Application of a circular RNA molecule in the preparation of a drug for treating muscle damage

Abstract

The present invention relates to the use of a circular RNA molecule in the preparation of a drug for treating muscle injury, wherein the circular RNA molecule is circTXNIP, and its buffalo source sequence is shown in SEQ ID NO: 1. Overexpression of circTXNIP promotes the generation of circTXNIP-encoded peptides, thereby increasing the proliferation and differentiation of myoblasts; the circTXNIP forms a circTXNIP nucleic acid complex with liposomes as a component for preparing a drug for treating muscle injury. The circTXNIP-encoded peptide generated after the translation of the circTXNIP provided by the present invention can promote the repair of muscle injury, so circTXNIP is expected to be developed as a nucleic acid drug for the preparation of drugs for treating muscle injury, and can be used for treating muscle injury by local intramuscular injection.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of a circular RNA molecule in preparing a medicine for treating muscle damage. Background Art

[0002] Skeletal muscle is an indispensable tissue for living organisms, playing a vital role in movement, metabolism and homeostasis. Skeletal muscle development can be roughly divided into two stages: embryonic development and postnatal development. The number of muscle fibers increases rapidly during the embryonic period. Although the total number of muscle fibers remains basically unchanged after birth, the diameter of the muscle fibers will continue to increase to achieve the appropriate muscle volume. This continuous process is inseparable from the proliferation and differentiation of myoblasts.

[0003] In addition to being regulated by genes, signaling pathways, transcription factors, and miRNA, these processes are also regulated by circRNA. CircRNA is a circular endogenous RNA formed by connecting the 3' and 5' ends of linear RNA through alternative splicing. It is not easily degraded by nuclease exonucleases and has a more stable structure than linear RNA. Studies have shown that circRNA is a key regulator of gene expression in various physiological and pathological processes, and plays a unique role in regulating muscle development in humans and animals and related physiological and pathological processes. Due to the lack of the 5' cap and poly (A) tail required for translation, it was generally believed that circRNA was essentially non-coding circular RNA in the past, but in recent years, studies have found that circRNA with IRES (Internal ribosome entry site) sequence can produce polypeptides. Artificial circRNA can be effectively translated in an in vitro translation system to encode functional peptides in a manner independent of the 5' cap structure. In addition, the translation of circRNA with N6-methyladenosine (m6A) modification has been reported, which can replace IRES for translation initiation. The study found that CircZNF609 is one of the earliest reported circRNAs containing IRES and is translated into a protein that regulates the differentiation of muscle cells into muscle. The circular RNA CircFAM188B encodes a protein that regulates the proliferation and differentiation of chicken skeletal muscle satellite cells. These results show that circRNAs can regulate the muscle generation process by encoding polypeptides.

[0004] At present, muscle injuries mainly rely on the body's own repair mechanism. Clinically, muscle strains are mainly treated with rest and rest, and local physical therapy is the main method. Generally, cold compresses are applied first, and then local hot compresses are applied 24 hours later. Blood-activating and stasis-removing drugs, such as flurbiprofen cataplasm, Yunnan Baiyao aerosol, and swelling and pain aerosol spray, etc. can also be taken orally with Chinese patent medicines that activate blood circulation and remove blood stasis, such as blood-activating and analgesic capsules, Panax notoginseng powder or Panax notoginseng capsules, Hulisan capsules, etc. If the local swelling is particularly severe, drugs for swelling and dehydration can be used, such as intravenous infusion of mannitol. If nerves are damaged at the same time, oral drugs for nerve nutrition, such as methylcobalamin or vitamin B1, are required. After the injury, obvious pain will be caused, and non-steroidal anti-inflammatory analgesics need to be selected according to the degree of pain. If the pain is mild, celecoxib capsules can be selected for pain relief. If the pain is moderate, ibuprofen sustained-release capsules can be selected. If the injury is more serious and severe pain occurs, tramadol sustained-release tablets can be selected. Minor muscle injuries can be recovered in about two weeks, but severe muscle injuries will take a longer time to recover gradually.

[0005] These drugs have different effects on muscle injuries. After muscle injury, blood congestion and muscle tissue fragments will cause an inflammatory immune response in the body. Anti-inflammatory and analgesic drugs can effectively reduce the degree of inflammatory immune response and reduce the patient's pain, but they will prolong muscle repair time. Nerve-nourishing drugs such as methylcobalamin can effectively help reshape nerve cells in the muscle and promote muscle regeneration, but they cannot directly promote muscle regeneration. It can be seen that the drugs currently used in clinical practice do not have the function of directly promoting muscle tissue regeneration. Therapeutic drugs are mainly represented by auxiliary functions such as alleviating patient pain and providing nutrition, and mainly rely on the self-regeneration of human muscles to start the repair function.

[0006] Nucleic acid drugs can directly promote muscle cell proliferation and differentiation and promote muscle tissue regeneration, but there are currently no reports of nucleic acid drugs that can directly treat damaged muscles. Summary of the invention

[0007] To solve the above problems, the present invention provides an application of a circular RNA molecule in the preparation of a drug for treating muscle damage. The circTXNIP molecule provided by the present invention can be used as a nucleic acid drug and administered by local muscle injection, with rapid onset and rapid metabolism and high safety. The circTXNIP molecule can enter the muscle tissue and be translated into the circTXNIP encoding peptide, which directly promotes the proliferation and differentiation of muscle cells and promotes the regeneration of muscle tissue.

