Wheat stem rot resistance gene TaHSP18.6, its expression product, recombinant vector and application

Abstract

The present application discloses a wheat stem rot resistance gene TaHSP18.6 The invention discloses and confirms a new wheat stem rot resistance gene for the first time. TaHSP18.6 , as shown in SEQ ID NO.2, its length is 537bp; its amino acid sequence is shown in the sequence table SEQ ID NO.3, its length is 178; a specific primer pair for identifying the gene is provided; a silencing vector, a plant expression vector and a recombinant bacterium are constructed based on the above gene, and applied to the verification of the gene's resistance to stem base rot. TaHSP18.6 The identification, isolation and application of the gene will not only help reveal the molecular regulatory pathways involved in disease resistance genes, but also accelerate the progress of wheat stem rot resistance breeding.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and specifically to a wheat stem rot resistance gene. TaHSP18.6 , its expression products, recombinant vectors and applications. Background Art

[0002] Wheat is an important food crop in my country and plays a pivotal role in the national economy. In recent years, wheat crown rot (Fusarium crown rot, FCR) has been seriously developed. During the occurrence of this disease, it not only causes serious yield losses and economic losses to wheat, but also produces a variety of toxins and secondary metabolites, which seriously affect the health of humans and animals. It has been called the "wheat cancer" of the new era. At present, no varieties that are highly resistant or immune to wheat crown rot have been identified at home and abroad, and there are very few resistance genes reported. Therefore, screening disease-resistant resources for wheat crown rot and exploring disease-resistant genes are of great significance to controlling the occurrence and spread of the disease.

[0003] Wheat stem rot is a potential soil-borne disease controlled by micro-effect polygenes. Current research on wheat stem rot focuses on material resistance identification and preliminary gene positioning. Ma et al. (2010) used the CSCR6 / Lang RIL population to detect a significant QTL on 3B in a greenhouse experiment of stem rot. The site originated from CSCR6, with an LOD value of 10.8 and a phenotypic variation rate of 49%. Subsequent verification in the RIL population showed that the QTL could reduce the severity of FCR by 33%. At present, 14 of the 21 chromosomes of hexaploid wheat have been reported to contain QTLs for wheat stem rot resistance (Liu et al., 2015; Yang et al., 2019). Among these QTLs, the sites that can be repeatedly detected are located on chromosomes 2DL, 3BL, 4B and 5DS, respectively, with the largest effect on 3BL. Yang et al. found that TaDIR-B1 can significantly negatively regulate wheat stem rot resistance, and its functional loss enhances wheat FCR resistance. Knocking out the receptor kinase TaCRK-7A increases wheat's sensitivity to FCR, thereby reducing the expression level of defense genes in wheat (Wu et al., 2021). Identifying and isolating disease resistance genes and breeding for disease resistance are the most economical, effective and environmentally friendly approaches among various measures for wheat disease prevention and control.

[0004] At present, there are only a few reports on the cloning of wheat stem rot resistance genes. In the study of wheat stem rot, discovering and utilizing excellent disease-resistant genes and exploring the regulatory pathways involved in disease-resistant genes have important guiding significance for wheat disease-resistant breeding and yield increase.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] The present application provides a wheat stem rot resistance gene TaHSP18.6 , its expression products, recombinant vectors and applications are intended to solve the technical problem of the lack of wheat stem rot resistance genes, so as to provide more options for wheat disease-resistant breeding and stem rot prevention and control.

[0007] According to one aspect of the present disclosure, a wheat stem rot resistance gene is screened and obtained. TaHSP18.6, The genomic nucleotide sequence is shown in the sequence table SEQ ID NO.1; the full-length CDS nucleotide sequence is:

[0008] (1) the nucleotide sequence shown in SEQ ID NO.2;

[0009] (2) Nucleotide sequences with equivalent functions derived from the nucleotide sequence defined by SEQ ID NO.2, including those with more than 80% homology to the sequence of SEQ ID NO.2 and encoding proteins related to controlling wheat grain size.

