TXNRD1 protein levels in TrspACD4as compared to WT CD4+T cells (Figure S04B). To test whether T cells require Trsp for pathogenicity, we employed the adoptive transfer model of colitis34wherein naive T cells (live, CD4+CD45RBhigh) from TrspΔCD4or control mice are injected into lymphocyte-deficient Rag1- / -recipient mice (Figure 2A). The frequency of injected tdTomato+cells did not differ between tRNASec-deficient or -sufficient naive T cells (Figure 2B), indicating that a similar frequency of cells underwent inducible Cre-mediated excision of the Rosa26 lox-stop-lox sequence prior to adoptive transfer. At the experimental endpoint, Rag1- / -mice that received tRNASec-deficient naive T cells were protected against colitis (Figure 2C). This was not attributed to differences in engraftment or expansion, as the frequency of splenic CD4+CD3+T cells did not differ between recipient groups (Figure 2D).Moreover, tRNASec-deficient T cells recovered from recipient mice and restimulated ex vivo with PMA / ionomycin produced IFNy to a similar degree as tRNASec-sufficient T cells (Figure 2E).Since T cell activation is a critical driver of colitis, this finding suggests that Trsp deficiency may lead to a TCR signaling defect, as cytokine production remained intact when bypassing TCR signaling with PMA / ionomycin. To test this, we utilized a T cell-independent colitis model mediated by dextran-sodium sulphate (DSS) and found no differences in weight loss, colon length, or histological injury between Trsp^cwand control mice (Figures 2F-H). Thus, Trsp is required for CD4+T cell pathogenicity in vivo, likely downstream of TCR activation.

[0080] Trsp is required for T cell receptor activation

[0081] To determine experimentally whether Trsp modulates pathways downstream of TCR activation, Trsp-sufficient / deficient CD4+T cells were stimulated using αCD3 and αCD28 followed by measurement of 213 TCR-relevant antibodies using a phosphoprotein assay. When ranked by fold change, phosphorylation of MEK1 at Ser298 (decreased) and phosphorylation of LCK at Tyr394 (increased) were identified as the two most altered in tRNASec-deficient as compared to control CD4+T cells (Figure 2I). These results were corroborated via Western blot analysis (Figure 2J). In addition, IL-2 production is downstream from TCR activation, and IL-2 is an important regulator of T cell metabolic function.35Thus, we assessed whether Trsp deletion in CD4 T cells alters both response to IL-2 and production of IL-2 after activation. Stimulationwith exogenous IL-2 in vitro resulted in reduced phosphorylation of signal transducer and activator of transcription 5 (pSTAT5) (Figure 2K). Interestingly, not only was the response to exogenous IL-2 reduced, but IL-2 production was also reduced in TrspΔCD4as compared to control CD4+T cells following activation (Figure 2L). Altogether, these data show that CD4+T cells require Trsp for activation of several signaling pathways downstream of TCR engagement. Moreover, tRNASec-deficient CD4+T cells secrete less IL-2 after TCR activation and are less responsive to exogenous IL-2. These findings likely explain the inability of 7r.s / ?-deficient naive CD4 T cells to cause colitis in Rag1- / -mice.

[0082] tRNASec-deficient Treg cells exhibit an activated phenotype but are functionally impaired

[0083] Since Trsp was required for TCR activation in TrspΔCD2mice, and TrspΔCD2mice were lymphopenic, we next sought to identify other CD4+T cell subsets that require Trsp. We hypothesized that the function of Trsp in Treg cells differs from other CD4+T cell subsets as we observed an increase in the frequency of splenic FOXP3+Treg cells in Trsp^cmmice (Figure 3A). TrspΔCD2Treg cells also exhibited a more active and proliferative phenotype based on expression of MHCII, Ki67, and CD69 (Figure 3B). Expression of RORyt was also increased in both CD4 FOXP3+(Figure 3B) and CD4+FOXP3negT cells from Trsp''c'nmice (Figure S05).Interestingly, CD4+FOXP3neg, but not CD4+FOXP3+, cells from TrspΔCD2mice also expressed elevated levels of CD25, the high-affinity component of the IL-2R, which may lead to higher affinity for IL-2 as compared to their WT counterparts (Figure S05). This may, in part, explain the increase in proliferation of CD4+FOXP3negT cells of Trsp^cmmice as measured by Ki67 (Figure S05). Prior work established that RORγt+Treg cells are more suppressive than RORγtnegTreg cells36,37. Therefore, we assessed the suppressive capacity of Treg cells from Trsp^cmmice in vitro and found that suppression by tRNASec-deficient Treg cells was modestly impaired compared to WT Treg cells (Figure 3C). Collectively, these data suggest that Trsp plays cell-intrinsic roles in Treg cell function.

[0084] Mice with tRNASec-deficient Treg cells develop fatal autoimmunity

[0085] Although Trsp^cmmice exhibit impaired thymopoiesis, they do not spontaneously develop overt inflammation. Nevertheless, they do exhibit increased Treg cellfrequency, and these Treg cells appear to be activated with increased RORyt+expression, yet they display defects in suppressive function in vitro. To investigate these Treg cell functional defects directly, we generated Zr5 / ?fl / flFoxp3YFP’Cre(Frs / ?ATres) mice. Homozygous deletion of Trsp specifically in FOXP3+cells resulted in an autoimmune phenotype (i.e. scaly tail, early mortality, skin inflammation, and hair loss) similar to FOXP3-deficient Foxp3scurfymice (Figure 4A-B).38Of note, gross phenotypes of TrspΔTregmice differed slightly from those of Foxp3scurfymice, in that TrspΔTregmice did not develop the characteristic thickened ears (not shown).TrspΔTregmice also displayed thymic involution and multiorgan inflammation, as observed in Foxp3scurfymice (Figure 4C-D), along with splenomegaly, decreased lymphocytes, and decreased splenic Treg cells (Figure 4E-F). Importantly, this reduction in splenic Treg cells could not be attributed to increased apoptosis, as measured by Annexin-V staining (Figure S06).Additionally, TrspΔTregand control mice displayed similar frequencies of splenic CD3+, CD8+, and CD4+cells (Figure 4F). This systemic inflammation was also associated with decreased splenic B cells and increased serum IgE levels (Figure 4G), both characteristics of autoimmune inflammation, and similar to Foxp3scurfymice (Figure S07). Of note, TrspΔTregmice did not develop spontaneous colitis, which is also not reported in Foxp3scurfymice39.

[0086] CD4+FOXP3+Treg, but not CD4+FOXP3neg, cells from Trsp^^ mice also exhibited an activated and proliferative phenotype (i.e. increased Ki67 and MHCII), along with increased ROS as measured via CellRox (Figures 4I-J, S08). To ascertain transcriptomic differences between 7 / :s / ?-sufficient / defi cient cells, we performed RNA-seq on sorted YFP+(FOXP3+) cells from TrspΔTregand control mice. One gene that was significantly downregulated in tRNASec-deficient Treg cells was the WNT transcription factor Lefl (Figure 4K). Lefl is both a WNT transcription factor and a WNT target gene and absence of Lefl renders Treg cells unable to suppress.40The decreased expression of Lefl in tRNASec-deficient Treg cells was confirmed by RT-qPCR (Figure S09). Since the frequency of Treg cells in TrspΔTregmice was reduced as compared to control mice (Figure 4F), we investigated whether Trsp expression provides a competitive advantage to Treg cells. Using congenically-marked mixed bone marrow chimeras, we found that the majority of Treg cells that persist in conditioned Rag1- / -mice were Trsp-sufficient (Figures 4L-M).