[0008] The present invention discloses an application of a circular RNA molecule in preparing a drug for treating muscle injury. The circular RNA molecule is circTXNIP, and its buffalo-derived sequence is shown in SEQ ID NO: 1. Overexpression of circTXNIP promotes the generation of circTXNIP-encoded peptides, thereby increasing the proliferation and differentiation of myoblasts.

[0009] Furthermore, the circTXNIP forms a circTXNIP nucleic acid complex with liposomes as a component for preparing a drug for treating muscle damage.

[0010] Furthermore, when the circTXNIP nucleic acid complex is used as a component for preparing a drug for treating muscle damage, the dosage per kilogram of damaged muscle is 300-1000 μg.

[0011] Furthermore, the medicine for treating muscle damage is an injection.

[0012] The medicine for treating muscle damage prepared by the present invention is locally injected into the damaged muscle site.

[0013] Furthermore, the mouse-derived DNA sequence used for linear expression of the circTXNIP encoding peptide is shown in SEQ ID NO:3.

[0014] Furthermore, the human DNA sequence used for linear expression of the circTXNIP encoding peptide is shown in SEQ ID NO:4.

[0015] Compared with the prior art, the present invention has the following beneficial effects in application:

[0016] 1. The TXNIP gene encodes thioredoxin binding protein, which is an interactive protein that binds to thioredoxin (TRX). Thioredoxin binding protein mediates biological regulatory effects such as oxidative stress, inducing cell apoptosis and inhibiting cell proliferation by inhibiting the function of thioredoxin. CircTXNIP is produced by shearing and cyclization of the TXNIP gene transcript, so the circTXNIP encoded peptide plays an important regulatory function on the proliferation and differentiation of myoblasts. The encoded polypeptide produced after the translation of circTXNIP provided by the present invention is abbreviated as circTXNIP-peptide, that is, circTXNIP encoded peptide. The circTXNIP encoded peptide can promote the repair of muscle damage, so circTXNIP is expected to be developed as a nucleic acid drug for the preparation of drugs for the treatment of muscle damage, and can be used for the treatment of muscle damage by local intramuscular injection.

[0017] 2. The present invention develops circTXNIP nucleic acid complexes into injections for injection into local muscles with muscle damage. The circTXNIP nucleic acid complexes can be translated into circTXNIP encoded peptides in the muscles, and then the circTXNIP encoded peptides significantly promote muscle fiber repair. Compared with the current clinical muscle injury medications (such as anti-inflammatory and analgesic drugs can effectively reduce the degree of inflammatory immune response and reduce patient pain, but will prolong muscle repair time; methylcobalamin and other nerve nutrition drugs can effectively help remodel nerve cells in muscles, but cannot directly promote muscle regeneration), circTXNIP nucleic acid complexes can directly and effectively promote the repair of damaged muscles, filling the gap in muscle injury treatment.

[0018] 3. The advantage of circTXNIP nucleic acid complex in repairing muscles is that, unlike traditional drugs that rely on their own slow repair mechanism, the circTXNIP encoded peptide can directly promote myoblast proliferation and differentiation. After injecting circTXNIP nucleic acid complex into the damaged muscle, the damaged muscle fibers started repairing faster than the control group. Normal muscle regeneration originally required more than 14 days. After 7 days of injection of circTXNIP nucleic acid complex, the inflammatory cell infiltration around the damaged site was significantly reduced compared with the control group, indicating that the muscle repair process was significantly accelerated and the muscle fiber integrity was better than the control group. Specifically, the distance between muscle bundles was reduced, the cross-sectional morphology of muscle fibers was regular, and the edges were clear and the structure was complete. These phenomena all indicate that the muscles are in a good repair process. Secondly, molecular detection of related gene expression also proved that circTXNIP nucleic acid complex significantly promoted the expression of genes related to muscle regeneration. This function of directly promoting muscle repair is not yet available in current clinical drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the expression detection results of circTXNIP coding peptide in myoblasts and muscle tissues;

[0020] Figure 2 To detect the efficiency of overexpressing circTXNIP in myoblasts;

[0021] Figure 3 To detect the efficiency of circTXNIP interference in myoblasts;

[0022] Figure 4 EdU was used to detect cell proliferation after overexpression of circTXNIP;

[0023] Figure 5 To detect cell proliferation by CCK8 after interfering with circTXNIP;

[0024] Figure 6To analyze the cell cycle changes of buffalo myoblasts overexpressing circTXNIP by flow cytometry;

[0025] Figure 7 To detect the expression of proliferation marker genes in buffalo myoblasts after overexpression of circTXNIP;

[0026] Figure 8 To interfere with circTXNIP buffalo myoblast proliferation gene qPCR detection;

[0027] Fig. 9 Statistics for myotube differentiation from myoblasts overexpressing circTXNIP;

[0028] Fig.10 Western blot detection of myoblast differentiation-related proteins overexpressing circTXNIP;

[0029] Fig.11 Establishment of a mouse tibialis anterior muscle injury model;

[0030] Fig.12 To detect the efficiency of overexpressing circ TXNIP in vivo;

[0031] Fig.13 To observe the repair process of tibialis anterior muscle by sectioning and HE staining;

[0032] Fig.14 qPCR was used to detect the expression of genes related to muscle regeneration;

[0033] Fig.15 Western blotting was used to detect the expression of muscle regeneration-related proteins;

[0034] Fig.16 Immunofluorescence detection and fluorescence intensity analysis of muscle injury sites overexpressing circTXNIP. DETAILED DESCRIPTION

[0035] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] Experimental materials and their sources:

[0037] (1) Two 4-5 month old young New Zealand white rabbits were purchased from a regular manufacturer and raised in the Rabbit Breeding Center of Guangxi University for the preparation of rabbit primary antibodies. 3-5 month old buffalo fetuses were obtained from a local slaughterhouse in Nanning for primary isolation of myoblasts. 4-week old SPF experimental mice of the C57BL / 6 strain were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd. and raised in the Mouse Breeding Center of the Guangxi University Experimental Base;

[0038] (2) pCD2.1 vector is the expression plasmid for this experiment; siRNA was designed and the sequence was synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. Primers were synthesized by Shanghai Shenggong Biotechnology Service Co., Ltd.;

[0039] (3) Antibodies used in this study and their catalog numbers: β-actin: 66009-1-Ig, CyclinD1: WL01435a, PCNA: WL03213, CDK2: 60312-1-Ig, MyoD: 18943-1-AP, MyoG:

[0040] 67082-1-Ig, MyHC: ab207926, TPM1: 28477-1-AP, SKP1: 10990-2-AP, PAX7: bs-2413R, HRP-labeled secondary antibody: Anti-Rabbit: SA00001-2, Anti-Mouse:

[0041] SA00001-1;

[0042] (4) Gel recovery kit was purchased from OMEGA, USA. EdU kit was purchased from Guangzhou Ruibo Biotechnology Co., Ltd. ECL ultrasensitive luminescent solution, Tween20 and skimmed milk powder were purchased from Beijing Solebow Technology Co., Ltd. T4 ligase and endonuclease were purchased from Thermo Company, USA;

[0043] CCK8 kit, cell transfection reagent and fluorescence quantitative PCR reagent were purchased from Nanjing Novozyme Biotechnology Co., Ltd. DAPI reagent, FITC fluorescent labeled secondary antibody and HRP labeled secondary antibody were purchased from Proteintech. 10x TBS stock solution, 10x PBS stock solution and 10x transfer solution stock solution were purchased from Shanghai Sangon Biotechnology Co., Ltd. Cell DMEM culture medium, fetal bovine serum and penicillin-streptomycin were purchased from Gibco, USA. In vivo transfection DNA reagent EntransterTM-invivo was purchased from Beijing EngreenBiosystem; Sakura brand OCT was purchased from Guangxi Zhuyan Biological Co., Ltd.; cardiotoxin was purchased from Shanghai Kemin Biotechnology Co., Ltd.; formalin solution was purchased from Shanghai Sangon Co., Ltd.; neutral gum, hematoxylin and eosin solution were purchased from Solebao; quantitative PCR reagents were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; adhesive slides were purchased from Zhongtai Company.

[0044] Example 1: Isolation and culture of primary buffalo muscle cells

[0045] (1) Carefully peel off the fetal membranes of the fetus sent from the slaughterhouse, and wipe and disinfect the skin surface with 75% alcohol;

[0046] (2) Use sterile ophthalmic scissors and forceps to peel off the skin and fascia and the longissimus dorsilumbar muscle;

[0047] (3) Transfer to 75% alcohol, then wash off the alcohol on the surface with PBS solution, and then transfer to 37°C preheated PBS solution containing 2× double antibody to fully soak;

[0048] (4) Rapidly transfer the removed fetal bovine longissimus dorsi muscle to a sterile cell culture room and use another set of sterilized ophthalmic scissors and forceps to remove the connective tissue and blood vessels between the muscles;

[0049] (5) Add an appropriate amount of 1× PBS and mince the muscle sample with sterile ophthalmic scissors until it becomes minced meat;

[0050] (6) Add 2–4 mL of collagenase II solution to the minced meat and digest at 37°C for 2 h.

[0051] (7) Centrifuge at 1,200 rpm / min for 5 min, discard the supernatant, add an appropriate amount of trypsin solution, and digest at 37°C for 30 min;

[0052] (8) After digestion, add the same volume of DMEM complete medium (DMEM plus 10% Gibco fetal bovine serum) to terminate trypsin activity;

[0053] (9) Gently use a pipette to blow away the tissue mass, first filter through a 100 μm cell sieve, then filter through a 70 μm cell sieve, and collect the filtered cell suspension;

[0054] (10) The cell suspension was centrifuged at 1,000 rpm / min for 5 min, the supernatant was discarded, the cells were washed twice with PBS solution, resuspended in complete culture medium and placed in a CO2 incubator for culture;

[0055] (11) After 1.5 hours, the non-adherent cells were removed and cultured in another dish and discarded. The adherent cells were muscle fibroblasts.

[0056] (12) Replace the medium with DMEM primary myoblast complete medium every 48 h until the cells grow to a density of about 80%, and then subculture or freeze the cells;

[0057] (13) When the cell confluence reached 75%, the growth medium was discarded and replaced with differentiation induction medium (DMEM containing 2% horse serum) to induce differentiation of the obtained myoblasts.

[0058] Example 2: Amplification of the full length of circTXNIP by PCR and sequencing of its nucleotide sequence

[0059] 1. Total RNA Extraction

[0060] First, the myoblasts obtained by separation and differentiation in Example 1 were digested with trypsin, washed twice with PBS solution, collected after centrifugation, and added with 1 mL of Trizol lysis solution and placed on ice. The extraction steps after adding Trizol lysis solution are as follows:

[0061] (1) Use a vortexer to evenly distribute the cells in the lysis buffer and lyse on ice for 10 min;

[0062] (2) Then, 200 μl of chloroform was added, shaken, and placed on ice for 10 min;

[0063] (3) Centrifuge at 4°C, 12,000 rpm / min for 10 min and carefully aspirate the colorless supernatant;

[0064] (4) Add an equal volume of pre-cooled methanol solution, mix by inversion, centrifuge at 12,000 rpm / min at 4°C for 15 min, and discard the solution;

[0065] (5) Wash the RNA precipitate with 75% ethanol solution prepared with pre-cooled RNase-free water, then centrifuge and discard the liquid;

[0066] (6) After the ethanol in the RNA evaporates, add an appropriate amount of RNase-free water to dissolve the RNA.