[0010] According to another aspect of the present disclosure, a wheat stem rot resistance gene is provided. TaHSP18.6 The amino acid sequence of the encoded protein is:

[0011] (1) the amino acid sequence shown in SEQ ID NO.3;

[0012] (2) A translatable fragment or conservative variant obtained by deleting, adding or replacing one or more amino acids based on the amino acid sequence defined in SEQ ID NO.3.

[0013] According to another aspect of the present disclosure, a primer pair for amplifying the above gene is provided, and its full nucleotide sequence is as follows:

[0014] TaHSP18.6 -1F: 5'- ATGGCCGAGCTGCTGTTCG-3';

[0015] TaHSP18.6 -1R:5'-CAGGCGATGGCGACCTGG-3'.

[0016] According to another aspect of the present disclosure, there is provided a wheat stem rot resistance gene TaHSP18.6Silencing recombinant vectors, linearized plasmids, in vitro transcribed single-stranded RNA or virus-induced gene silencing (VIGS) positive silenced plants, etc.

[0017] In some embodiments of the present disclosure, a specific DNA fragment from position 1 to 180 from the 5' end of the sequence shown in SEQ ID NO.2 is inserted between the Pacl and Notl double restriction sites of the BSMV-γ-PDS vector to obtain a VIGS silencing recombinant vector.

[0018] In some embodiments of the present disclosure, the wheat stem rot resistance gene TaHSP18.6 By restriction enzyme B H and SacI Inserted into the LGY-OE3 plant overexpression vector to form a recombinant overexpression vector.

[0019] Carrying the above TaHSP18.6 The expression vector can be used to transform plant cells or tissues through conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants; the transformed host can be either monocotyledonous plants or dicotyledonous plants.

[0020] According to another aspect of the present disclosure, the wheat stem rot resistance gene TaHSP18.6 Or the recombinant vector is used in the breeding of wheat varieties / lines resistant to stem rot.

[0021] According to another aspect of the present disclosure, the wheat stem rot resistance gene TaHSP18.6 Used to regulate the antioxidant capacity of plants.

[0022] According to another aspect of the present disclosure, the wheat stem rot resistance gene TaHSP18.6 Or the protein is used in preventing and treating wheat stem base rot.

[0023] According to another aspect of the present disclosure, a method for improving wheat resistance to stem base rot is provided, wherein the wheat stem base rot resistance gene TaHSP18.6 Upregulated expression in wheat plants.

[0024] One or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:

[0025] 1. A new wheat stem rot resistance gene was first published and confirmed, named TaHSP18.6 , which can regulate wheat stem rot.

[0026] 2. Identification of wheat stem rot resistance genes TaHSP18.6 The genomic nucleotide sequence, CDS sequence and encoded protein sequence lay the foundation for the application practice of wheat disease resistance breeding.

[0027] 3. First use of VIGS technology to identify wheat stem rot resistance genes TaHSP18.6 Silencing was performed, confirming its involvement in regulating wheat stem base rot.

[0028] 4. The first use of the Agrobacterium-mediated transformation system will carry the present application TaHSP18.6 The plant expression vector was transformed into wheat embryos, confirming TaHSP18.6 Its role in wheat stem rot resistance breeding.

[0029] 5. It helps to reveal the molecular genetic basis of wheat stem rot and plays an important role in improving wheat quality and breeding disease-resistant wheat varieties using genetic engineering technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 In the VIGS test in one embodiment of the present application TaHSP18.6 Comparison of the relative expression levels of genes in plants with different treatments.

[0031] Figure 2 This is a comparison chart of the resistance of wheat to stem base disease in different treatments in the VIGS test in one embodiment of the present application.

[0032] Figure 3 This is a statistical diagram of the disease index of stem base disease of wheat with different treatments and a comparison of DAB staining in an embodiment of the present application in a VIGS test.