[0087] Given elevated oxidative stress in Treg cells of Trsp^Kgmice, we tested whether the autoimmune phenotypes could be rescued via antioxidant treatment. During ROS-induced lipid peroxidation, toxic isolevuglandins are formed that can be scavenged by 2-hydroxybenzylamine (2-HOBA), reducing ROS-induced damage.412-HOBA is currently under clinical investigation for several autoimmune / inflammatory disorders.42Thus, we tested whether 2-HOBA in the drinking water could ameliorate the autoimmune phenotypes of TrspΔTregmice. At 6 weeks, TrspΔTregmice that received 2-HOBA were still smaller in size compared to Trsp-sufficient mice but did not develop skin ulcerations, lethargy, or scaly tail (Figure 4N) that were observed in TrspΔTregmice without 2-HOBA treatment by 5 weeks of age (Figure 4A).However, by 8 weeks TrspΔTregmice receiving 2-HOBA did begin to develop these phenotypes. Survival of Trsp^xe%mice receiving 2-HOBA was prolonged compared to untreated Trsp^K^ mice (Figure 40) and inflammation in the skin and lung was less severe in 2-HOBA-treated TrspΔTregmice compared to untreated (Figure 4P). Splenic Treg cell numbers in TrspΔTregmice were higher with 2-HOBA treatment compared to TrspΔTregmice not administered 2-HOBA (Figure 4Q). Importantly, 2-HOBA treatment had no effect on splenic Treg numbers in control mice (Figure 4Q). Altogether, these data indicate that Treg expression of selenoproteins is required to prevent fatal autoimmunity in mice, possibly attributed to impaired Lefl expression and increased oxidative stress.

[0088] Treg cells require Trsp for stability, suppression, and survival in an IL-2-dependent manner

[0089] Treg cells can lose Foxp3 expression and consequently their suppressive function to become pathogenic ex-Treg cells.43,44It is possible that the systemic inflammation observed in TrspΔTregmice is due to conversion of tRNASec-deficient Treg cells to pathogenic ex-Tregs. In female ’ / r.s / ?11 ll / 'av / ?34 I I>'Crc'1mice, which have both 7 / :s / ?-sufficient and -deficient Treg cells due to random X-inactivation45, the majority of CD4+CD25+T cells were YFPneg(-75%), as compared toFP‘Cre / WTcontrol mice, in which 50% of CD4+CD25+T cells were YFPneg(data not shown). These data suggest that Treg cells lose their identity in Trspfl / flFoxp3YFP-Cremice. To examine how loss of Trsp affects Treg cells and their propensity towards becoming ex-Treg cells, we generated lineage-tracinglV’ar / ?3c(H'l>_Crc4',fl 2 / ?asz / 26h’x'slop4ovld lo'1iatoreporter mice and compared them to control ox >3eGFP'Cre'ERT2;7?05«26lox'stop’lox'tdTomatomice. In thesemice, F0XP3 -expressing cells are constitutively marked by GFP expression, and, upon tamoxifen administration, become irreversibly labeled with tdTomato. Repeated tamoxifen treatment reduced splenic Treg cell frequency in Tr / ?fl flo / ?3eGFP’Cre’ERT2Fo t / 26lox’stop’lox'tdTomatoas compared to control mice (Figures 5A-B). The frequency of ex-Treg cells (tdTomato+GFPneg) trended upwards in Tr57?fl / flox?3eGFP'Cre’ERT2Fo a2610X'st0p'10X'tdT0mat0mice, but did not achieve statistical significance (Figure 5C). When we tested GFP+tdTomato+Treg cells for suppressive function, we again observed that tRNASec-deficient Treg cells had a trend towards reduced suppressive capacity (Figure 5D). We then determined if loss of Treg cell stability (i.e. conversion to ex-Tregs) associated with Trsp deficiency is sufficient to cause inflammation in lymphopenic mice. To directly test this, GFP+tdTomato+Treg cells were sorted and transferred mXoRagl ■ ' recipient mice (Figure 5E). Both ' / / '.s / i-deficient and -sufficient Treg cells did not cause weight loss or colitis (Figure 5F and data not shown), indicating that tRNASec-deficient (ex-)Treg cells are not pathogenic in a cell-intrinsic manner. However, when compared to mice that received (WT) naive T cells, the frequency of Treg cells in mice that received tRNAScc-sufficient Treg cells was increased to a greater extent as compared to mice that received tRNASec-deficient Treg cells (Figure 5G), suggesting that in a non-competitive setting, Treg cells need Trsp for sustenance.

[0090] As Treg cells are uniquely sensitive to IL-2 due to expression of the trimeric, high-affinity IL-2R, our observations in 7r / ?ATregmice raised the question of whether the advantage of Trsp- sufficient Treg cells is IL-2-dependent. To this end, splenic Treg cells were sorted from Trspa'flox / ?5eGFp-Cre-ERT27?o5a26lox-stop-lox-tdTomat° mice and o / ?3eGFP Cre’ERT2Fo5a26lox'stop‘lox dTomatomice and cultured in the presence of increasing doses of IL-2 without TCR stimulation. No differences were observed in the MFI of GFP (FOXP3) in tdTomato tRNASec-deficient versus -sufficient Treg cells (Figure 5H), indicating that Trsp is not required for IL-2-mediated FOXP3 stability in vitro. Nevertheless, survival of tRNASec-deficient Treg cells was reduced as compared to tRNASec-sufficient Treg cells in the presence of varying concentrations of IL-2 (Figure 51). In summation, these data show that Trsp is required for Treg cell suppression, Treg cell stability (IL-2-independent), and Treg cell survival (IL-2-dependent).

[0091] Discussion

[0092] The present invention shows that Trsp is required for normal thymopoiesis, peripheral CD4+T cell activation, and regulatory T cell survival and function. More specifically, we illustrate that Trsp deletion in CD2+cells impairs thymopoiesis by reducing progression of T cell progenitors from DN3 to DN4, resulting in lymphopenia and T cell exhaustion. In peripheral CD4+T cells, Trsp deficiency impairs TCR activation, IL-2 signaling, and effector T cell function. Finally, the present inventors show that Trsp deletion specifically in Treg cells causes Treg cell deficiency and fatal autoimmune inflammation through increased oxidative stress. These phenotypes recapitulate those of mice with loss-of-function mutations in Foxp3. As Trsp encodes a tRNA required for translation of all selenoproteins, these data position Trsp and selenoproteins as central to T cell physiology.

[0093] Without being bound by theory or mechanism, the present inventors found that Trsp is particularly important in the DN3 to DN4 transition and that selenoproteins (particularly Gpxl, Selenow, and Selenof) are expressed as early as DN1, while expression of Txnrdl in (all) DN thymocytes is relatively low as compared to other selenoproteins. Others have shown that WT non-Cre-expressing DN 1 thymocytes have a competitive advantage over Cre -expressing Txnrdl -deficient DN1 thymocytes after transplantation into WT irradiated mice. Despite increased oxidative stress in DN1 thymocytes, we did not observe this reduced DN1 cellularity in TrspaK[CD2Cxemice. Though these are seemingly discrepant findings, the advantage of WT DN1 thymocytes as compared with 7Yw / / -deficient DN1 thymocytes was measured in a different context (i.e. post-irradiation and transfer as compared with from birth). Nevertheless, our data is consistent with their finding that selenoproteins may be relevant for pre-TCR signaling, as we demonstrated that there is CD2 expression in murine DN thymocytes and found it is highly expressed by DN1 cells, thus supporting a role for CD2 pre-TCR, as has been suggested. Overall, there is sparse literature on how individual selenoproteins affect thymopoeisis, and much more work is required to determine their roles.

[0094] The observation that TrspaaCD2CKmice have substantial aberrations in thymopoiesis and peripheral T cell proportions, studying the functional consequences of Trsp deletion in conventional CD4+T cells was only possible utilizing inducible Cre based approaches. For example, memory T cells respond differently to external stimuli, i.e. TCR stimulation, then naive T cells, and Trsp^cmmice have significantly more memory T cells thanWT mice. Thus, to test the function of Trsp in conventional CD4+T cells, we utilized cells isolated from Ct / Cre'ERT2>- / <zszz2lo"stop_|ox"td lon'l°; Trspa amice. To mimic TCR stimulation in vitro, we treated these Trsp- sufficient and -deficient CD4+T cells using ccCD3 / aCD28, since T cells require signal via the CD3 protein complex and costimulatory signal via the CD28 protein complex, which is typically provided by antigen-presenting cells. We found that phosphorylation of MEK1 on Serine 298 is decreased in Trsp-deficient CD4+T cells, which suggests decreased MEK1 autophosphorylation, decreased ERK activity, and thus decreased T cell function. This finding is consistent with a prior publication which found that ERK signaling was reduced in ' / / ■.s / i-deficient T cells. We also found that phosphorylation of LCK on Tyrosine 394 is increased in 7 / '.s / ?-deficient CD4+T cells, whereas phosphorylation of LCK on Tyrosine 505 is decreased, suggesting that LCK activity is increased in the absence of Trsp. This is in accordance with others who have shown that T cells require Selenokior calcium signaling downstream of TCR signaling. To what extent 7r / ?-deficient CD4+T cell function can be rescued by restoring individual components of the TCR signaling cascade remains to be determined.

