A stable and efficient circular RNA overexpression vector and its preparation method and application

Abstract

The present invention relates to a vector for overexpression of circular RNA, which is a lentiviral vector connected with a circular RNA looping framework; the circular RNA looping framework is derived from a pcDNA3.1(+)CircRNA Mini Vector plasmid. The present invention cuts the plasmid pcDNA3.1(+)CircRNA Mini Vector circRNA looping framework and connects it to a lentiviral vector pLVX‑EF1α‑IRES‑ZsGreen1 to form a new lentiviral vector pLVX‑circRNA‑ZsGreen1 that can stably and efficiently overexpress circular RNA. Transfection experiments confirm that it has significant effects in terms of transfection efficiency and overexpression of circular RNA, and has practical promotion and application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a stable and efficient circular RNA overexpression vector and a preparation method and application thereof. Background Art

[0002] Circular RNA (circRNA) is a special type of non-coding RNA. Unlike linear RNA, it has no 5' and 3' ends. It is a type of single-stranded RNA circular structure that is covalently closed and connected end to end to form a ring. The main mechanisms of circular RNA formation include RNA binding protein (RBP)-driven circularization and intron pairing-driven circularization. The main characteristics of circRNA are that it is diverse, richly expressed, stable and not easily degraded by RNAse (different from linear), highly conserved in evolution, cell type specific and tissue specific. The biological functions of circRNA mainly include regulating gene transcription, participating in alternative splicing, inhibiting RNA maturation, participating in the translation process, promoting protein-protein interaction and affecting protein localization. circRNA is related to the occurrence and progression of diseases such as tumors, neurodevelopment, atherosclerosis, and myotonic dystrophy. Therefore, circular RNA has broad prospects in the development and application of new disease diagnosis and treatment methods.

[0003] A small number of circRNAs are widely present, abundant and evolutionarily conserved, and are highly expressed in cells, while most are still lowly expressed. Therefore, overexpressing circRNAs in cells by transfecting overexpression vectors is a powerful method to study the biological functions and mechanisms of circRNAs. At present, there are three main types of circular RNA overexpression vectors: 1. Gene-specific flanking sequence vectors, which require the construction of 200-1000bp sequences of the upstream and downstream flanking target circular RNA amplified by PCR and the circular RNA sequence into a eukaryotic expression vector. The vector construction is complex, the cycle is long, and the effectiveness and efficiency of overexpression are difficult to predict; 2. Universal circularization framework vectors that simulate the endogenous circularization mechanism, which use the upstream and downstream frames to promote the circularization and shearing of the inserted circular RNA sequence. Therefore, there are problems such as short circularization mediating sequences, difficulty in accurately circularizing some circular RNAs, unsatisfactory overexpression efficiency, and high cost; 3. Simplified natural circularization framework vector pcDNA3.1(+)CircRNA Mini Vector, which still has the problem that it cannot accurately circularize and overexpress circular RNAs with special sequences and stable and complex secondary structures. Since it does not carry a fluorescent marker, it is not convenient to directly observe the transfection efficiency. It is mainly used for transient transfection, and the genetic material is lost over time, which limits the research on circRNA functions.

[0004] In order to solve the problems existing in the commonly used vectors, patent CN105176981B discloses a vector for circular RNA expression, whose overexpression efficiency of transfecting 293T is mostly 250-500 times, and in the cell line infected by lentivirus, the overexpression efficiency is around 200 times, which is still relatively low; patent CN109097395A also discloses a vector for circular RNA expression, which requires the addition of specific promoter / terminator, restriction sites, etc., is difficult to prepare and has high cost. At the same time, since the ability of lentiviral vectors has not been verified, the actual overexpression situation is unclear, and the actual application risk is high.

[0005] Due to the particularity of circular RNA's own structure and biosynthesis, and the difficulty of effectively mimicking the intracellular environment, the overexpression of circular RNA is limited by whether it can form a circle and its efficiency, which is related to the sequence and structure of different circular RNAs, as well as the framework and elements of the overexpression vector. At present, the lack of overexpression vectors that can accurately, efficiently, reproducibly and stably generate circular RNA is still a difficulty and key point in circular RNA research. Summary of the invention

[0006] The purpose of the present invention is to provide a vector for circular RNA overexpression, which is a lentiviral vector connected with a circular RNA looping framework; the circular RNA looping framework is derived from a pcDNA3.1(+)CircRNA Mini Vector plasmid.