[0033] Figure 4 In one embodiment of this application TaHSP18.6 Relative expression levels in its overexpression lines (OE#2, OE#3 and OE#4) and the control Fielder.

[0034] Figure 5 This is a comparison of the resistance of the overexpression strains (OE#2, OE#3 and OE#4) and the control Fielder to wheat stem rot in an example of the present application.

[0035] Figure 6 This is a comparison chart of the disease index statistics and DAB staining of wheat stem rot of the overexpression strains (OE#2, OE#3 and OE#4) and the control Fielder in one embodiment of the present application. DETAILED DESCRIPTION

[0036] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0037] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; the reagents, carriers and other test materials involved are all commercially available conventional products unless otherwise specified; the test methods, detection methods, etc. involved are all conventional methods unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0038] Example 1: Wheat stem rot resistance gene TaHSP18.6 Acquisition

[0039] The discovery of wheat stem rot resistance genes was carried out through transcriptome sequencing, as follows:

[0040] 1. Test strains and test soil: The strain used in the test is Pseudomonas graminearum WZ-8A, which is the dominant pathogen currently prevalent in the Huanghuai wheat region, with significant characteristics such as wide infection range and strong pathogenicity. The soil used in the test is medium-fertile loam. Before using the soil, weeds and large clods were removed with a purpose sieve, and sterilized in a sterilizer at 121℃, 0.1Mpa for 1h for use.

[0041] 2. Test culture medium: PDA culture medium and millet culture medium. PDA culture medium: Select fresh potatoes of appropriate size, peel them and cut them into medium-thin pieces. Weigh 200g of thin pieces and put them into a pot. Add distilled water and boil for about 20 minutes. Filter through four layers of gauze. Return the filtrate to the pot and continue heating. Add 15g agar powder and 20g glucose in turn. Stir evenly and make the volume to 1000 mL. After cooling, divide it into packages, wrap it, and sterilize it with wet heat at 121℃ and 0.1 Mpa for 20 minutes. Millet culture medium: Select millet of uniform size, put it into boiling water and boil it for 3 minutes, then pour it out, rinse it with cold water, and spread it on clean gauze and dry it in a ventilated place until there is no water on the surface. After drying, divide it into 150 mL triangular bottles and tie the bottle mouth. Sterilize it with wet heat at 121℃ and 0.1 Mpa for 30 minutes.

[0042] 3. Pathogen propagation: Take out the preserved Pseudomonas graminearum and activate it on PDA culture medium. When propagating, pick healthy and vigorous fungus blocks with hyphae from the edge of the newly activated Pseudomonas graminearum PDA culture plate and inoculate them into sterilized millet culture medium for culture at 25℃ for 7 days.

[0043] 4. Material inoculation, culture and sampling: refer to the method of Yang (2019). 150g sterile soil was weighed into a 7cm * 7cm small square box, 12 grains of wheat variety Nongyou 9 were evenly placed on the surface, and 20g of soil was covered. Each treatment was repeated three times, and the tray was placed, the bottom was watered thoroughly, and it was placed in an incubator with 16h / 8h, 25℃ / 15℃, and 60-80% humidity. 3 days after seedlings, weak seedlings were removed, 0.4g of infected millet was inoculated into the box, and the small box was evenly spread to ensure that there was a millet fungus at the base of each wheat seedling. The culture conditions were the same as before, and water was applied once every 2d. The stem base was quickly sampled at 0h, 24h, 48h, 72h, and 96h after the infection, and was quickly frozen in liquid nitrogen and placed at -80℃ for use. The stem base material stored at -80℃ was used for RNA extraction.