[0095] Alterations in TCR signaling lead to functional impairment as the adoptive transfer of / / ■.s / i-deficient naive T cells into Rag1- / -mice did not cause colitis, likely due to disabling TCR-dependent activation. Consistent with this conclusion, cytokine production itself is intact when TCR is bypassed in these adoptively transferred cells. Yet, Trsp function in CD4+T cells does not seem limited to TCR activation per se. 7r p-deficient CD4+T cells respond to IL-2 stimulation with less phosphorylation of STAT5 then Trsp- sufficient CD4+T cells. This observation is true across all CD4+T cell subsets, including in antigen-inexperienced naive T cells and in the absence of TCR activation. Accordingly, one embodiment of the invention is treating an autoimmune disease such as colitis by rescuing Trsp deletion. Accordingly, modulation of Trsp in CD4+T cells might be a therapeutic option to reduce inflammation in patients with autoimmune diseases.

[0096] In immune homeostasis, Treg cells suppress conventional CD4+T cells. Similar to tRNASec-deficient conventional T cells, tRNASec-deficient Treg cells were also dysfunctional and lead to fatal autoimmunity. This finding is significant, as only deletion of CTLA-454and IL-2R55subunits have previously been shown to phenocopy the autoimmunity observed in Foxp3scurymice. Understanding the mechanisms behind tRNASec-deficient Treg cell dysfunctionis crucial. Our data suggest that increased oxidative stress renders Treg cells incapable of effective suppression, since 2-HOBA partially rescues this phenotype. In vitro suppression data indicate that Treg cells require Trsp during TCR-mediated activation and further investigation into how these processes occur is ongoing. Our findings seem to oppose reports that GPX1-deficient Treg cells are superior in suppressing T cell proliferation in vitro56Yet, tRNASec-deficient Treg cells may be dissimilar from GPX1 -deficient Treg cells in several aspects such as levels of oxidative stress and expression of other compensatory selenoproteins. Similar to conventional CD4 T cells, tRNASec-deficient Treg cells also exhibit impaired responses to IL-2. IL-2 signaling is particularly important for Treg cell function, as they require IL-22’5produced by activated effector T cells. Ex vivo, 7 / '.s / ?-deficient Treg cells demonstrate decreased survival as compared to Tksp-sufficient Treg cells. Based on these observations, Trsp may be a target for reducing the immune suppressive function of Treg cells in cancers, potentially allowing for increased immunosurveillance.

[0097] Important next steps in the field will be to determine which selenoproteins are required for differentiation into specific T cell subsets.57The extent to which specific selenoproteins affect individual Th subsets and Treg cell function have not been fully defined. While it has been shown that GpxTFmice displayed enhanced Thl / Thl7 polarization with a concomitant decrease in Th2 polarization,58and that GpxT~ CD25+Treg cells) suppressed naive T cell proliferation induced by aCD3 and WT dendritic cells to a greater degree than WT CD25+Treg cells in vitro,56there is little data systematically determining which selenoproteins are most important in each Th subset.

[0098] Material and Methods

[0099] Mice

[0100] Mice lacking Trsp in specific immune cells were generated by crossingyj^fiox / flox 22mjce variousQrelines: CD2Cremice61(The Jackson Laboratory, Bar Harbor, ME, JAX stock #008520); Ct / #Cre'ERT2mice62(J AX stock #022356); Fox / ?3eGFP'Cre’ERT2mice63(JAX stock #016961); and ox / ?3FP'Cremice64(JAX stock #016959). As Foxp3 is located on the X chromosome, we used Foxp3YFP~Crehemizygous males and homozygous females for all experiments. To enable lineage tracing, the tamoxifen-inducible Cre mice (i.e. C / 7trc‘FRT2andFox / ? JeGFP'Cre'ERT2) were crossed with Fc>5«26lox'stop’lox‘tdTomatomice63(J AX stock #007914). Mice were administered 8 mg tamoxifen (Millipore Sigma, St. Louis, MO, #T5648) in 200 pL olive oil (Millipore Sigma, 01514) with 1% ethanol (Millipore Sigma, #1085430250) by oral gavage. To prevent bias from tamoxifen gavage and its associated Cre recombination66, both knockout and control mice received tamoxifen. 7rs / IF,x nox / ’ r / ;3YI P'Cre(and control) mice were monitored by independent observers blinded to experiment and genotype, and euthanized when deemed moribund. Macroscopic photos were taken using an iPhone (Apple, Cupertino, CA).

[0101] Genotyping for Trsp was done in-house using the following primers (Millipore Sigma) and the following protocol: CKNO2: 5’-GCAACGGCAGGTGTCGCTCTGCG-3’; 8RP: 5’-CGTGCTCTCTCCACTGGCTCA-3’. PCR conditions: 94°C for 5 min; 30 cycles of: 94°C for 30 sec, 58°C for 60 sec, 72°C for 60 sec; 72°C for 3 min. Using these primers and protocol, the floxed Trsp gene yields a ~1.1 kb fragment, while the WT Trsp gene yields a 900 bp fragment. The Cre-excised Trsp gene yields a -450 bp fragment. Confirmatory genotyping was done by Transnetyx using their proprietary probes after we confirmed these probes yielded the same results as our in-house genotyping.

[0102] Foxp3scur' (J AX stock #004088)67mice have been described previously. All mice except Ragl~ ' mice were housed in the same room. RagF~ mice68(J AX stock #002216) were housed in sterilized cages and provided autoclaved food and water. All experiments were performed using 6-8-week-old sex- and age-matched, co-housed mice unless otherwise indicated. Both female and male mice were used. Littermates were used whenever possible. Experiments were approved by the VA Institutional Animal Care and Use Committee (IACUC) and / or the VUMC IACUC.

[0103] Flow Cytometry

[0104] Staining

[0105] For cell surface staining, cells were blocked using mouse Fcblock (Biolegend, San Diego, CA, #101320) and incubated in the antibody cocktail including a fixable live / dead stain (ThermoFisher Scientific, Waltham, MA, #65-0866-14) for 20 minutes at 4°C in the dark. Red blood cells were lysed prior to staining where applicable using ACK lysing buffer(Therm oFisher Scientific, #A1049201). Intracellular cytokine staining was performed using Cytofix / Cytoperm (BD, #554714) and intranuclear stain was performed using the Foxp3 / Transcription Factor Staining Buffer Set (ThermoFisher Scientific, #00-5523-00), the Foxp3 / Transcription Factor staining buffer kit (Tonbo / Cytek, #TNB-0607-KIT), or the TrueNuclear™ Transcription Factor Buffer Set (#424401, Biolegend), according to manufacturer's instructions. Cells were stained for oxidative stress using CellROX Deep Red (ThermoFisher Scientific, #C10422) for 30 minutes at 37°C with 5% CO2 in 200 pL T cell media (TCM, RPMI 1640 with 10% heat-inactivated FBS, 100 unitsmL’1penicillin, 100 pgmL-1streptomycin (ThermoFisher Scientific, #10378016), GlutaMax (ThermoFisher Scientific, #35050-061), MEM non-essential amino acids (Coming, #25-025-CI), 55 M betamercaptoethanol (ThermoFisher Scientific, #21985-023), and 1 mM sodium pyruvate (Millipore Sigma, #S8636-100ML). Stock vials of CellROX were used a maximum of two times as our observations showed similar results (not shown). Cells were stained for Annexin-V for 15 minutes at room temperature in either IX Annexin-V binding buffer for Annexin-V antibody staining or PBS for Apo-15 peptide staining (Biolegend). Antibodies used for flow cytometry or cell sorting are listed in Table SI.