[0067] 2. cDNA Synthesis

[0068] (1) Removal of genomic DNA: Add the following liquids to an RNase-free PCR tube: template RNA (total RNA amount is 1 pg-1 μg), 4x gDNA wiper Mix 4 μL, RNase-free ddH 2 O to 16 μL, mix well; PCR instrument 42°C, 2 min;

[0069] (2) Prepare the reverse transcription reaction system: directly add 4 μL of 5xHisScriptqRT SuperMix to the centrifuge tube used in the first step and mix well;

[0070] (3) Perform reverse transcription reaction: 37°C, 15 min; 85°C, 5 s. The obtained buffalo myoblast cDNA is stored in a -20°C refrigerator.

[0071] 3. PCR amplification of the full length of circTXNIP

[0072] PCR amplification was performed using buffalo myoblast cDNA as template. Primers used:

[0073] circTXNIP-clone-F:5′-AGATTAACATCCATGCTG-3′

[0074] circTXNIP-clone-R:5′-CATCACCTTCACAGAATC-3′

[0075] PCR amplification was performed according to the instructions of 2x Taq PCR Mastermix, and the obtained product was detected using agarose gel, and the band with the same size as the target gene was cut out for gel recovery, and the recovered product was sent to Shanghai Bioengineering for Sanger sequencing. The sequencing results showed that the full-length sequence of circTXNIP was 360bp, and its RNA sequence was shown in SEQ ID NO:1.

[0076] Example 3: Identification of circTXNIP-encoded peptides

[0077] 1. Antigen design and antibody preparation

[0078] The open reading frame (ORF) of the full-length sequence of circTXNIP was found using ORF Finder and translated into an amino acid sequence named circTXNIP-peptide (circTXNIP-encoded peptide). The sequence information is shown in SEQ ID NO: 2. The antigen epitope of the circTXNIP-encoded peptide recognized by B cells was predicted based on a neural network algorithm using an online website with the following parameters: ABCpred, Threshold>0.8, length=16aa. The amino acid sequence of the antigen epitope with the highest score at the N-terminus was determined as KAAIVARHTYLANGQT, which was commissioned to be synthesized by Hangzhou Special Peptide Biological Co., Ltd.;

[0079] After the synthesized antigen peptide was fully mixed and emulsified with the immune adjuvant, young rabbits were immunized. The immunization procedure was: the first immunization (10 mg of antigen mixed with complete Freund's adjuvant, multiple subcutaneous injections on the back), and three booster immunizations (5 mg of antigen mixed with incomplete Freund's adjuvant, multiple subcutaneous injections on the back). The interval between the two immunizations was 10 days. After the immunization, the rabbit antibody serum was collected for subsequent experiments.

[0080] 2. Immunofluorescence

[0081] The buffalo proliferating and differentiating myoblasts obtained in Example 1 were collected, rinsed with PBS three times, fixed with 4% paraformaldehyde for 30 minutes, rinsed with PBS three times; treated with 0.1% Triton X-100 for 30 minutes, washed with PBS three times; blocked with 2% goat serum for 1 hour, covered with diluted circTXNIP encoding peptide antibody, and incubated at 4°C overnight. After discarding the primary antibody, wash with PBS, add diluted green fluorescent secondary antibody, and incubate at room temperature in the dark for 1 hour; after washing with PBS, incubate with DAPI solution at room temperature for 15 minutes; finally, wash three times with PBS and observe with a fluorescence microscope. Figure 1 As shown in A, the cell nucleus is blue after being stained with DAPI; the green fluorescence of the cytoplasm is the signal for the detection of the circTXNIP encoding peptide. The immunofluorescence test simultaneously detected the cell samples of myoblast proliferation and myoblast differentiation. The results showed that the circTXNIP encoding peptide fluorescence signal was detected in both the myoblast proliferation and differentiation stages, and it was mainly distributed in the cytoplasm. The immunofluorescence test proved that the circTXNIP encoding peptide was stably expressed in the cytoplasm of myoblast proliferation and myoblast differentiation, indicating that it has important biological significance for the normal proliferation and differentiation process of myoblasts.

[0082] 3. Protein Extraction and Western Blotting

[0083] Proteins in myoblasts or buffalo muscle tissue samples were extracted using RIPA lysis buffer containing 1% PMSF. Protein concentration was determined using a BCA kit, followed by separation of proteins using 10% SDS-polyacrylamide gel electrophoresis and transfer to NC membranes; after incubation with specific primary antibodies and corresponding secondary antibodies, the images were exposed and analyzed using the ChemiDoc XRS+ system. Figure 1 As shown in B, Western Blotting assay detected that the molecular weight of circTXNIP-peptide in buffalo muscle tissue was between 40-55 kDa, which was consistent with the predicted theoretical size of 51 kDa;

[0084] The identification of the circTXNIP-encoded peptide showed that the circTXNIP-encoded peptide existed in buffalo myoblasts and buffalo muscle tissue, and was involved in the regulation of buffalo muscle development.