[0044] 5. Discovery of genes associated with wheat stem rot resistance

[0045] The Illumina DNBSEQ-T7 platform was used to study the transcriptome of wheat stem bases at different inoculation time points. A total of 132,570 transcripts were identified at the transcriptional level, involving 11,2964 genes. Based on the |log2FC|>1 and FDR<0.05 standards, 0h was used as the control, and the differentially expressed genes at the four inoculation time points of 24h, 48h, 72h, and 96h were analyzed, and a total of 53 genes were identified.

[0046] Ten candidate genes were selected for fluorescence quantitative expression verification, and the results showed that 6 of them responded to wheat stem rot at the RNA level at the four inoculation time points of 24h, 48h, 72h, and 96h. TaHSP18.6 , Chinese Spring Accession No.: TraesCS6B02G374100), this gene belongs to the HSPs family. As a chaperone protein, plant HSPs play a vital role in biotic and abiotic stress resistance. HSPs also enhance plant immunity by accumulating and stabilizing pathogen-related proteins under various biotic stresses. However, no relevant function of this gene has been reported. Therefore, it was cloned as the target gene.

[0047] Based on the published Chinese Spring reference sequence, the TaHSP18.6 After cloning, a complete open reading frame was finally obtained.

[0048] ① DNA extraction: The SLS method was used to extract DNA of Nongyou 9 seedlings.

[0049] ② Total RNA extraction and synthesis of the first chain of cDNA: TRIZOL reagent was used to extract total RNA of Nongyou No. 9 seedlings. Total RNA that met the quality requirements was taken and the first chain of cDNA was synthesized according to PrimeScript TM The first-chain cDNA was synthesized according to the instructions of RT Reagent Kit (perfect Real time).

[0050] ③ TaHSP18.6 Gene cloning and sequence analysis: design of PCR primers, TaHSP18.6 -1F and TaHSP18.6 -1R is designed at both ends of the start codon ATG and the stop codon TAA, respectively, as follows:

[0051] TaHSP18.6 -1F:5'- ATGTCTGTCCCGCGTCCATTG-3';

[0052] TaHSP18.6 -1R:5'-CTAGGTGCATGCTGAGTGTG-3'.

[0053] Using the DNA of Nongyou No. 9 as a template, TaHSP18.6 -1F and TaHSP18.6 -1R primer pair for PCR amplification. PCR reaction solution (50 μl system): 10×PCR Buffer (25 μl), ddH2O (9 μl), dNTP (10 μl), TaHSP18.6 -1F (1.5 μl), TaHSP18.6 -1R (1.5 μl), DNA (2 μl), TaKaRa LA Taq enzyme (1 μl); PCR parameters: 94°C for 4 min; then 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, for a total of 35 cycles; then 72°C for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis, recovered, ligated to the PMD18-T vector (TAKARA), and sent to Bioengineering for sequencing.

[0054] A similar method was used to use the cDNA of Nongyou 9 as a template. TaHSP18.6 -1F and TaHSP18.6 -1R primer pair was used for PCR amplification; the PCR reaction system and parameters were the same as above. After gel running and recovery, the fragments were connected to the PMD18-T vector (TAKARA) and sent to Bioengineering for sequencing.

[0055] The sequencing results showed that the DNA fragment obtained by PCR amplification using the DNA of wheat Nongyou 9 as a template was TaHSP18.6The genomic level sequence of the gene is shown in the sequence listing SEQ ID NO.1, which is 652bp in length and contains 2 exons and 1 intron; its CDS nucleotide sequence is shown in SEQ ID NO.2, which is 537bp in length and encodes an amino acid sequence as shown in the sequence listing SEQ ID NO.3, with 178 amino acids.

[0056] Embodiment 2: TaHSP18.6 VIGS silencing and identification

[0057] 1. TaHSP18.6 Construction of recombinant silencing vector

[0058] Select the specific DNA fragment with a length of 180 bp from the 1st to 180th position of the 5' end of the sequence of SEQ ID NO.2, according to TaHSP18 .6 cDNA sequence to design appropriate primers, add Pacl and Notl restriction sites and protective bases before the 5' end of the primers, the primer sequences are as follows:

[0059] TaHSP18.6 -2F: 5'-CCTTAATTAAATGGCCGAGCTGCTGTTC-3',

[0060] TaHSP18.6 -2R: 5'-ATGCGGCCCGCCACGGGCGCGCCGCCGC-3'.