[0106] IL-2 stimulation and pSTAT5 staining

[0107] To measure T cell activation in response to IL-2, CD4+T cells were enriched from spleen and mLN using immunomagnetic negative selection (EasySep™ Mouse CD4+ T Cell Isolation Kit, STEMCELL Technologies, #19852). T cells were stained for surface markers (Table SI) as above, washed with TCM, incubated for 5 minutes at 37°C, 5% CO2, then stimulated with 20 ngmL'1recombinant mouse IL-2 (R& D Systems, #202-IL-010 / CF) for 15 minutes at 37° C, 5% CO2. After stimulation, cells were fixed with warm Phosflow™ Fix Buffer I (BD, # 557870) for 10 minutes at 37°C. After washing, cells were permeabilized with ice-cold (-20°C) Phosflow™ Perm Buffer III (BD, # 558050) for 30 minutes on ice. Cells were washed again and stained for pSTAT5 for 1 hour at room temperature, then washed and acquired.

[0108] Acquisition and sorting

[0109] Flow cytometric analysis was performed using a 4 / 5-Laser Fortessa or 5-laser LSRII (BD, Franklin Lakes, NJ) with FACSDiva software (BD), or a Cytek® Aurora (CytekBio, Bethesda, MD). FC-sorting was performed on a Cytek Aurora™ CS System or on a FACS Aria III (BD).

[0110] Adoptive transfer

[0111] For adoptive transfer colitis, naive T cells were sorted from spleen and mLN based on live CD4+CD45RBhlexpression following pre-enrichment for CD4+cells as above. Ragl'~ mice were intraperitoneally injected with 5xlO5naive T cells.34As colitis in the adoptive transfer model is dependent on a complex microbiota containing Helicobacter spp., recipients were removed from sterile housing conditions and bedding from other (non-experimental) mice housed in non-autoclaved cages was mixed into the cages of recipient mice at the time of injection.69For transfer of Treg cells, Treg cells were sorted from spleen and mLN based on live, CD4+FOXP3+ROSAtdTomato+expression following pre-enrichment for CD4+cells using negative selection as above. Ragl ~ mice were intraperitoneally injected with IxlO5Treg cells. For both experiments, mice that received / / '.sy>-deficient or -sufficient Tnaive / Treg cells were co-housed. Mice were weighed at the beginning of each experiment to establish a baseline weight, then weekly thereafter.

[0112] In vitro Treg cell suppression

[0113] Naive T cells (Live CD4+CD45RBhl) from spleen and mLN were sorted and labeled with CellTrace Violet (ThermoFisher Scientific, #C34557). Treg cells (live CD4+CD25+in CD2Cremice and live CD4+FOXP3+ROSAtdTomato+in Foxp3eGFp-Cre~ERT2;ROSA26lox-stop-lox- tdTomatomjce)weresorted. Cells were stimulated using aCD3ocCD28 Dynabeads (ThermoFisher Scientific, #11456D) for approximately 60 hours. Proliferation was assessed via CellTrace Violet dilution in naive T cells and % suppression determined.

[0114] Histology

[0115] Hematoxylin and eosin (H& E) staining was performed by the VUMC Translational Pathology Shared Resource on formalin-fixed, paraffin-embedded (FFPE) sections.Histological scoring was performed by a gastrointestinal pathologist (MKW) blinded to genotype and treatment.

[0116] Slide imaging

[0117] H& E slides were imaged by the VUMC Digital Histology Shared Resource using a high-throughput Leica SCN400 Slide Scanner automated digital image system from Leica Microsystems. Whole slides were imaged at 40X magnification to a resolution of 0.25 pm / pixel. Images were exported from QuPath70(version 0.4.3, developed at University of Edinburgh, Edinburgh, Scotland) and if necessary, adjusted for brightness and contrast using Adobe Photoshop CS6 (equally across all images in one figure panel).

[0118] Mixed bone marrow chimeras

[0119] RagF~ recipient mice were pre-conditioned with 450 rads of 137Cssource radiation. Conditioned mice were retro-orbitally injected with 5xlO5congenically-marked lineage-depleted (ThermoFisher Scientific, #8804-6829-74) bone marrow cells recovered from the tibiae and femora of CD45. \+,'Foxp3YFP~Creand CD45.2+; Tr5 / ^; Fox / ?3yKP-Cremice in a 1:1 ratio. Similarly, control mice received cells from CD45. l; / ’o.r / Ui7''reand CD45,2+Foxp3YFP~Cremice. All recipient mice received 0.4 mgmL’1enrofloxacin (Baytril, Elanco) in their drinking water from 7 days pre-to 7 days after transplant (14 total days), and 1 mgL’1neomycin from day 3 to day 10 after transplant. Mice were euthanized 6 weeks post-transplant for evaluation.

[0120] Dextran sodium sulfate colitis

[0121] To induce colitis, mice received 3.5% DSS (TdB consultancy, Uppsala, Sweden) in their drinking water for 5 days, followed by 5 days of regular autoclaved drinking water, after which mice were euthanized. Mice were weighed at the beginning of each experiment to establish a baseline weight, then daily thereafter.

[0122] ELISAs

[0123] IgE ELISA

[0124] Serum IgE levels were measured with a Mouse IgE ELISA Kit (ThermoFisher Scientific, #EMIGHE) according to the manufacturer’s protocol, with the following modifications. For Foxp3YFP Cre; Trsp samples, the precoated anti-mlgE 96-well plate included in the kit was used. For Foxp3scur^ysamples, a Nunc MaxiSorp 96-well plate (ThermoFisher Scientific, #445101) was coated with 1 pgmL'1anti-mlgE (BioLegend, #406902) overnight at 4° C. The following day, the plate was washed with PBS five times, then blocked with 75% (v / v) PBS with 0.1% Tween 20 (Millipore Sigma, #P9416), 25% (v / v) Block ACE (Bio-Rad, #BUF029), 5% (w / v) a-lactose monohydrate (Millipore Sigma, #L3625), and 5% (w / v) D-sucrose (ThermoFisher Scientific, #BP220-212) for 1 hour at room temperature. All serum samples were diluted 1: 10000 in the IX Assay Diluent included in the kit prior to ELISA.Absorbance at 450 nm was read on a GloMax® Discover plate reader (Promega, Madison, WI).

[0125] IL-2 ELISA

[0126] Samples were diluted (1: 15-1.50) and used in the ELISA MAX™ Deluxe Set Mouse IL -2 (Biolegend, #431004) according to manufacturer’s instructions. Absorbance at 450 nm was read on a GloMax® Discover plate reader (Promega).

[0127] Phosphoprotein assay

[0128] CD4+T cells were enriched from the spleen and mLN of tamoxifen-treated mice using negative magnetic selection. Cells were stimulated using 2pgmL’1plate-bound oCD3 (ThermoFisher Scientific, #16-0031-86) and 1 pgmL'1soluble otCD28 (ThermoFisher Scientific, #16-0281-85) for 2 hours. The T-Cell Receptor Phospho Antibody Array (Full Moon Biosystems, #PTC188) was then performed with these cells according to the manufacturer’s protocol, with 10 pLmL'1each of phosphatase inhibitor cocktail 2 (Millipore Sigma, #P5726), phosphatase inhibitor cocktail 3 (Millipore Sigma, #P0044), and protease inhibitor cocktail (Millipore Sigma, #P8340) added to the provided Extraction Buffer for cell lysis. Cy3-streptavidin (ThermoFisher Scientific, #SA1010) was used as the detection antibody. The stained arrays were then imaged, quantified, and analyzed by Full Moon Biosystems. Resulting data displayed is the ratio analysis (ratio change, see description that follows) executed and described by the manufacturer: “For each spot on the array, Median Signal Intensity is extracted from array image. Average Signal Intensity of Replicate Spots is the mean value of Median Signal Intensityof the replicate spots for each antibody. Using the Average Signal Intensity of Replicate Spots, for each pair of site-specific antibody and phospho site-specific antibody, Signal Ratio of the paired antibodies is determined. Ratio = (Signal Intensity of Phospho Site-Specific Antibody) / (Signal Intensity of Site-Specific Antibody). Ratio change between samples = Treatment Sample / Control Sample.”

[0129] 2-HOBA treatment

[0130] Foxp3YFP~Cre; Trsp mice were provided 1.33 gL’12-hydroxybenzylamine acetate (TSI Group Co., Ltd) in the drinking water ad libitum from birth.