[0007] Furthermore, the lentiviral vector is pLVX-EF1α-IRES-ZsGreen1; the nucleotide sequence of the circular RNA loop framework is shown in SEQ ID NO.2.

[0008] Furthermore, the nucleotide sequence of the vector is shown in SEQ ID NO.3.

[0009] The present invention also provides a method for constructing the above-mentioned vector, characterized in that it comprises the following steps:

[0010] The lentiviral vector is double-digested, and the nucleotide sequence after digestion, such as the fragment shown in SEQ ID NO.1, is connected to the circular RNA ring frame, and then introduced into Escherichia coli, and the recombinant plasmid is extracted to obtain;

[0011] The nucleotide sequence of the circular RNA forming loop framework is shown in SEQ ID NO.2.

[0012] Furthermore, the lentiviral vector is pLVX-EF1α-IRES-ZsGreen1; the double enzyme digestion is with EcoRⅠ and XbaⅠ; and the Escherichia coli is Escherichia coli DH5α.

[0013] The present invention also provides a use of the above-mentioned vector in preparing a recombinant vector or a recombinant cell overexpressing circular RNA.

[0014] The present invention also provides a recombinant vector for overexpressing circular RNA, which comprises the aforementioned vector and a DNA fragment for transcribing circular RNA; the DNA fragment is shown in SEQ ID NOs. 4 to 6.

[0015] The present invention also provides a method for constructing a recombinant vector for overexpressing circular RNA, which comprises the following steps:

[0016] Take the DNA fragment of transcribed circular RNA, insert it into the aforementioned circular RNA expression vector, then introduce it into Escherichia coli, and extract the recombinant plasmid to obtain;

[0017] or:

[0018] Take the DNA fragment of the transcribed circular RNA, insert it into the circular RNA loop frame of the pcDNA3.1(+)CircRNA Mini Vector plasmid, then introduce it into E. coli, extract the recombinant plasmid, take the recombinant plasmid and the lentiviral vector for double restriction digestion, connect the circular RNA loop frame with the inserted DNA fragment and the fragment with the nucleotide sequence as shown in SEQ ID NO.1, then introduce it into E. coli, extract the recombinant plasmid, and obtain;

[0019] The nucleotide sequence of the circular RNA loop framework is shown in SEQ ID NO.2.

[0020] Furthermore, the vector and pcDNA3.1(+)CircRNA Mini Vector plasmid are digested with Hpa Ⅰ; the double digestion is double digestion with XbaI and EcoRI; the Escherichia coli is Escherichia coli DH5α; the insertion method is T4 ligation method or homologous recombination method; the nucleotide sequence of the DNA fragment is shown in SEQ ID NO.4~6.

[0021] The present invention also provides a recombinant cell overexpressing circular RNA, which comprises the aforementioned recombinant vector overexpressing circular RNA.

[0022] Finally, the present invention provides a method for constructing a recombinant cell overexpressing circular RNA, which comprises the following steps:

[0023] Take the aforementioned recombinant vector and transfect cells to obtain the product.

[0024] Furthermore, the transfected cells are first transfected into 293T cells, cultured and obtained viral supernatant, and then transfected into RKO cells.

[0025] The "circular RNA looping framework" described in the present invention refers to a nucleotide sequence that connects the 3' and 5' ends of RNA to form a complete circular structure, which includes a promoter-Alu cyclization element-multiple cloning site-reverse complementary Alu cyclization element-terminator.

[0026] The stable and efficient circular RNA expression vector of the present invention cuts the plasmid pcDNA3.1 (+) CircRNA MiniVector circRNA circular framework and connects it to the lentiviral vector pLVX-EF1α-IRES-ZsGreen1 to form a new lentiviral vector pLVX-circRNA-ZsGreen1 that can stably express specific circular RNA. The transfection experiment confirms that it has significant effects in transfection efficiency and overexpression of circular RNA, and the overexpression efficiency can be as high as 900 times. The technicians in this field can successfully obtain accurate and efficient overexpression of circRNA by using the vector of the present invention, and only need to master some basic theoretical knowledge and operations of molecular cloning experiments, which has practical promotion and application value.