[0085] Example 4: Construction of circTXNIP overexpression vector and interfering RNA

[0086] 1. Construction of circTXNIP overexpression vector

[0087] Design the full-length sequence primers of circTXNIP, and add protection bases and restriction sites to the upstream and downstream primers. The primer sequences are: (the underlined part is the restriction site):

[0088] pCD2.1-circTXNIP-F:GGGGTACCAGATTAACATCCATGCTG;

[0089] pCD2.1-circTXNIP-R:CATCACCTTCACAGAATCGGATCCCG;

[0090] Using buffalo cell cDNA as a template, PCR amplified and cloned the full length of circTXNIP. The amplified full length sequence of circTXNIP was connected to the pCD2.1 vector to obtain the overexpression vector pCD2.1-circTXNIP.

[0091] 2. Synthesis of interference fragments

[0092] Based on the full-length sequence of circTXNIP, its interference fragment was designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. with the sequence: ATACTCCTTACTGGAACCT.

[0093] Example 5: Detection of the effects of overexpression and interference of circTXNIP on the proliferation ability of buffalo myoblasts

[0094] 1. Transfection of buffalo myoblasts with circTXNIP overexpression vector and interference vector

[0095] According to the test requirements, buffalo myoblasts were inoculated into cell culture dishes. When the cell density reached 70%, the overexpression plasmid pCD2.1-circTXNIP and the interference fragment si-circTXNIP (pCD2.1 plasmid and si-NC were controls, respectively) were transfected into the buffalo myoblasts according to the instructions of the transfection reagent, and the expression of circTXNIP in the cells after overexpression and interference was detected to determine the effect of overexpression and interference. Figure 2 As shown in the figure, the expression of circTXNIP in myoblasts was detected by qPCR. In the figure, pCD2.1 is the control group myoblasts transfected with an empty vector plasmid, and the circTXNIP group is the myoblasts transfected with the overexpression plasmid pCD2.1-circTXNIP. The relative expression of circTXNIP in the circTXNIP group was significantly increased by about 7 times compared with the pCD2.1 group (p<0.01), indicating that the overexpression plasmid pCD2.1-circTXNIP can significantly increase the expression of circTXNIP in buffalo myoblasts. Detection of interference fragments is shown in Figure 1. Figure 3As shown, after transfection of circTXNIP interference fragment, circTXNIP expression was inhibited, and qPCR detection detected that circTXNIP expression level was significantly downregulated to about half of the control group, indicating that transfection of circTXNIP interference fragment can significantly inhibit circTXNIP expression (p<0.01).

[0096] 2. EdU detection of cell proliferation

[0097] Buffalo myoblasts were cultured in 96-well plates until the cell confluence reached 65%, and the pCD2.1-circTXNIP plasmid was transfected into the cells using a liposome transfection reagent. After transfection, the cell confluence reached about 70% and the transfected cells had obvious green fluorescence.

[0098] EdU labeling: dilute the EdU reagent with DMEM complete medium at a ratio of 1 / 1000 to prepare a cell culture medium containing 10 μM final concentration of EdU. Add 100 μL of EdU culture medium to each well of a 96-well plate, incubate for 6 hours, discard the culture medium, and wash with PBS solution 2 to 3 times, 3 minutes each time.

[0099] Cell fixation: Add 50 μL of PBS cell fixative containing 4% paraformaldehyde to each well, fix at room temperature for 30 minutes and then discard the fixative. Then add 50 μL of 2 mg / mL glycine solution to each well, incubate on a shaker at room temperature for 5 minutes, and then remove the glycine solution. Use 100 μL of PBS to each well, wash on a shaker for 3 minutes and then discard the PBS solution. Add 100 μL of permeabilization agent (0.5% TritonX-100 in PBS) to each well and incubate for 10 minutes, discard the liquid and wash once with PBS.

[0100] Apollo staining: Add 100 μL of Apollo staining solution prepared according to the instructions to each well, incubate at room temperature in the dark for 30 minutes, and then discard the staining reaction solution. Add 100 μL of PBS containing 0.5% TritonX-100 to each well and wash the cells 4 to 5 times, each time for 5 minutes.

[0101] Finally, perform cell nucleus staining: add 100 μL Hoechst staining solution to each well, incubate at room temperature in the dark for 10 minutes, and then wash with PBS three times, 3 minutes each time. After washing, add appropriate amount of PBS and take pictures under a fluorescence microscope for analysis. Figure 4 As shown, 4A is an EdU positive myoblast staining image, in which pCD2.1 is the control group, and the circTXNIP group is the experimental group overexpressing the circTXNIP encoding peptide. All cell nuclei are stained with Hochest, and the replicated cell nuclei are stained with EdU dye. Finally, the percentage of EdU stained nuclei in the total cell nuclei is counted in the superposition figure to obtain the proportion of replicated cells. Figure 4 The number of bright spots in the cell nucleus in A is the number of positively stained cells. Figure 4 B is the statistical result of EdU positive cells. It can be seen from the result that the proportion of EdU positive cells in the circTXNIP group overexpressing circTXNIP was significantly higher than that in the pCD2.1 control group (p<0.05), indicating that circTXNIP significantly promoted the proliferation of myoblasts.