[0131] Protein extraction

[0132] After anti-CD3 / 28 stimulation, CD4+T cells were collected and centrifuged at 300 g for 5 minutes at 4° C. Cells were resuspended in RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, #89900) with 10 pLmL'1each of phosphatase inhibitor cocktail 2 (Millipore Sigma, #P5726), phosphatase inhibitor cocktail 3 (Millipore Sigma, #P0044), and protease inhibitor cocktail (Millipore Sigma, #P8340), incubated on ice for 10 minutes, and centrifuged at 16000 g for 10 minutes at 4° C. Supernatant protein concentrations were quantified with a BCA Protein Assay Kit (ThermoFisher Scientific, #23225) per manufacturer’s instructions.

[0133] WES™ Simple Western Analysis

[0134] Cell lysates at 0.5 pgpl’1were denatured at 95°C for 5 minutes and target proteins detected using an automated capillary-based immunodetection system (WES™ SimpleWestem, Biotechne, Minneapolis, MN) according to the manufacturer’s protocol (ProteinSimple, San Jose, CA). Primary antibodies against GPX4 (abeam, #ab 125066), TXNRD1 (abeam, #abl24954) and [J-actin (Millipore Sigma, #A5441) were diluted 1:25 in kit-supplied dilution buffer. Wes™ reagents (biotinylated molecular weight marker, streptavidin-HRP fluorescent standards, luminol-S, hydrogen peroxide, sample buffer, DTT, running buffer, wash buffer, matrix removal buffer, secondary antibodies, antibody diluent, and capillaries) were obtained from the manufacturer and used according to the manufacturer’s instructions in supplied partially pre-fdled microplates. “Virtual blots” electrophoretic images were automatically generated bythe Compass Software and data analysis was performed using the same software (ProteinSimple).

[0135] TCR activation Western blot

[0136] Lysates were diluted in 4X Laemmli Sample Buffer (Bio-Rad, #1610747) with 6% (v / v) 2-mercaptoethanol (Millipore Sigma, #M3148), then incubated at 95° C for 5 minutes.30 pg total protein was loaded into each lane of a 10-well 4-20% Mini-PROTEAN TGX Precast Protein Gel (Bio-Rad, #4561094), alongside Precision Plus Protein Dual Color Standards (BioRad, #1610374) for SDS-PAGE. Separated proteins were then transferred to a 0.45 µm nitrocellulose membrane (ThermoFisher Scientific, #LC2001), blocked with Intercept (TBS) Blocking Buffer (LLCOR, #927-60001) at room temperature for 30 minutes, then probed with primary antibodies diluted in 50% Intercept (TBS) Blocking Buffer / 50% TBS with 0.1% (v / v) Tween-20 (Millipore Sigma, P9416) (TBS-T) at 4°C overnight. Primary antibodies used included: rabbit anti-LCK (1:1000, Cell Signaling Technology, #2984), rabbit anti-pLCK (pTyr394) (1:1000, abeam, #ab318960), mouse anti-MEKl (1:2000, Cell Signaling Technology, #2352), rabbit anti-pMEKl (pSer298) (1:1000, Cell Signaling Technology, #9128), and as loading control rabbit anti-vinculin (1:1000, Cell Signaling Technology, #13901). Membranes were washed with TBS-T, then probed with IRDye 680LT goat anti-mouse IgG (1:10,000, LL COR, #92668020) and IRDye 800CW goat anti -rabbit IgG (1: 10,000, LLCOR, #92632211) secondary antibodies diluted in TBS-T at room temperature for 30 minutes. Membranes were washed again with TBS-T, imaged with an Odyssey Clx near-infrared fluorescence imaging system (LLCOR), and quantified with Image Studio (LLCOR). Densitometric values for proteins of interest were normalized to those of their corresponding loading controls.

[0137] Treg cell survival assay

[0138] Treg cells (Live CD4+FOXP3+ROSAldTomato+) were sorted from the spleen and mLN of tarn oxifen-treated mice. 4xl04cells were plated in each well of a round-bottom 96-well plate with human IL-2 (Biolegend or R& D Systems) at concentrations indicated in the figure legend. After 48 hours, CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7572) was performed according to manufacturer’s instruction, and results normalized to TCM only negative control.

[0139] Human thymus single cell RNA-seq analysis

[0140] A public single-cell RNA-seq dataset of human thymocytes31was manually transcribed from the web-based interface to Prism (Version 10.1.1).

[0141] TCR chain immunosequencing

[0142] Samples were enriched for CD4+T cells using negative selection as above. Cells were then stained and flow-sorted into PBS with 2% FBS and 0.025 M HEPES followed by DNA extraction using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany, #69504). TCR beta sequencing was performed by Adaptive Biotech using the immunoSEQ Assay. Raw data was analyzed using the immunoSEQ Analyzer 3.0 website(cli ents. adapti vebi otech. com / 1 ogin).

[0143] RNA isolation, cDNA synthesis, and RT-qPCR

[0144] RNA extraction from cells was performed using the RNeasy Mini Kit (Qiagen, #4304437). For low cell numbers the RNAeasy Micro Kit (Qiagen, #74004) was used, and cells were sorted directly into 300 µL RLT buffer (Qiagen, #79216) containing 2-mercapto-ethanol as recommended. On column DNAse treatment was performed as per manufacturer's recommendations. For cDNA synthesis, 5 µL RNA, 4 µL SuperScript IV VILO Master Mix (ThermoFisher Scientific, #11756050), and 11 µL water were combined in a PCR tube and incubated as follows: 1) at 25° C for 10 minutes, 2) at 50° C for 10 minutes, and 3) at 85° C for 5 minutes. Selenoprotein RT-qPCR was performed in technical duplicate using TaqMan™ probes described previously by our group30and TaqMan™ Universal PCR Master Mix (ThermoFisher Scientific, #4304437) on a QuantStudio3 (ThermoFisher Scientific). Selenoprotein RT-qPCR results were analyzed by the delta-delta Ct method and normalized to Tbp. For Lefl RT-qPCR, SYBR primers (Millipore Sigma) (5’ TGTTTATCCCATCACGGGTGG 3’ and 5’ CATGGAAGTGTCGCCTGACAG 3’) and PerfeCTa® SYBR® Green SuperMix ROX (Quantabio, #9505502K) were used. Lefl RT-qPCR results were normalized to Ubc (5’ GCCCAGTGTTACCACCAAGA 3’ and 5’ CCCATCACACCCAAGAACA 3’).

[0145] RNA isolation for sequencing

[0146] Quality control for RNA was performed by the Vanderbilt Technologies for Advanced Genomics core using RNA 6000 Pico (Agilent, Santa Clara, CA), and cDNA library preparation using a NEB library preparation kit. Paired end 150bp sequencing was performed on a NovaSeq 6000 (Illumina).

[0147] RNA-sequencing analysis (bulk)

[0148] Briefly, samples were trimmed with fastp (version 0.20.0) using default parameters. Quantification was performed using Salmon (version 1.4.0) against a decoy transcriptome (Mus musculus Gencode version 21). Further analysis was performed in R (version 4.1.2) in R studio (version 2021.09.2 + 382). For differential expression analysis, limma (version 3.50.3) was used on log-CPM transformed counts with prior count set to 3 or DESEq2 (version 1.34.0) was used on non-normalized counts.

[0149] T cell polarization

[0150] T cells were acquired from spleen and mLN of WT C57 / B16 mice using negative enrichment. T cells were then activated using 2pgmL’1plate-bound ocCD3 (ThermoFisher Scientific, #16-0031-86) and 1 pgmL’1soluble aCD28 (ThermoFisher Scientific, #16-0281-85) and the following cytokines: ThO: 20 ngmL’1IL-2 (Biolegend, #575406). Thl: 20 ngmL’1IL-2, 10 ngmL’1IL-12 (R& D Systems, #419-ML-010 / CF), and 2 pgmL’1aIL-4 (ThermoFisher Scientific, #16-7041-85). Th2: 20 ngmL’1IL-2, 10 ngmL’1IL-4 (R& D Systems, #404-ML-010 / CF), and 1 pgmL’1OIIFNY (ThermoFisher Scientific, #14-7311-85). Treg: 40 ngmL’1IL-2, 1 pgmL’1alFNyl, pgmL’1otIL-4, and 2 ngmL’1human TGF (R& D Systems, #240-B-002 / CF). Thl 7: 20 ngmL’1IL-6 (R& D Systems, #406-ML-005 / CF), 1 ngmL’1human TGFp, 1 pgmL’1aIL-12 (BD, #554475), 1 pgmL’1o. IFNy, and 1 pgmL’1aIL-4. ThO, Thl, Th2, and Treg cells were cultured in RPMI 1640, while Th 17 cells were cultured in IMDM (ThermoFisher Scientific, #12440079) base media. All T cell media contained 10% (v / v) heat-inactivated FBS, 100 unitsmL’1penicillin, 100 pgmL’1streptomycin, 1% (v / v) GlutaMax, 1% (v / v) MEM non-essential amino acids, 55 µM beta-mercaptoethanol, and 1 mM sodium pyruvate.