[0027] The raw material plasmid pcDNA3.1(+)CircRNA Mini VectorcircRNA and the lentiviral vector pLVX-EF1α-IRES-ZsGreen1 used in the preparation method of the present invention are both commonly used materials in the molecular field, are low-cost and easy to obtain, have mature circularization arm sequences, strong vector functions, and good transfection effects. Lentivirus overexpression vectors of various circular RNAs can be constructed in a short time, and the preparation method is simple.

[0028] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0029] The above contents of the present invention are further described in detail below through specific implementation modes in the form of examples, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 pLVX-3.1circ sequencing results and theoretical sequence alignment

[0031] Figure 2 pLVX-3.1circ map

[0032] Figure 3 pLVX-circ5 sequencing results and theoretical sequence alignment

[0033] Figure 4pLVX-circ20 sequencing results and theoretical sequence alignment

[0034] Figure 5 pLVX-circ21 sequencing results and theoretical sequence alignment

[0035] Figure 6 Fluorescence images of two groups of vectors after transient transfection of 293T

[0036] Figure 7 Pattern diagram and Sanger sequencing peak diagram near the circularization site

[0037] Figure 8 circ5 cyclization

[0038] Fig. 9 circ20 cyclization

[0039] Fig.10 circ21 cyclization

[0040] Fig.11 Overexpression of circular RNA after transient transfection of two groups of vectors into 293T cells

[0041] Fig.12 Overexpression of circular RNA in RKO stable strains

[0042] Fig.13 RKO stable strain: circ5 circularization

[0043] Fig.14 RKO stable strain: circ20 circularization

[0044] Fig.15 RKO stable strain: circ21 circularization

[0045] Fig.16 qPCR results bar graph

[0046] Fig.17 Sequencing results of pc3.1-5 and its theoretical sequence alignment DETAILED DESCRIPTION

[0047] Example 1 Construction of a stable and efficient circular RNA expression vector (pLVX-3.1circ vector)

[0048] 1. Preparation of Linearized Vector

[0049] 1.1 Double enzyme digestion (EcoRⅠ and XbaⅠ) of vector pLVX-EF1α-IRES-ZsGreen1 and pcDNA3.1(+)CircRNA Mini Vector respectively

[0050] Prepare the following system in 2 centrifuge tubes respectively:

[0051]

[0052] Incubate at 37°C for 2-4 hours

[0053] After the digestion is complete, perform agarose gel electrophoresis to identify the digestion results (use the undigested plasmid as a control)

[0054] 1.2 Gel recovery and purification (Fuji-Gel Recovery Kit)

[0055] 1% and 2% agarose gels were cast respectively, and the pLVX-EF1α-IRES-ZsGreen1 digestion product and pcDNA3.1-circ mini digestion product were loaded onto 1% and 2% agarose gels respectively. After electrophoresis at 130V for 15min, the band at about 9000bp in 1% gel and the band at about 200bp in 2% gel were cut with a knife respectively, and then recovered and purified with a gel recovery kit to obtain linearized vector a and fragment b respectively, and the concentration was measured by spectrophotometer.

[0056] Linearized vector a nucleotide sequence derived from pLVX-EF1α-IRES-ZsGreen1 (SEQ ID NO.1):

[0057]

[0058] Nucleotide sequence of fragment b derived from pcDNA3.1-circ mini (SEQ ID NO.2):

[0059] AATTCAAAGTGCTGAGATTACAGGCGTGAGCCACCCCCGGCCCACTTTTTGTAAAGGTACGTACTAATGACTTTTTTTTTATACTTCAGGATATCATCGATACCGGTTTAATTAACACGTGGGTAACCGTTAACCCGCGGAGGTAAGAAGCAAGGAAAAGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCAGCGGCCGCTCGAGT

[0060] In addition: Fragment b can also be directly synthesized by gene synthesis

[0061] 2 connections a, b (T4 connection)

[0062] Prepare the following ingredients in a centrifuge tube:

[0063]

[0064] Reaction procedure: 25°C, 10 min; 16°C, +∞

[0065] 3. Transform the product into competent DH5α

[0066] ①Take out the competent DH5α from -80℃ and thaw it on ice

[0067] ② Take 10 μl of the ligation product and add it to 100 μl (or 50 μl) competent cells (DH5α), flick the tube wall to mix, do not shake to mix), and let it stand on ice for 30 minutes

[0068] ③After heat shock in 42℃ water bath for 45 seconds, immediately cool on ice for 2-3 minutes

[0069] ④ Add 900 μl SOC or LB medium (without antibiotics) and shake at 37°C for 1 h (speed 200-250 rpm).

