High-efficiency method for ligating DNA (Deoxyribonucleic Acid) with adapters
A technology of linker connection and DNA molecules, which is applied in the field of molecular biology, can solve the problem of unsatisfactory A addition efficiency and achieve the effect of increasing connection efficiency and improving construction efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Verification that DNA plus A reaction products have different terminal structures.
[0041] 1. Amplify the DNA fragment and add 3'dA
[0042] Using λDNA as a template, primers were designed to amplify the target fragment with a length of 120bp. PCR primers are 5' phosphorylated primers with the following sequences:
[0043] 120bp Primer F: 5'-GAGGATGACTGCTGCTGC-3' (see the sequence listing SEQ ID No.1) 120bp Primer R: 5'-GGTATCCCAGGTGGCCTG-3' (see the sequence listing SEQ ID No.2) The PCR reaction system is as follows:
[0044]
[0045] The PCR reaction conditions are:
[0046]
[0047] After the PCR, 5 μl was taken and detected by 2.0% agarose gel electrophoresis. then use PCRPurification Kit purifies PCR products. Quantify with a spectrophotometer.
[0048] Next, add 3'dA to the PCR product, and the reaction system is as follows:
[0049]
[0050] then use PCR Purification Kit to purify PCR products. Quantify with a spectrophotometer.
...
Embodiment 2
[0083] Example 2: Compare the difference between the method introduced in the present invention and the library construction method using traditional linkers.
[0084] 1. Amplify the DNA fragment and add A
[0085] With step 1 in embodiment 1
[0086] 2. Preparation of Double-Stranded DNA Adapters
[0087] With step 3 in embodiment 1
[0088] 3. Preparation of Y-shaped structure DNA linker
[0089] Synthesize 1 single-stranded DNA with the following sequence:
[0090] Y Adapter Reverse:
[0091] CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGGCGTCAGTTT (see sequence listing SEQ ID No.9)
[0092] Anneal Adapter T Forward, Adapter C Forward, Adapter Blunt Forward and YAdapter Reverse respectively to construct 3 joints. The annealing reaction system is as follows:
[0093]
[0094] The annealing product condition is: 95°C for 5 minutes, slowly cooling to room temperature. Take 1 μl for detection by 2.0% agarose gel electrophoresis.
[0095] The products of the three annealing...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com