[0061] The cDNA of Zhengmai 9023, a highly susceptible variety to wheat and barley stripe mosaic virus (BSMV), was used as a template for PCR amplification and the product was recovered for later use. TaHSP18.6 The silencing fragment was inserted into the double restriction site of the BSMV phytoene desaturase (PDS) vector (BSMV-γ-PDS) between the Pacl and Notl double restriction sites to construct a recombinant silencing vector named γ- TaHSP18.6 .

[0062] 2. Vector Linearization and In Vitro Transcription

[0063] The viral vectors (α, β, γ, γ-PDS) and γ- TaHSP18.6 Linearization was performed using RiboMAX TM The Large Scale RNA Production Systems-T7 Kit was used to perform in vitro transcription on the five linearized plasmids mentioned above to obtain in vitro transcribed single-stranded RNA of different components. PDS / γ- TaHSP18.6 2.5 μL of in vitro transcription products of each strain were mixed at a ratio of 1:1:1, diluted with an equal volume of DEPC-treated water, and the mixture was added to 270 μL of the prepared FES buffer to prepare 285 μL of the inoculated virus mixture, and then the Zhengmai 9023 seedlings were inoculated with BSMV virus. Four different treatments were set up in each experiment: wild-type control (Wild-type, WT), VIGS empty vector control (BSMV0: α+β+γ), PDS positive control (BSMV PDS :α+β+γ- PDS ) and gene silencing group (BSMV TaHSP18.6 :α+β+γ- TaHSP18.6 ).

[0064] 3. Virus Inoculation

[0065] Virus inoculation was performed when the wheat seedlings had 2 leaves and 1 heart. Before inoculation, spray a little DEPC-treated water on the leaves, then take 8-10μL of the inoculated virus mixture and apply it to the index finger wearing a latex glove, gently touch it with the thumb, and then rub the second leaf of the seedling 3 times. When rubbing from the base of the leaf to the tip of the leaf, a slight squeaking sound can be heard. After inoculation, spray a little DEPC-treated water, maintain the room temperature at 23±2˚C, keep moist and avoid light for 24 hours, and then culture with a normal 16 / 8h light and dark cycle. Observe the phenotype regularly and record it.

[0066] 4. VIGS silencing efficiency evaluation

[0067] Two weeks after inoculation, the gene silencing efficiency was identified using fluorescence quantitative technology. The extraction of total RNA and the inversion of cDNA were the same as in Example 1.

[0068] against TaHSP18.6 The specific primers for fluorescence quantitative analysis were designed based on the gene sequence as follows:

[0069] TaHSP18.6 -3F: 5'- ACGTGCTGGTGAATGAAGAGC -3';

[0070] TaHSP18.6 -3R: 5'-CCCAACAGCGTGCTACATTC-3'.

[0071] Selection of internal reference genes β -actin (GenBank accession no. AB181991), the primer sequences are as follows:

[0072] β -actin-F:GTTCCAATCTATGAGGGATACACGC;

[0073] β -actin-R:GAACCTCCACTGAGAACAACATTACC.

[0074] Fluorescence quantification was performed using the Bio-Rad IQ5 Real-Time PCR Detection System (USA). A 20 μL reaction system included 0.4 μL of upstream and downstream primers, 10 μL of Go Taq® qPCR Master Mix (Perfect Real Time; Promega), and 7.2 μL of nuclease-free water. PCR program: 95°C for 3 min, 95°C for 5 s, 60°C for 30 s, 72°C for 30 s, and 40 cycles. TaHSP18.6 -3F and TaHSP18.6 -3R primers, with WT plants as the control, using 2 -△△CT Gene detection TaHSP18.6 In BSMV0 plants, BSMV TaHSP18.6 The relative expression levels in the plants were Figure 1 As shown in the figure, compared with WT and BSMV0, TaHSP18.6 It was significantly down-regulated in silenced plants and the gene was effectively silenced.