[0070] ⑤ Centrifuge at 5000 rpm for 5 min, discard 800-900 μl of supernatant (leave about 100 μl), resuspend the cells with the remaining culture medium, and spread gently on a solid LB plate containing ampicillin (Amp+) using a sterile spreader.

[0071] ⑥ Incubate inverted in a 37°C incubator for 12-16 hours

[0072] 4 Product identification

[0073] 4.1 Pick 2-4 bacteria and put each into 20ul LB liquid medium (Amp+) and mix well. Take 1ul of bacterial solution and use TaqPlus DNA Polymerase to perform colony PCR (PCR primer sequence: EF-1a: TCAAGCCTCAGACAGTGGTTC;

[0074] IRES-R: CCTCACATTGCCAAAAGACG), and the PCR product was subjected to agarose gel electrophoresis. If a bright band at the right position was visible, it indicated that the selected colony contained the plasmid that had been successfully connected.

[0075] 4.2 Add the above bacterial solution to 15 ml LB liquid medium (Amp+) and mix well. Incubate the culture at 37°C for 12-16 hours. Use TIANGEN-EndoFree Mini Plasmid Kit II to extract the plasmid and perform Sanger sequencing (sangon, sequencing primer EF-1a, 1 reaction). Use snapgene software to simulate the theoretical sequence of the T4 ligation product. The actual Sanger sequencing results are compared with the theoretical sequence. Figure 1 From the comparison results, it can be seen that fragment b has been inserted into the linearized vector a, indicating that pLVX-3.1circ was successfully constructed. The map of pLVX-3.1circ is shown in Figure 2

[0076] 5. Cost statistics

[0077] See Table 1 for details.

[0078] Table 1 Construction cost of pLVX-3.1circ

[0079]

[0080] That is, it costs about 2,372.6 yuan and takes 3 days to complete the construction and verification of the pLVX-3.1circ empty vector.

[0081] The beneficial effects of the present invention are further illustrated by test examples below:

[0082] Experimental Example 1 Construction of a specific circular RNA overexpression vector①

[0083] The circular RNA overexpression vectors pLVX-circ5, pLVX-circ20, and pLVX-circ21 were constructed using the pLVX-3.1circ vector of Example 1.

[0084] 1. Preparation of linearized vector

[0085] 1.1 Single restriction enzyme digestion of vector pLVX-3.1circ: HpaⅠ

[0086] Prepare the following system in a centrifuge tube:

[0087]

[0088] Incubate at 37°C for 2-4 hours

[0089] After the digestion is complete, perform agarose gel electrophoresis to identify the digestion results (use the undigested plasmid as a control)

[0090] 1.2 Gel recovery and purification

[0091] A 1% agarose gel was cast and the pLVX-3.1circ digestion product was subjected to electrophoresis at 130 V for 15 min. The bright band was cut off with a knife and then recovered and purified using the gel recovery kit FOREGENE-Gel Extraction Kit Instruction Manual to obtain the linearized vector, and the concentration was measured by spectrophotometer.

[0092] 2. Obtaining Insert Fragments

[0093] The RNAs designed in the experiment include circ5, circ20 and circ21, and their linear sequences (with cyclization sites at both ends) are as follows:

[0094] circ5 linear sequence (SEQ ID NO.4)

[0095] GCCTGATCTTTTGGCCAGAAGGAGATTAAAAAGATGCCCCTCAAGATGGCTGTGCCTGTCAGCTGCATGGAGCTTCGTTCAAGTATTTTCTGAGCCTGATGGATTTACAGTGATCTTCAGTGGTCTGGGGAATAACGCTGGTGGAACCATGCACTGGAATGACACACGCCCGGCACATTTCAGGATACTAAAAGTGGTTTTAAGGGAGGCTGTGGCTGAATGCCTCATGGATTCTTACAGCTTGGATGTCCATGGGGGACGAAGGACTGCAGCTGGCTGAGAGGGTTGAGATCTCTGTTTACTTAGATCTCTGCCAACTTCCTTTGGGTCTCCCTATGGAATGTAAGACCCCGACTCTTCCTGGTGAAGCATCTGATGCACGTTCCATCCGGCGCTCAGCTGGGCTTGAG