[0151] Quantification and statistical analysishttps: / / doi.org / 10.1038 / nri2232. Preprint, https: / / doi.org / 10.1038 / nri2232

[0152] Age-, sex- and, when feasible, littermate-matched mice were used for all experiments. Statistical analysis was performed using GraphPad Prism (9.1.2) unless otherwise described. Sample size was determined empirically. All data points are biological replicates, i.e. each datapoint represents one mouse, unless otherwise indicated, i.e. data from multiple mice were pooled. All figures represent similar results from at least three independent experiments unless otherwise indicated.References1. Zhang, M., Lin, X., Yang, Z., Li, X., Zhou, Z., Love, P. E., Huang, J., and Zhao, B. (2022).Metabolic regulation of T cell development. Front Immunol 13. https: / / doi.org / 10.3389 / fimmu.2022.946119.2. Wilfahrt. D., and Delgoffe. G. M. (2024). Metabolic waypoints during T cell differentiation.Preprint at Nature Research, https: / / doi.org / 10.1038 / s41590-023-01733-5https: / / doi.org / 10.1038 / s41590-023 -01733 -5.3. Ma, S., Ming, Y., Wu, J., and Cui, G. (2024). Cellular metabolism regulates the differentiation and function of T-cell subsets. Preprint at Springer Nature, https: / / doi.org / 10.1038 / s41423-024-01148- 8 https: / / doi.org / 10.1038 / s41423-024-01148-8.4. Bantug, G. R., Galluzzi, L., Kroemer, G., and Hess, C. (2018). Tire spectrum of T cell metabolism5. Chapman, N. M., Boothby, M. R.. and Chi, H. (2020). Metabolic coordination of T cell quiescence6. Shver, J. A., Flavell, R. A., and Bailis, W. (2020). Metabolic signaling in T cells. Cell Res 30, 649- 659. https: / / doi.org / 10.1038 / s41422-020-0379-5.7. Oliveira-Marques, V., Marinho, H. S., Cyme, L., and Antunes, F. (2009). Role ofHydrogen Peroxide in NF-KB Activation: From Inducer to Modulator. Antioxid Redox Signal 11, 2223- 2243. https: / / doi.org / 10.1089 / ars.2009.2601.8. Flescher, E., Ledbetter, J. A., Schieven, G. L., Vela-Roch, N., Fossum, D., Dang, H., Ogawa, N., and Talal, N. (1994). Longitudinal exposure of human T lymphocytes to weak oxidative stress suppresses transmembrane and nuclear signal transduction. The Journal of Immunology 153, 4880-4889. https: / / doi.org / 10.4049 / jimmunol.153.! 1.4880.9. Kryukov, G. V., Castellano, S., Novoselov, S. V., Lobanov, A. V., Zehtab, O., Guigo, R., and Gladyshev. V. N. (2003). Characterization of Mammalian Selenoproteomes. Science (1979) 300, 1439-1443. https: / / doi.org / 10.1126 / science.1083516.10. Brown, K., and Arthur, J. (2001). Selenium, selenoproteins and human health: a review. Public Health Nutr 4, 593-599. https: / / doi.org / 10.1079 / PHN2001143.11. Rae, I., Mathias, J. L., Dekker, R., Goodenough, N. Y., Dick, D. A., Lyons, J. S. B., Biol; Revel, J. E. J., Yancey, J. P., Nicholson, S. B., Hob, B., et al. (1985). Gene for a novel tRNA species that accepts L-serine and cotranslationally inserts selenocysteine.12. Carlson, B. A., Yoo, M. H., Shrimali, R. K., Irons, R., Gladyshev, V. N., Hatfield, D. L., and Park, J. M. (2010). Role of selenium-containing proteins in T-cell and macrophage function. In Proceedings of the Nutrition Society, pp. 300-310. https: / / doi.org / 10.1017 / S002966511000176X.13. Vindry, C., Guillin, O., Wolff, P., Marie, P., Mortreux, F., Mangeot, P. E., Ohlmann, T., and Chavatte, L. (2023). A homozygous mutation in the human selenocysteine tRNA gene impairshttps: / / doi.org / 10.1038 / nri2232. Preprint, https: / / doi.org / 10.1038 / nri2232UGA recoding activity and selenoproteome regulation by selenium. Nucleic Acids Res 51, 7580-7601. https: / / doi.org / 10.1093 / nar / gkad482.Geslot. A.. Savagner, F., and Caron, P. (2021). Inherited Selenocysteine Transfer RNA Mutation: Clinical and Hormonal Evaluation of 2 Patients. Eur Thyroid J 10, 542-547. https: / / doi.org / 10.1159 / 000518275.Schoenmakers, E., Carlson, B., Agostini, M., Moran, C., Rajanayagam, O., Bochukova, E., Tobe, R., Peat, R, Gevers, E., Muntoni, F., et al. (2016). Mutation in human selenocysteine transfer RNA selectively disrupts selenoprotein synthesis. J Clin Invest 126, 992-996. https: / / doi.org / 10.1172 / JCI84747.Bösl, M. R., Takaku, K., Oshima, M., Nishimura, S., and Taketo, M. M. (1997). Early embryonic lethality caused by targeted disruption of the mouse selenocysteine tRNA gene ( Trsp ).Proceedings of the National Academy of Sciences 94, 5531-5534.https: / / doi.org / 10.1073 / pnas.94.11.5531.Brigelius-Flohe, R., Muller, M., Lippmann, D., and Kipp, A. P. (2012). The Yin and Yang of Nrf2-Regulated Selenoproteins in Carcinogenesis. Int J Cell Biol 2012, 1-8. https: / / doi.org / 10.1155 / 2012 / 486147.Shrimali, R. K., Irons, R D., Carlson, B. A., Sano, Y., Gladyshev, V. N., Jin, M. P., and Hatfield, D. L. (2008). Selenoproteins mediate T cell immunity through an antioxidant mechanism. Journal of Biological Chemistry 283, 20181-20185. https: / / doi.org / 10.1074 / jbc. M802559200.Shyer, J. A., Flavcll, R. A., and Bailis, W. (2020). Metabolic signaling in T cells. Cell Res 30, 649-659. https: / / doi.org / 10.1038 / s41422-020-0379-5.Kaminski, M. M., Sauer, S. W., Klemke, C.-D., Suss, D., Okun, J. G., Krammer, P. H., and Giilow, K. (2010). Mitochondrial Reactive Oxygen Species Control T Cell Activation by Regulating IL-2 and IL-4 Expression: Mechanism of Ciprofloxacin-Mediated Immunosuppression. The Journal of Immunology 184, 4827-4841. https: / / doi.org / 10.4049 / jimmunol.0901662.Sena, L. A., Li, S., Jairaman, A., Prakriya, M., Ezponda, T., Hildeman, D. A., Wang, C. R., Schumacker, P. T., Licht, J. D., Perlman, H., et al. (2013). Mitochondria Are Required for Antigen-Specific T Cell Activation through Reactive Oxygen Species Signaling. Immunity 38, 225-236. https: / / doi.org / 10.1016 / j.immuni.2012.10.020.Kumaraswamy, E., Carlson, B. A., Morgan, F., Miyoshi, K., Robinson, G. W., Su, D., Wang, S., Southon, E., Tessarollo, L., Lee, B. J., et al. (2003). Selective Removal of the Selenocysteine tRNA[Ser]Sec Gene (Trsp) in Mouse Mammary Epithelium. Mol Cell Biol 23, 1477-1488. https: / / doi. org / 10.1128 / mcb.23.5.1477-1488.2003.Hatfield, D. L., and Gladyshev, V. N. (2002). How Selenium Has Altered Our Understanding of the Genetic Code UGA DICTATES Sec INCORPORATION INTO PROTEIN. Mol Cell Biol 22, 3565-3576. https: / / doi.org / 10.1128 / MCB.22.11.3565.Shrimali, R. K., Irons, R. D., Carlson, B. A., Sano, Y., Gladyshev, V. N., Jin, M. P., and Hatfield, D. L. (2008). Selenoproteins mediate T cell immunity through an antioxidant mechanism. Journal of Biological Chemistry 283. 20181-20185. https: / / doi.org / 10.1074 / jbc. M802559200.Ashby, K. M., and Hogquist, K. A. (2024). A guide to thymic selection of T cells. Preprint at Nature Research, https: / / doi.org / 10.1038 / s41577-023-00911-8 https: / / doi.org / 10.1038 / s41577-023-00911-8.Rothenberg, E. V., Moore, J. E., and Yui. M. A. (2008). Launching the T-cell-lineageOh, S., Liu, X., Tomei, S., Luo, M., Skinner, J. P., Berzins, S. P., Naik, S. H., Gray, D. H. D., and Chong, M. M. W. (2023). Distinct subpopulations of DN1 thymocytes exhibit preferential y5 T lineage potential. Front Immunol 14. https: / / doi.org / 10.3389 / fimmu.2023.1106652.Sasada, T., and Reinherz, E. L. (2001). A Critical Role for CD2 in Both Thymic Selection Events and Mature T Cell Function. The Journal of Immunology 166, 2394-2403.https: / / doi. org / 10.4049 / jimmunol.166.4.2394.Fehling, H. J., and Boehmer, H. von (1997). Early aP T cell development in the thymus of normal and genetically altered mice. Curr Opin Immunol 9, 263- 15. https: / / doi. org / https: / / doi.org / 10.1016 / S0952-7915(97)80146-X.Pilat, J. M., Brown, R. E., Chen, Z., Berle, N. J., Othon, A. P., Washington, M. K., Anant, S. A., Kurokawa. S., Ng, V. H., Thompson, J. J.. et al. (2023). SELENOP modifies sporadic colorectal carcinogenesis and WNT signaling activity through LRP5 / 6 interactions. Journal of Clinical Investigation 133. https: / / doi.org / 10.1172 / jci165988.Park, J. E., Botting, R. A, Conde, C D., Popescu, D M, Lavaert, M., Kunz, D. J., Goh, I., Stephenson, E., Ragazzini, R., Tuck, E., et al. (2020). A cell atlas of human thymic development defines T cell repertoire formation. Science (1979) 367. https: / / doi.org / 10.1126 / science.aay3224. Kannan, K., and Jain, S. K. (2000). Oxidative stress and apoptosis.Surh. C. D., and Sprent, J. (2000). Commentary Homeostatic T Cell Proliferation: How Far Can T Cells Be Activated to Self-Ligands?Powrie, F., Leach, M. W., Mauze, S., Caddie, L. B., and Coffman, R. L. (1993). Phenotypically distinct subsets of CD4 + T cells induce or protect from chronic intestinal inflammation in C. B-17 scid mice. Int Immunol 5, 1461-1471. https: / / doi. org / 10.1093 / intimm / 5.11.1461.Ross, S. H., and Cantrell, D. A. (2018). Signaling and Function of Interleukin-2 in T Lymphocytes. Annu Rev Immunol 36, 411-433. https: / / doi.org / 10.1146 / annurev-immunol-042617-053352. Sefik, E., Geva-Zatorsky, N., Oh, S., Konnikova, L., Zemmour, D., McGuire, A. M., Burzyn, D., Ortiz-Lopez, A., Lobcra, M., Yang, J., ct al. (2015). Individual intestinal symbionts induce a distinct population of R0Rgamma+ regulatory T cells. Science (1979) 349, 993-997. https: / / doi.org / 10.1126 / science.aaa9420.Yang, B. H., Hagemann, S., Mamareli, P., Lauer. U., Hoffmann, U., Beckstette, M., Fdhse. L., Prinz, L, Pezoldt, J., Suerbaum, S., et al. (2016). Foxp3+ T cells expressing RORyt represent a stable regulatory T-cell effector lineage with enhanced suppressive capacity during intestinal inflammation. Mucosal Immunol 9, 444-457. https: / / doi.org / 10.1038 / mi.2015.74.Brunkow, M. E., Jeffery, E. W., Hjerrild, K. A., Paeper, B., Clark, L. B., Yasayko, S. A., Wilkinson, J. E., Galas, D., Ziegler, S. F., and Ramsdell, F. (2001). Disruption of a new forkhead / winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy’ mouse. Nat Genet 27. 