[0075] Embodiment three: TaHSP18.6 VIGS phenotypic identification

[0076] Continuing with Example 2, the plant phenotype was investigated 2 weeks after inoculation. The VIGS silenced plants and the control group were taken out of the culture box, the base of the plants were washed with water, and the disease occurrence degree of the plants was counted according to the disease level classification method of Smiley et al. (2005b), and the disease index was calculated. The results are shown in Figure 2. Figure 2 and Figure 3 As shown in A. Figure 2 It can be seen that compared with the wild type, TaHSP18.6 The browning of the stem base of the silenced plants increased and their resistance decreased; Figure 3 As we know, TaHSP18.6 The disease index of the silenced plant (DI=59) was significantly higher than that of the wild type (DI=48), and the disease resistance of the plant was significantly reduced.

[0077] Studies have shown that HSPs improve membrane stability and detoxify reactive oxygen species (ROS) by positively regulating the antioxidant enzyme system. It is speculated that the disease resistance function of HSPs may be related to the ROS pathway, so the DAB method was used to detect the activity of peroxidase in VIGS silenced plants and the control group. When peroxidase is present, DAB will be converted into water-insoluble dark brown particles by H2O2. The DAB staining method is as follows: add 20 mg of DAB and 38 ml of ddH2O to a 50 ml centrifuge tube, and adjust the pH to 0.2M HCl to dissolve DAB to prepare a DAB dye solution with a final concentration of 0.5 mg / ml. Invade the isolated leaves of each component in DAB. Vacuum for 30 minutes to completely immerse the leaves in the DAB dye solution, and incubate at room temperature overnight. Decolorize with 95% ethanol in an 80-degree water bath, and take pictures of the leaves. Each component is repeated 6 times. Results Figure 3 As shown in B. From 3B, we can see that TaHSP18.6 The browning of silenced plants was enhanced, indicating that the antioxidant capacity of the plants was significantly reduced.

[0078] Embodiment 4: TaHSP18.6 Acquisition and Identification of Transgenic Wheat

[0079] 1. TaHSP18.6 Construction of plant overexpression vector

[0080] According to the cloned TaHSP18.6 Primers were designed based on the full-length cDNA sequence of the PCR product, and restriction endonuclease BamHI and SacI recognition sites and protective bases were introduced at both ends of the primers. The primer sequences are as follows:

[0081] TaHSP18.6 -4F:5'- CGGGATCCATGTTGGAGAAAGACAGGAT -3';

[0082] TaHSP18.6 -4F: 5'- CGGAGCTCTCAATGTCCGCCGTCATCAT -3'.

[0083] The expression vector LGY-OE3 was selected, and the 537 bp DNA fragment was cloned into the restriction sites BamHI and SacI of the plant expression vector LGY-OE3 to obtain a wheat TaHSP18.6 The recombinant expression vector of the gene was named LGY-OE3- TaHSP18.6 .

[0084] 2. TaHSP18.6 Obtaining genetically modified wheat

[0085] LGY-OE3- TaHSP18.6The immature embryo callus of wheat Fielder was transformed by Agrobacterium infection, and transgenic wheat plants were obtained through screening, pre-differentiation and differentiation.

[0086] 3. PCR Identification of Transgenic Wheat

[0087] The T1 transgenic plants were positively identified using the hygromycin tag (Hyg) primers Hyg-F and Hyg-R. The primer sequences are as follows:

[0088] Hyg-F: 5'-TCTGCACCATCGTCAACCAC-3';

[0089] Hyg-R: 5'-AAACCCACGTCATGCCAGTT-3'.