[0096] circ20 linear sequence (SEQ ID NO.5):

[0097] ATCTTGGCATATACAGAAGGGCTGCATGGAAAATGGCTGTTCACAGAGATACGATCAATCTTTTCTCGTCGTTATCTTTTGCAAAATACAGCCCTGGAGATCTTTATGGCAAACAGAGTTGCTGTGATGTTCAACTTCCCAGACCCTGCAACAGTAAAGAAAGTGGTTAACTATCTACCTCGTGTTGGCGTTGGAACAAGTTTTGGATTGCCTCAAACCAGACGTATTTCATTAGCTAGTCCACGTCAGCTTTTTAAGGCTTCTAATATGACCCAGCGATGGCAACACAGAGAGATATCTAATTTTGAGTACTTGATGTTTCTCAACACGATAGCAGGACGGAGTTATAATGACTTAAATCAGTATCCAGTGTTTCCTTGGGTCATCACTAATTATGAATCAGAAGAACTGGATCTTACCTTGCCCACCAACTTCAGAGATTTGTCCAAG

[0098] circ21 linear sequence (SEQ ID NO.6):

[0099] ATCTTGGCATATACAGAAGGGCTGCATGGAAAATGGCTGTTCACAGAGATACGATCAATCTTTTCTCGTCGTTATCTTTTGCAAAATACAGCCCTGGAGATCTTTATGGCAAACAGAGTTGCTGTGATGTTCAACTTCCCAGACCCTGCAACAGTAAAGAAAGTGGTTAACTATCTACCTCGTGTTGGCGTTGGAACAAGTTTTGGATTGCCTCAAACCAGACGTATTTCATTAGCTAGTCCACGTCAGCTTTTTAAGGCTTCTAATATGACCCAGCGATGGCAACACAGAGAGATATCTAATTTTGAGTACTTGATGTTTCTCAACACGATAGCAGGACGGAGTTATAATGACTTAAATCAGTATCCAGTGTTTCCTTGGGTCATCACTAATTATGAATCAGAAGAACTGGATCTTACCTTGCCCACCAACTTCAGAGATTTGTCCAAGCCAATAGGAGCTCTGAACCCAAAAAGAGCAGCATTCTTCGCTGAGCGTTATGAATCATGGGAAGATGATCAAGTTCCAAAGTTTCACTATGGTACTCATTACTCAACTGCAAGTTTTGTTCTTGCATGGCTGCTAAGAATAGAACCCTTTACAACTTATTTCCTAAATTTGCAAGGAGGCAAATTTGATCATGCAGATCGAACTTTTTCATCAATTTCCAGAGCTTGGCGAAACAGTCAGCGTGATACCTCTGATATTAAGGAGTTGATCCCTGAATTTTATTATCTCCCTGAGATGTTTGTCAACTTCAATAATTATAATCTTGGAGTGATGGATGATGGGACAGTAGTGTCTGATGTCGAACTTCCTCCTTGGGCCAAAACCTCAGAAGAATTTGTTCACATAAACAGATTG

[0100] 2.1 Forward / Reverse Primer Design and Synthesis

[0101] General principle: Linearized pLVX-3.1circ terminal homologous sequence + target circRNA specific forward /

[0102] Reverse amplification primer sequence

[0103] Insert fragment forward amplification primer design method: 5'-vector upstream end homologous sequence + target circular RNA specific forward amplification primer sequence-3'

[0104] Insert fragment reverse amplification primer design method: 5'-vector downstream end homologous sequence + target circular RNA specific reverse amplification primer sequence-3'

[0105] The forward and reverse primer sequences of circ5, circ20, and circ21 are as follows;

[0106]

[0107]

[0108] 2.2 PCR reaction

[0109] use PCR reaction was performed using Super-Fidelity DNA Polymerase Kit.

[0110] The template DNA used was cDNA from 293T cells, and the dosage was 1 ul.