[0102] 3. CCK8 detection of cell proliferation

[0103] Buffalo myoblasts were cultured in 96-well plates until the cell confluence reached 60%, and si-circTXNIP was transfected into buffalo myoblasts by transfection reagent to interfere with circTXNIP expression, so as to achieve the effect of reducing the expression of circTXNIP. 24h after transfection, when the cell confluence reached about 70%, new complete medium was replaced with 100μL per well, 10μCCK-8 dye was added, and incubated for 2h. When the orange-yellow formazan dye color was visible to the naked eye, the absorbance was measured at a wavelength of 450nm using a multifunctional microplate reader, and the percentage of proliferating cells was calculated. The calculation formula is: Cell proliferation percentage = [(AC) / (BC)]×100%, where the letters mean A: absorbance of the experimental group (absorbance of the medium, cells, test substance and CCK-8 dye) B: absorbance of the control group (absorbance of the medium, cells, CCK-8 dye) C: absorbance of the blank group (absorbance of the medium and CCK-8 dye). Through calculation and statistical analysis, the results of CCK8 detection of buffalo myoblast proliferation are as follows Figure 5 As shown, the cell proliferation rate in the circTXNIP interference group was significantly reduced by about 12% compared with the control group (p<0.001). This indicates that the proliferation activity of buffalo myoblasts in the circTXNIP interference group was significantly inhibited, and the expression of circTXNIP is indispensable for the proliferation of buffalo myoblasts.

[0104] 4. Flow cytometry analysis of cell cycle

[0105] Buffalo myoblasts were cultured in 60 mm dishes until the cell confluence reached 65%, and the pCD2.1-circTXNIP overexpression plasmid was transfected into the cells for expression using a transfection reagent. After transfection, the cells were digested with trypsin and harvested for cell cycle analysis when the cell confluence reached about 75%. The harvested cells were washed twice with PBS, centrifuged at 1,000 rpm / min for 5 minutes, and the supernatant was discarded. The cells were then resuspended in a PBS solution containing 75% ethanol precooled at -20°C on a vortexer, and the cells were fixed at -20°C overnight. The fixed cells were centrifuged to remove the ethanol solution and then washed twice with PBS solution. FxCycleTM PI / NnaseStaining Solution was added and the cells were incubated at room temperature in the dark for 30 minutes. The cell cycle was then analyzed by flow cytometry (Thermo, AttuneNxT), and the instrument analysis parameters were set as follows: FSC-100V; SSC-300V; flow rate 12.5μL / min; single cell recording 10,000; threshold FSC-25^1e3. The generated data were analyzed by FlowJo 10 software to analyze the proportion of each cell cycle.

[0106] The results of flow cytometry analysis of cell cycle Figure 6 As shown, the proportion of cells in each period was analyzed by PI staining combined with flow cytometry. In the figure, 2N, S, and 4N correspond to the interphase, S phase, and mid- and late phase of cell division. Figure 6 It can be seen intuitively in A that the S phase proportion of the circTXNIP overexpression group was 38.9%, which was higher than 25.4% of the pCD2.1 control group, indicating that circTXNIP may increase the proportion of buffalo myoblasts in the proliferation phase. Further, the results of the cell cycle statistical analysis are shown in Figure 6 As shown in B, the proportion of cells in the 2N phase was significantly lower than that in the control group (p<0.05), and the proportion of cells in the S phase in the circTXNIP group was higher than that in the pCD2.1 control group, but the difference was not significant (p>0.05). These results indicate that circTXNIP acts on buffalo myoblasts, causing more buffalo myoblasts to be in the cell proliferation cycle, thereby accelerating the proliferation process of buffalo myoblasts.

[0107] 5. qPCR and Western blotting assays to detect the regulatory effects of overexpression and interference of circTXNIP on gene expression in buffalo myoblasts

[0108] According to the method of Example 2, total RNA of buffalo myoblasts was extracted, reverse transcription was performed using a reverse transcription kit, and RNA was reverse transcribed into cDNA. The expression changes of buffalo myoblast proliferation-related genes PCNA, CyclinD1 and CDK2 at the RNA level were detected by qPCR technology. At the same time, intracellular proteins were extracted according to the method of Example 3, and the expression changes of circTXNIP and buffalo myoblast proliferation-related genes PCNA, cyclinD1 and CDK2 at the protein level were detected by western blotting technology.

[0109] like Figure 7 As shown in the figure, after buffalo myoblasts overexpressed circTXNIP, the transcription and protein expression of buffalo myoblast proliferation marker genes were detected. Figure 7 A shows the expression changes of PCNA, CyclinD1 and CDK2 at the transcriptional level. The figure shows that the PCNA and CDK2 gene expressions in the circTXNIP overexpression group were significantly higher than those in the control group. Figure 7 B is the protein immunoblotting technique to detect the expression of proliferation-related gene proteins. The results show that PCNA, CyclinD1 and CircTXNIP-pep proteins are significantly higher than those in the control group, indicating that overexpression of circTXNIP in buffalo myoblasts significantly promotes the expression of PCNA and CyclinD1 proteins. CircTXNIP-pep protein is encoded by circTXNIP, and its increase in the circTXNIP overexpression group also proves that as circTXNIP expression increases, its encoded protein also increases accordingly, which once again confirms that circTXNIP can encode polypeptides.

[0110] In contrast, interference with circTXNIP downregulated the relative expression of myoblast proliferation genes. Figure 8 As shown in the figure, qPCR detected that the expression of CyclinD1 and PCNA genes was significantly downregulated in the circTXNIP interference group (p<0.05), while the expression of CDK2 gene was reduced but the difference was not significant. Figure 7 The results showed that circTXNIP promoted the proliferation of buffalo myoblasts. The proliferation genes of buffalo myoblasts were significantly inhibited by interfering with circTXNIP, resulting in a slower cell proliferation rate.