[0090] A total of 12 positive transgenic plants were obtained. After additional generations, T2 generation homozygous transgenic lines OE#1, OE#2 and OE#3 were obtained.

[0091] 4. Expression identification of transgenic wheat

[0092] Fluorescence quantitative analysis was performed on transgenic lines OE#1, OE#2, OE#3 and Fielder; total RNA extraction and cDNA inversion were the same as in Example 1. The fluorescence quantitative PCR reaction system and method were the same as in Example 2. TaHSP18.6 -3F and TaHSP18.6 -3R primer, with Fielder as control, using 2 -△△CT Gene detection TaHSP18.6 The expression level in the leaves of T2 positive transgenic lines was as follows. Figure 4 As shown. Figure 4 It can be seen that TaHSP18. The expression level of 6 in the leaves of T2 generation positive transgenic lines (OE#2, OE#3 and OE#4) was significantly higher than that of the control, which was 7, 5 and 10 times that of the control, respectively.

[0093] Embodiment five: TaHSP18.6 Phenotypic Identification of Transgenic Wheat

[0094] The above T2 generation overexpression transgenic lines (OE#2, OE#3 and OE#4) and the control Fielder were tested for stem base rot resistance and DAB antioxidant capacity, as in Example 2; the results are as follows: Figure 5 and Figure 6 shown.

[0095] Depend on Figure 5 It can be seen that compared with the wild type, TaHSP18.6 The browning of the stem base of the silenced plants was weakened and the resistance was enhanced.

[0096] Depend on Figure 6 A shows that the disease index of the T2 generation overexpression transgenic lines (OE#2, OE#3 and OE#4) (DI=36, 39, 38) was significantly lower than that of the wild type (DI=55), and the disease resistance of the plants was significantly enhanced.

[0097] Depend on Figure 6 B shows that compared with the wild type, the browning of the T2 generation overexpressing transgenic lines (OE#2, OE#3 and OE#4) was weakened and the antioxidant capacity of the plants was significantly enhanced.

[0098] In summary, TaHSP18.6 After gene silencing, the disease resistance of plants was significantly reduced, while the disease resistance of overexpressed plants was significantly enhanced. This indicates that this gene is a positive regulatory gene in the response to wheat stem rot, which enhances wheat stem rot resistance by enhancing the antioxidant capacity of plants.

[0099] Although some preferred embodiments of the present application have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present application.

[0100] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the inventive spirit and scope of the present application. Thus, if these modifications and variations fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. Wheat stem rot resistance gene TaHSP18.6 or application of a recombinant vector in the breeding of wheat varieties / lines resistant to stem rot; the wheat stem rot resistance gene TaHSP18.6 The nucleotide sequence is as shown in SEQ ID NO.1, or its CDS nucleotide sequence is as shown in SEQ ID NO.2; the recombinant vector is an overexpression vector containing the DNA fragment as shown in SEQ ID NO.

2.

2. Wheat stem rot resistance gene TaHSP18.6 The application in positively regulating the antioxidant capacity of wheat is characterized in that: Overexpression of the wheat stem rot resistance gene TaHSP18.6 ; The wheat stem rot resistance gene TaHSP18.6 The nucleotide sequence is shown in SEQ ID NO. 1, or its CDS nucleotide sequence is shown in SEQ ID NO.

2.

3. Wheat stem rot resistance gene TaHSP18.6 Or use of a protein having an amino acid sequence as shown in SEQ ID NO.3 in preventing and controlling wheat stem base rot, the wheat stem base rot resistance gene TaHSP18.6 The nucleotide sequence is shown as SEQ ID NO. 1, or its CDS nucleotide sequence is shown as SEQ ID NO.

2.

4. A method for improving wheat resistance to stem rot, characterized in that: Up-regulating the expression of the wheat stem rot resistance gene as claimed in claim 1 TaHSP18.6 .

Images