[0111] After the reaction is completed, 3 μl of the product is taken for agarose gel electrophoresis to observe whether it is a specific band.

[0112] 2.3 Purification of PCR amplification products

[0113] The PCR product was purified using FOREGENE-PCR Purification Kit, i.e., DNA fragments were recovered and the concentration was measured by spectrophotometer.

[0114] 3. Recombination reaction

[0115] use II One Step Cloning Kitt kit for linearized vector and insert fragment recombination reaction. After reacting at 37℃ for 30min, cool to 4℃ or immediately cool on ice to obtain the recombination product.

[0116] 4. Transform the product into competent DH5α

[0117] The method is the same as in Example 1 "3 Product transformation into competent DH5α"

[0118] 5. Product Identification

[0119] The method is the same as "4 Product identification" in Example 1.

[0120] Finally, plasmids pLVX-circ5, pLVX-circ20 and pLVX-circ21 were obtained. The theoretical sequences and their comparison with Sanger sequencing results are detailed in Figure 3 to Figure 5 From the comparison results, it can be seen that circ5, circ20, and circ21 have been inserted into pLVX-3.1circ, and the overexpression vectors of the three have been successfully constructed.

[0121] 6. Cost statistics

[0122] Table 2 Construction cost of specific circular RNA overexpression vector

[0123]

[0124]

[0125] *Indicates steps that can be completed simultaneously

[0126] That is, based on the pLVX-3.1circ empty vector, it costs about 175.5 yuan and takes 3 days to construct each specific circular RNA overexpression vector (multiple specific circular RNA overexpression vectors can be constructed at the same time)

[0127] Experimental Example 2: Verification of transfection effect, circularization accuracy, and overexpression efficiency of circular RNA expression vector

[0128] 1. Transient transfection

[0129] Using invitrogen-Lipofectamine TM 3000 kit, with pLVX-3.1circ constructed in Example 1 (blank control), the corresponding specific circular RNA overexpression vectors pLVX-circ5, pLVX-circ20, and pLVX-circ21 constructed in Experimental Example 1, and the commercially available blank vector (experimental number: pLC5-NC) and the corresponding specific circular RNA overexpression vectors pLC5-circ5, pLC5-circ20, and pLC5-circ21 constructed therefrom were transiently transfected into 293T cells to compare the effects.

[0130] 2. Transfection effect

[0131] 48 hours after transfection, the images were taken under a fluorescence microscope. Figure 6 ,Depend on Figure 6It can be seen that compared with 293T cells transformed with pLC-circ5, 20, and 21, 293T cells transformed with pLVX-circ5, 20, and 21 have a higher proportion of green fluorescence and a stronger fluorescence intensity. Therefore, pLVX-circ5, 20, and 21 have better transfection efficiency than pLC5-circ5, 20, and 21.

[0132] 3. Circularization accuracy and overexpression efficiency

[0133] Two days after transfection, cellular RNA was extracted by the Trizol method and reverse transcribed into cDNA.

[0134] 3.1 Perform conventional PCR amplification using cDNA as template; the primer sequences are as follows:

[0135]

[0136] The product was subjected to Sanger sequencing, and the cyclization site was detected, indicating that the circular RNA can be successfully cyclized in the cell. The pattern diagram and sequencing peak diagram near the cyclization site are shown in Figure 7 The sequencing results are shown in Figure 8 to Figure 10 .

[0137] 3.2 Real-time fluorescence quantitative PCR was performed using cDNA as a template. The original results and bar graphs are shown in Tables 3 and Fig.11 : The primer sequences are as follows:

[0138]

[0139] Table 3 Real-time fluorescence quantitative PCR raw results

[0140]

[0141]

[0142] From Table 3 and Fig.11 It can be seen that the overexpression multiples of cir5, circ20, and circ21 by pLVX-3.1circ vector can reach more than 1600 times, more than 500 times, and more than 1100 times, which are all higher than the corresponding overexpression multiples of pLC vector. Therefore, pLVX-3.1circ vector may have a higher overexpression efficiency than pLC5 vector.

[0143] The above demonstrates the superiority of pLVX-3.1circ in terms of transfection effect, circularization accuracy, and transient overexpression efficiency.