68-73. https: / / doi.org / 10.1038 / 83784.Goettel, J. A., Biswas, S., Lexmond, W. S., Yeste, A., Passerini, L., Patel, B., Yang, S., Sun, J., Ouahed, J.. Shouval, D. S., et al. (2015). Fatal autoimmunity in mice reconstituted with human hematopoietic stem cells encoding defective FOXP3. Blood 125, 3886-3895. https: / / doi.org / 10.1182 / blood-2014-12-618363.Xing, S., Gai, K., Li, X., Shao, P., Zeng, Z., Zhao, X., Zhao, X., Chen, X., Paradee, W. J., Meyerholz, D. K., et al. (2019). Tcfl and Lefl are required for the immunosuppressive function of regulatory T cells. J Exp Med, jem.20182010. https: / / doi.org / 10.1084 / jem.20182010.Zagol-Ikapitte, I., Amamath, V., Bala, M., Roberts, L. J., Oates, J. A., and Boutaud, O. (2010). Characterization of Scavengers of y-Ketoaldehydes That Do Not Inhibit Prostaglandin Biosynthesis. Chem Res Toxicol 23, 240-250. https: / / doi.org / 10.1021 / tx900407a.Rathmacher, J. A., Fuller, J. C., Abumrad. N. N., and Flynn, C. R. (2023). Inflammation Biomarker Response to Oral 2-Hydroxybenzylamine (2-HOBA) Acetate in Healthy Humans. Inflammation 46. 1343-1352. https: / / doi.org / 10.1007 / sl0753-023-01801-w.Zhou, X., Bailey-Bucktrout, S. L., Jeker, L. T., Penaranda, C., Martinez-Llordella, M., Ashby, M., Nakayama. M., Rosenthal, W., and Bluestone, J. A. (2009). bistability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo. Nat Immunol 10, 1000-1007. https: / / doi.org / 10.1038 / ni.1774.Li, X., and Zheng, Y. (2015). Regulatory T cell identity: Formation and maintenance. Trends Immunol 36, 344-353. https: / / doi. org / 10.1016 / j.it.2015.04.006.Fontenot, J. D., Rasmussen, J. P., Williams, L. M., Dooley, J. L., Farr, A. G., and Rudensky, A. Y. (2005). Regulatory T cell lineage specification by the forkhead transcription factor Foxp3.Immunity 22, 329-341. https: / / doi. org / 10.1016 / j.immuni.2005.01.016.Hori, S., Nomura, T., and Sakaguchi, S. (2003). Control of Regulatory T Cell Development by the Transcription Factor Foxp3. Science (1979) 299. 1057-1061.https: / / doi.org / 10.1126 / science.1079490.Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003). Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4, 330-336. https: / / doi.org / 10.1038 / ni904.Khattri, R., Cox, T., Yasayko, S. A., and Ramsdell, F. (2017). An essential role for Scurfin in CD4+CD25+T regulatory cells. Journal of Immunology 198, 993-998. https: / / doi.org / 10.1038 / ni909.Muri, J., Heer, S., Matsushita, M., Pohlmeier, L., Tortola, L., Fuhrer, T., Conrad, M., Zamboni, N., Kisielow, J., and Kopf. M. (2018). The thioredoxin-1 system is essential for fueling DNA synthesis during T-cell metabolic reprogramming and proliferation. Nat Commun 9. https: / / doi.org / 10.1038 / s41467-018-04274-w.Park, E. R., Eblen, S. T., and Catling, A. D. MEK1 activation by PAK: A novel mechanism.Hwang, J. R., Byeon, Y., Kim, D., and Park, S. G. (2020). Recent insights of T cell receptor-mediated signaling pathways for T cell activation and development. Preprint at Springer Nature, https: / / doi.org / 10.1038 / s12276-020-0435-8 https: / / doi.org / 10.1038 / s12276-020-0435-8.Yamaguchi, H., and Hendrickson, W. A. (1996). Structural basis for activation of human lymphocyte kinase Lck upon tyrosine phosphorylation. Nature 384, 484-489.https: / / doi.org / 10.1038 / 384484a0.Verma, S., Hoffmann, F. W., Kumar, M., Huang, Z., Roe, K., Nguyen-Wu, E., Hashimoto, A. S., and Hoffmann. P. R. (2011). Selenoprotein K Knockout Mice Exhibit Deficient Calcium Flux in Immune Cells and Impaired Immune Responses. The Journal of Immunology 186, 2127-2137. https: / / doi.org / 10.4049 / jimmunol.1002878.Wing, K., Onishi, Y., Prieto-Martin, P., Yamaguchi, T., Miyara, M., Fehervari, Z., Nomura, T., and Sakaguchi, S. (2008). CTLA-4 Control over Foxp3+Regulatory T Cell Function. Science (1979) 322, 271-275. https: / / doi.org / 10.1126 / science.1160062.Chinen, T., Kannan, A. K., Levine, A. G., Fan, X., Klein, U., Zheng, Y., Gasteiger, G., Feng, Y., Fontenot, J. D., and Rudensky, A. Y. (2016). An essential role for the IL-2 receptor in T reg cell function. Nat Immunol 17, 1322-1333. https: / / doi.org / 10.1038 / ni.3540.Kim, H. R.. Lee, A., Choi, E. J., Hong, M. P., Kie, J. H., Lim, W., Lee, H. K.. Moon, B. I.. and Seoh, J. Y. (2014). Reactive oxygen species prevent imiquimod-induced psoriatic dermatitis through enhancing regulatory T cell function. PLoS One 9. https: / / doi.org / 10.1371 / journal.pone.0091146. Ma, C., and Hoffmann, P. R. (2021). Selenoproteins as regulators of T cell proliferation, differentiation, and metabolism. Semin Cell Dev Biol 115, 54-61. https: / / doi. org / 10.1016 / j.semcdb.2020.11.006.Won, H. Y., Sohn, J. H., Min, H. J., Lee, K., Woo, H. A., Ho, Y. S., Park, J. W., Rhee, S. G., and Hwang, E. S. (2010). Glutathione peroxidase 1 deficiency attenuates allergen-induced airway inflammation by suppressing th2 and th 17 cell development. Antioxid Redox Signal 13, 575-587. https: / / doi.org / 10.1089 / ars.2009.2989.Ma, C., Hoffmann, F. W., Shay, A. E., Koo, L, Green, K. A., Green, W. R., and Hoffmann, P. R. (2024). Upregulated selenoprotein I during lipopolysaccharide -induced B cell activation promotes lipidomic changes and is required for effective differentiation into IgM-secreting plasma B cells. J Leukoc Biol 116, 6-17. https: / / doi.org / 10.1093 / jleuko / qiae024.Yim, S. H., Everley, R. A., Schildberg, F. A., Lee, S. G., Orsi, A., Barbati, Z. R., Karatepe, K., Fomenko, D. E., Tsuji, P. A., Luo, H. R., et al. (2018). Role of Selenof as a Gatekeeper of Secreted Disulfide-Rich Glycoproteins. Cell Rep 23, 1387-1398.https: / / doi.org / 10.1016 / j. celrep.2018.04.009.Zhumabekov, T., Corbella, P., Tolaini, M., and Kioussis, D. (1995). Improved version of a human CD2 minigene based vector for T cell-specific expression in transgenic mice. J Immunol Methods 185, 133-140. https: / / doi.org / 10.1016 / 0022-1759(95)00124-s.Aghajani, K., Keerthivasan, S., Yu, Y., and Gounari, F. (2012). Generation of CD4CreER(T2) transgenic mice to study development of peripheral CD4-T-cells. Genesis 50, 908-913. https: / / doi.org / 10.1002 / dvg.22052.Rubtsov, Y. P., Niec, R. E., Josefowicz, S., Li, L., Darce, J.. Mathis, D., Benoist, C., and Rudensky. A Y. (2010). Stability of the Regulatory T Cell Lineage in Vivo. Science (1979) 329, 1667-1671. https: / / doi.org / 10.1126 / science.1191996.Rubtsov, Y. P., Rasmussen, J. P., Chi, E. Y., Fontenot, J., Castelli, L., Ye, X., Treuting, P., Siewe, L., Roers, A., Henderson, W. R., et al. (2008). Regulatory T Cell-Derived Interleukin- 10 Limits Inflammation at Environmental Interfaces. Immunity 28. 546-558. https: / / doi. org / 10.1016 / j.immuni.2008.02.017.Madisen. L., Zwingman, T. A., Sunkin. S. M.. Oh, S. W., Zariwala, H. A., Gu, H., Ng, L. L., Palmiter, R. D., Hawrylycz, M. J., Jones, A. R., et al. (2010). A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci 13, 133-140. https: / / doi.org / 10.1038 / nn.2467.Rossi, M., Salomon, A., Chaumontel, N., Molet, J., Bailly, S., Tillet, E., and Bouvard, C. (2023). Warning regarding hematological toxicity of tamoxifen activated CreERT2 in young Rosa26CreERT2 mice. Sci Rep 13. https: / / doi.org / 10.1038 / s41598-023-32633-l.Godfrey, V. L., Wilkinson, J. E., and Russell. L. B. (1991). X-linked lymphoreticular disease in the scurfy (sf) mutant mouse. Am J Pathol 138, 1379-1387.Mombaerts, P.. lacomini, J., Johnson, R. S., Herrup, K., Tonegawa. S., and Papaioannou. V. E. (1992). RAG- 1 -deficient mice have no mature B and T lymphocytes. Cell 68, 869-877. https: / / doi.org / 10.1016 / 0092-8674(92)90030-g.Reinoso Webb, C, Den Bakker, H., Koboziev, L, Jones-Hall, Y., Rao Kottapalli, K., Ostanin, D., Furr, K. L., Mu, Q., Luo, X. M., and Grisham, M. B. (2018). Differential Susceptibility to T Cell-Induced Colitis in Mice: Role of the Intestinal Microbiota. Inflamm Bowel Dis 24, 361-379. https: / / doi.org / 10.1093 / ibd / izx014.Bankhead, P., Loughrey, M. B., Fernandez, J. A., Dombrowski, Y., McArt. D. G., Dunne, P. D., McQuaid, S., Gray, R. T., Murray, L. J., Coleman, H. G., et al. (2017). QuPath: Open source software for digital pathology image analysis. Sci Rep 7. 16878. https: / / ;doi.org / 10.1038 / s41598-017-17204-5.