[0111] Example 6: Detection of the effect of overexpression of circTXNIP on the differentiation ability of buffalo myoblasts

[0112] 1. Cell transfection and differentiation induction

[0113] Buffalo skeletal muscle satellite cells were inoculated into different types of culture dishes and cultured until the cell density reached more than 60%. According to the instructions of the transfection reagent, the pCD2.1-circTXNIP overexpression plasmid and the pCD2.1 control plasmid were transfected into buffalo myoblasts. After transfection, the cells were cultured continuously until the cell density reached about 75%, and then 2% horse serum DMEM was used to induce differentiation.

[0114] 2. Differentiation Myotube Statistics

[0115] The method for counting the total number of myotubes is as follows: First, 20 different fields of view were taken for each of the two groups of cells under a quadruple microscope, and fusion myotubes with obvious refractive index were found by magnification, and the numbers were marked and counted on the graph using Image J software. After statistics, the total number of myotubes in different fields of view was analyzed ( Fig. 9 B), and then the graph was drawn using Graphpad software. Statistics of the number of myotube fusion cells: After immunofluorescence staining, 30 images were taken for each group, and the number of cell nuclei in each myotube in each group was counted ( Fig. 9 C) Fig. 9 A shows two groups of immunofluorescence-stained myotubes and fused myotubes with obvious refractive index under a four-fold microscope, wherein the immunofluorescence staining method is consistent with that in Example 3, the myotubes show green fluorescence after staining, and the cell nuclei show blue fluorescence after staining, and the immunofluorescence staining is used to clearly distinguish the outline of the myotubes from the cell nuclei in the myotubes for the convenience of statistical analysis.

[0116] In order to quantify the differentiation level of muscle cells, the present invention counted the total number of myotubes in the field of view of a four-fold microscope and the number of cell nuclei in a single myotube stained by immunofluorescence. Fig. 9 B is the statistical result of the number of myotubes. It can be seen from the figure that the number of myotubes in the circTXNIP overexpression group was significantly higher than that in the control group under a quadruple microscope (p<0.05). Fig. 9 Figure C shows the statistics of the number of myotube fusion cells. The statistical results show that the number of myotube fusion cell nuclei in the circTXNIP overexpression group increased significantly, indicating that circTXNIP promoted myoblast fusion and accelerated the differentiation of myoblasts into myotubes.

[0117] 3. Western Blot

[0118] Buffalo myoblasts differentiated for 5 days were collected, proteins were extracted, and Western blotting was used to detect the expression changes of myogenic differentiation-related genes MyoD1, MyoG and MyHC at the protein level ( Fig.10 In the state of myoblast differentiation, we used Western blotting to detect whether circTXNIP has a regulatory effect on the expression of myoblast differentiation-related proteins. Fig.10As shown in the figure, the expression of MyoD protein was significantly upregulated, while the expression of MyoG and Myhc was not significantly different. This indicates that circTXNIP mainly promotes the fusion of myoblasts to form myotubes and promotes the myogenic differentiation of buffalo myoblasts by upregulating the expression of MyoD protein.

[0119] Example 7: Effect of overexpression of circTXNIP on muscle damage in mice

[0120] 1. Construction of muscle injury model

[0121] Five-week-old C57 / 6J mice (n=50) were used to construct a muscle injury model. 50 μL of 10 μM cardiotoxin was injected into the tibialis anterior muscle of the left leg, and 50 μL of 5% glucose solution was injected into the tibialis anterior muscle of the right leg as a control. Three mice were killed 24 hours after the injection, and the tibialis anterior muscles of the left and right legs were stripped and fixed with neutral formalin solution for 24 hours, and then dehydrated with 10%, 20%, and 30% sucrose solutions in turn. After OCT embedding, frozen sections and HE staining were used to observe muscle damage ( Fig.11 ) to determine whether the muscle injury model was successfully established.

[0122] In order to observe the regulatory function of circTXNIP-encoded peptide on muscle development in vivo, a muscle injury model was first established by injecting CTX at multiple points in the tibialis anterior muscle of mice, and the tibialis anterior muscle of the model mice was sampled 48 hours after injection. Fig.11 After HE staining, the muscle injury model group can be observed to have obvious damage to the muscle fibers at the injection site, accompanied by many inflammatory cell infiltrations (the cells scattered between the muscle bundles are deeply stained with hematoxylin in the figure). In the control group, the muscle fiber structure is intact and tight, with normal muscle morphology and no inflammatory cells, indicating that the rat tibialis anterior muscle injury model was successfully established by intramuscular injection of CTX.

[0123] 2. Overexpression of circTXNIP in vivo

[0124] After confirming that the muscle injury model was successfully constructed, an in vivo transfection test was performed according to the instructions of the EntransterTM-in vivo kit. After evaluation, it was theoretically possible to use the buffalo-derived circTXNIP constructed in Example 2 and liposomes to form a circTXNIP nucleic acid complex as an overexpression plasmid for treating muscle injury in mice. Therefore, the pCD2.1-circTXNIP and pCD2.1-CIR transfection complex constructed in Example 2 were injected into the injured part of the tibialis anterior muscle of mice, once a week, and a total of 3 injections of the transfection reagent and plasmid complex.

[0125] By overexpressing circTXNIP in the injured tibialis anterior muscle, the regulatory function of circTXNIP on muscle regeneration in vivo was observed. Fig.12 As shown in the figure, after overexpression of circTXNIP, the expression level of circTXNIP increased by more than 400 times compared with the control group, indicating that in vivo transfection of circTXNIP nucleic acid complex can significantly increase the expression level of circTXNIP.