[0144] Experimental Example 3 Construction, screening and effect verification of stable overexpression cell lines

[0145] 1. Lentiviral packaging:

[0146] 293T cells were plated (6-well plate) 2 days in advance. When the fusion density reaches 80-90%, transfection can be prepared. Transfection system / well

[0147] A-tube:

[0148]

[0149] B-tube:

[0150] Opti-mem 200ul

[0151] Lipo3000 10ul

[0152] Note: The plasmids in tube A are pLVX-3.1circ constructed in Example 1, pLVX-circ5, pLVX-circ20, and pLVX-circ21 constructed in Experimental Example 1;

[0153] Add the liquid in tube B to tube A, mix gently, let stand for 10-15 minutes, then add 600ul of Opti-MEM, mix gently and add to 293T. After 8 hours, discard the mixed culture medium, wash gently with PBS, and replace with 10% DMEM. Continue to culture in a 37℃, 5% CO2 incubator. After 48 hours, collect the virus supernatant, centrifuge at 2000rpm for 10 minutes to remove cell debris, and filter with a 0.22um filter.

[0154] 2. Infect target cells with lentivirus (taking RKO as an example):

[0155] RKO cells were plated 2 days in advance and infected when the confluence density reached 30%-40%.

[0156] Mix the virus supernatant and 10% DMEM in a volume ratio of 1:1 to 4:1 and add to the wells. After culturing for 8-12 hours, remove the supernatant, add complete medium and continue culturing.

[0157] 3. Fluorescence sorting

[0158] After the cells are stable, fluorescence sorting (BD FACSAria SORP) is performed, and the cells are cultured until they adhere to the wall and expand. The results are shown in Fig.12 .

[0159] from Fig.12 It can be seen that almost all RKO cells contain green fluorescence, indicating that the corresponding vector was successfully transferred into the cells after lentivirus packaging.

[0160] 4. Circularization accuracy and overexpression efficiency

[0161] The specific method is the same as that in Experiment 2 "Circularization accuracy and overexpression efficiency"

[0162] 4.1 Sanger sequencing confirmed successful circularization

[0163] The specific verification method is the same as "3.1" in Experimental Example 2, and the sequencing results are shown in Figures 13-15 , it can be seen from the results that the circular RNA can be successfully circularized in RKO cells.

[0164] 4.2 The original results of qPCR are shown in Table 4 and the bar graph Fig.16 :

[0165] Table 4 qPCR raw results

[0166]

[0167] At this point, the RKO cell line that can long-term, stably and significantly overexpress the above circular RNA has been successfully constructed.

[0168] In summary, pLVX-3.1circ has strong advantages in transient overexpression and stable overexpression of circular RNA, and can overexpress hundreds or even thousands of times. At the same time, compared with the currently commercially available lentiviral circular RNA overexpression vectors (specific circular RNA sequences have been inserted, and empty vectors are often not sold separately), the cost is as high as 3,000 to 7,000 yuan, and the circularization accuracy and overexpression efficiency cannot be guaranteed. The present invention can insert different circular RNAs into expression vectors according to actual needs, with lower cost, more convenient and flexible use, and better stability; compared with the research reports on the disclosed circularized overexpression vectors, the present invention is simpler to prepare, has higher circularization accuracy and overexpression efficiency, and has market promotion and application prospects.

[0169] Experimental Example 4 Construction and Verification of Specific Circular RNA Overexpression Vector

[0170] During the molecular experiment, those skilled in the art may also construct a specific circular RNA overexpression vector using a method different from that of Experimental Example 1 according to actual conditions, as follows:

[0171] 1. Insert the target circular RNA sequence (taking circ5 as an example) into pcDNA3.1(+)CircRNAMini Vector by homologous recombination

[0172] 1. Linearize the pcDNA3.1(+)CircRNA Mini Vector (hereinafter referred to as pc3.1circ) plasmid

[0173] 1.1 Single restriction enzyme digestion with Hpa Ⅰ to linearize the plasmid

[0174] system:

[0175]

[0176] Incubate in 37℃ water bath overnight.

[0177] 1.2 Gel recovery and purification (Fuji-Gel Recovery Kit)

[0178] Pour 1% or 1.5% agarose gel, run the gel and recover the bands under UV light to obtain the linearized plasmid, and measure the concentration.