Claims

CLAIMSWe claim:

1. A method of promoting T-cell function, comprising administering an effective amount of a compound of the following formula:wherein:R-2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

2. The method of claim 1, wherein the compound is chosen from 2-hydroxybenzyl amine, methyl-2-hydroxybenzylamine, or ethyl-2-hydroxybenzylamine.

3. The method of claim 1, wherein the compound is 2-hydroxybenzylamine acetate.

4. A method of modulating Treg cells, comprising administering an effective amount of a compound of the following formula:wherein:R.2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

5. The method of claim 4, wherein the compound is chosen from 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2-hydroxybenzylamine.

6. The method of claim 4, wherein the compound is 2-hydroxybenzylamine acetate.

7. A method of modulating selenoproteins, comprising administering an effective amount of a compound of the following formula:wherein:R-2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

7. The method of claim 7, wherein the compound is chosen from 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2-hydroxybenzylamine.

8. The method of claim 7, wherein the compound is 2-hydroxybenzylamine acetate.

9. A method of enhancing T-cell therapy, comprising administering an effective amount of a compound of the following formula:wherein:R-2 is independently H, substituted or unsubstituted alkyl;R3 is H, halogen, alkoxy, hydroxyl, nitro;R4 is H, substituted or unsubstituted alkyl, carboxyl; and pharmaceutically acceptable salts thereof.

10. The method of claim 9, wherein the compound is chosen from 2-hydroxybenzylamine, methyl-2-hydroxybenzylamine, or ethyl-2-hydroxybenzylamine.

11. The method of claim 9, wherein the compound is 2-hydroxybenzylamine acetate.

12. The method of claim 9, wherein the therapy is a cancer treatment.

13. The method of claim 9, wherein the therapy is treating an autoimmune disease.