[0126] 3. Detection of the effect of overexpression of circTXNIP on muscle damage and repair in mice

[0127] The muscle repair was observed by collecting samples for frozen section and HE staining ( Fig.13 ). The same method as that at the cell level was used to extract muscle tissue RNA and protein, and qPCR was used to detect changes in the expression of muscle regeneration-related genes at the RNA level ( Fig.14 ). WB method was used to detect the expression changes of muscle regeneration-related genes at the protein level ( Fig.15 ). Immunofluorescence method was used to quantify protein expression by fluorescence intensity, and to observe changes in tissue morphology and the specific expression sites of proteins in tissues ( Fig.16 ).

[0128] like Fig.13 As shown in the figure, muscle bundles gradually repaired with the time of overexpression of circTXNIP. After 7 days of overexpression, the muscle fibers in the circTXNIP group showed certain signs of muscle repair by sectioning and HE staining, while the control group pCD2.1 was more severely damaged and no obvious repair was observed. After 21 days of overexpression, the muscle bundles in the circTXNIP group had a better repair effect, while the pCD2.1 control group had some repair, but many muscle bundles still showed irregular circles. This shows that circTXNIP can continuously promote muscle repair in vivo and accelerate muscle regeneration after injury.

[0129] like Fig.14 As shown in the figure, the qPCR detection results of muscle regeneration-related gene expression. In the circTXNIP overexpression group for 14 days, the expression of proliferation and differentiation genes generally increased, among which CDK2, cyclinD1 and MyoD were significantly upregulated. This shows that circTXNIP in vivo promotes muscle repair by upregulating the expression of muscle cell-related genes.

[0130] like Fig.15 As shown, the expression of muscle regeneration-related proteins was detected by Western blotting. Fig.15The darker the protein band, the higher the protein expression. It can be seen that the circTXNIP-peptide group significantly upregulated the expression of PAX7 protein, indicating that muscle satellite cells were activated from a resting state and began to proliferate in large numbers to supplement the missing muscle cells. In addition, the upregulation of cyclinD1, PCNA and CDK2 protein expression showed that the circTXNIP-peptide group significantly promoted the cell proliferation process. Proliferating muscle cells cannot directly play the physiological function of muscles. Muscle cells further differentiate into myotubes to form muscle fibers to restore the ability of muscle contraction. The increase in the expression of MyoD, MyoG and MyHC indicates that a large number of proliferating muscle cells subsequently fuse and differentiate. Completing this stage means that muscle repair is nearing the end. The circTXNIP group promoted the expression of MyoD, MyoG and MyHC proteins, indicating that circTXNIP accelerated the repair of muscle damage by increasing the expression of muscle regeneration-related proteins.

[0131] like Fig.16 As shown in the figure, the fluorescence staining and statistical analysis results show that the fluorescence staining of PAX7 in the figure shows that there is a strong fluorescence signal around the muscle bundles in the circTXNIP group, and muscle satellite cells are often attached to the muscle bundles. If the muscle is damaged, it will activate proliferation. Therefore, the muscle satellite cells activated in the circTXNIP group express a large amount of PAX7 protein, resulting in a strong fluorescence signal around the muscle bundles. After immunofluorescence staining, the average fluorescence intensity was calculated using Image J. From the statistical results, it can be seen that PAX7, cyclinD1 and MyoD proteins are significantly upregulated. The expression of these muscle regeneration-related proteins promotes muscle damage repair.

[0132] In summary, in addition, since the circTXNIP encoding peptide can be applied to the treatment of human skeletal muscle injury in theory, the present invention provides a sequence that can be used for linear expression of circTXNIP encoding peptide in mice and humans based on the experimental results obtained above. These two sequences can be connected to a eukaryotic linear expression vector, mixed with a transfection reagent to form a nucleic acid complex and injected into skeletal muscle to express the amino acid sequence of the circTXNIP encoding peptide. The DNA sequence for linear expression of circTXNIP encoding peptide in mouse skeletal muscle is shown in SEQ ID NO: 3, and the DNA sequence for linear expression of circTXNIP encoding peptide in human skeletal muscle is shown in SEQ ID NO: 4.

[0133] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of a circular RNA molecule in the preparation of a drug for treating muscle damage in buffaloes and mice, characterized in that: The circular RNA molecule is circTXNIP, and its sequence is shown in SEQ ID NO:

1. Overexpression of circTXNIP promotes the production of circTXNIP-encoded peptides, thereby increasing the proliferation and differentiation of myoblasts.

2. The use of the circular RNA molecule according to claim 1 in the preparation of a drug for treating muscle damage in buffaloes and mice, characterized in that: The circTXNIP and liposome form a circTXNIP nucleic acid complex as a component for preparing a drug for treating muscle damage.

3. The use of the circular RNA molecule according to claim 2 in the preparation of a drug for treating muscle damage in buffaloes and mice, characterized in that: When the circTXNIP nucleic acid complex is used as a component for preparing a drug for treating muscle damage, the dosage per kilogram of damaged muscle is 300-1000 μg.

4. The use of the circular RNA molecule according to claim 1 in the preparation of a drug for treating muscle damage in buffaloes and mice, characterized in that: The medicine for treating muscle damage is an injection.

5. The use of the circular RNA molecule according to claim 1 in the preparation of a drug for treating muscle damage in buffaloes and mice, characterized in that: The mouse-derived DNA sequence used for linear expression of the circTXNIP encoding peptide is shown in SEQ ID NO:

3.

6. The use of the circular RNA molecule according to claim 1 in the preparation of a drug for treating muscle damage in buffaloes and mice, characterized in that: The human DNA sequence used for linear expression of the circTXNIP encoding peptide is shown in SEQ ID NO:4.

Images