Unlock instant, AI-driven research and patent intelligence for your innovation.

An Efficient Method for DNA Adapter Ligation

A technology of linker connection and DNA molecules, which is applied in the field of molecular biology, can solve the problem of unsatisfactory A addition efficiency and achieve the effect of increasing connection efficiency and improving construction efficiency

Active Publication Date: 2019-06-21
BEIJING TRANSGEN BIOTECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some scholars have developed or improved some DNA polymerases to increase the efficiency of dA tail addition (ENZYME COMPOSITION FOR DNA END REPAIR, ADENYLATION, PHOSPHORYLATION.United States Patent Application 20150087557; Thermostable Viral Polymerases and Methods of Use.United States Patent Application 20080268498), but Even when these enzymes are used under optimized reaction conditions, the efficiency of A addition is still not satisfactory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An Efficient Method for DNA Adapter Ligation
  • An Efficient Method for DNA Adapter Ligation
  • An Efficient Method for DNA Adapter Ligation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Verification that DNA plus A reaction products have different terminal structures.

[0041] 1. Amplify the DNA fragment and add 3'dA

[0042] Using λDNA as a template, primers were designed to amplify the target fragment with a length of 120bp. PCR primers are 5' phosphorylated primers with the following sequences:

[0043] 120bp Primer F: 5'-GAGGATGACTGCTGCTGC-3' (see the sequence listing SEQ ID No.1) 120bp Primer R: 5'-GGTATCCCAGGTGGCCTG-3' (see the sequence listing SEQ ID No.2) The PCR reaction system is as follows:

[0044]

[0045] The PCR reaction conditions are:

[0046]

[0047] After the PCR, 5 μl was taken and detected by 2.0% agarose gel electrophoresis. then use PCRPurification Kit purifies PCR products. Quantify with a spectrophotometer.

[0048] Next, add 3'dA to the PCR product, and the reaction system is as follows:

[0049]

[0050] then use PCR Purification Kit to purify PCR products. Quantify with a spectrophotometer.

...

Embodiment 2

[0083] Example 2: Compare the difference between the method introduced in the present invention and the library construction method using traditional linkers.

[0084] 1. Amplify the DNA fragment and add A

[0085] With step 1 in embodiment 1

[0086] 2. Preparation of Double-Stranded DNA Adapters

[0087] With step 3 in embodiment 1

[0088] 3. Preparation of Y-shaped structure DNA linker

[0089] Synthesize 1 single-stranded DNA with the following sequence:

[0090] Y Adapter Reverse:

[0091] CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGGCGTCAGTTT (see sequence listing SEQ ID No.9)

[0092] Anneal Adapter T Forward, Adapter C Forward, Adapter Blunt Forward and YAdapter Reverse respectively to construct 3 joints. The annealing reaction system is as follows:

[0093]

[0094] The annealing product condition is: 95°C for 5 minutes, slowly cooling to room temperature. Take 1 μl for detection by 2.0% agarose gel electrophoresis.

[0095] The products of the three annealing...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a high-efficiency method for linking a connector, the method comprising: using a type A DNA polymerase or a DNA polymerase Klenow fragment to process a DNA molecule so as to add a 3'dA protruding end; then linking the processed DNA molecule to a connector mixture to obtain a linking product, wherein the connector mixture comprises three kinds of double-strand DNA connectors, and the ends of the three double-strand DNA connectors are a blunt end, a 3'dT protruding end and a 3'dC protruding end respectively. The method may effectively improve the efficiency of linking a connector to DNA.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a method for constructing recombinant DNA, that is, an efficient method for connecting DNA joints. Background technique [0002] Linkers, which refer to chemically synthesized double-stranded DNA molecules, include three different types: blunt-end linkers, which have blunt ends at both ends; TA linkers, which have a blunt end at one end and a dT base protruding from the 3' end at the other end ; a sticky-end linker with a blunt end on one end and a sticky end on the other. Among them, sticky-end adapters can be ligated with restriction endonuclease-digested DNA molecules and used for library construction and other applications. [0003] Clark et al. (Clark JM.Novel non-templated nucleotide addition reactionscatalyzed by procaryotic and eucaryotic DNA polymerases.Nucleic AcidsRes.1988,16:9677–9686; Hu,G.DNA polymerase-catalyzed addition of nontemplatedextra nucleotide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10
CPCC12N15/10
Inventor 耿亮辛文
Owner BEIJING TRANSGEN BIOTECH CO LTD