[0179] 2. PCR amplification and purification of target (insert) fragment:

[0180] The method is the same as that of Experimental Example 1 "Obtaining Insert Fragment 2"

[0181] 3. Recombination reaction

[0182] The method is the same as that of "Test Example 1" 3. Recombination reaction"

[0183] 4. Transformation of recombinant products into competent cells DH5α

[0184] The method is the same as "Test Example 1 "Product transformation into competent DH5α"

[0185] 5. Identification of recombinant products

[0186] The selected bacteria were placed in 20ul LB liquid culture medium (Amp+) and mixed. 1ul was taken for colony PCR. If a bright band can be seen when the PCR product is run on agarose, it means that the selected colony contains a successfully recombined plasmid. Shake the bacteria for amplification, extract the plasmid (SanPrep Endotoxin-free Plasmid DNA Mini-Extraction Kit) and perform Sanger sequencing. The detection of the inserted fragment sequence indicates that the recombinant plasmid has been successfully constructed. The sequencing results of pc3.1-5a are shown in Fig.17 .

[0187] 2. Construction of pLVX-3.1circ and pLVX-circ5 vectors by restriction digestion and ligation

[0188] 1. Linearize the vector pLVX

[0189] The method is the same as "1.1" in "1. Preparation of linearized vector" in Example 1.

[0190] 2. Linearize plasmids pc3.1-NC, pc3.1-5

[0191] a. Double digest the four plasmids with XbaI and EcoRI, using the same method as above

[0192] b. Gel recovery and purification (1% gel) using the same method as above. Pay attention to recovering the small fragment circular framework (Snc) and the circular framework with circ5 inserted (S5), and measure the concentration.

[0193] 3. Use T4 ligase to connect L and Snc, S5, S20, and S21 respectively

[0194] Reaction system:

[0195]

[0196] Reaction procedure: 25°C, 10 min; 16°C, +∞

[0197] 4. Transform competent cells using the same method as in Example 1, “3. Product transformation into competent DH5α”.

[0198] 5 Identification: the method is the same as that in "4 Product Identification" in Example 1.

[0199] The sequencing results showed that Snc and S5 were successfully inserted into L, so the obtained plasmids were named pLVX-3.1circ and pLVX-c5, respectively.

[0200] From the above results, it can be seen that there are various methods to construct vectors for overexpressing circular RNA using plasmid pcDNA3.1(+)CircRNA Mini VectorcircRNA and lentiviral vector pLVX-EF1α-IRES-ZsGreen1. You can first construct a blank circular RNA overexpression vector and then insert the circular RNA into the vector. You can also first insert the circular RNA into the circular framework of the pcDNA3.1(+)CircRNAMini Vector plasmid and then recombinant the circular framework into the lentiviral vector pLVX-EF1α-IRES-ZsGreen1. The effects of the two methods are equivalent.

[0201] In summary: the present invention cuts the plasmid pcDNA3.1(+)CircRNA Mini VectorcircRNA circular framework and connects it to the lentiviral vector pLVX-EF1α-IRES-ZsGreen1 to form a new lentiviral vector pLVX-circRNA-ZsGreen1 that can stably express specific circular RNA. The transfection experiment confirms that it has significant effects in transfection efficiency and overexpression of circular RNA, and the overexpression efficiency can be as high as 900 times. And the preparation cost is low, it is easy to obtain, the circularization arm sequence is mature, the vector function is strong, the transfection effect is good, and it can be used as a raw material in a short time to construct a variety of lentiviral overexpression vectors of circular RNA, which has practical promotion and application value.

Claims

1. A vector for circular RNA overexpression, characterized in that: It is a lentiviral vector connected to a circular RNA loop framework; the nucleotide sequence of the circular RNA loop framework is shown in SEQ ID NO.2; The lentiviral vector is pLVX-EF1α-IRES-ZsGreen1.

2. The carrier according to claim 1, characterized in that: The nucleotide sequence of the vector is shown in SEQ ID NO.

3.

3. A method for constructing the vector according to claim 2, characterized in that: It includes the following steps: The lentiviral vector is double-digested, and the nucleotide sequence after digestion, such as the fragment shown in SEQ ID NO.1, is connected to the circular RNA ring frame, and then introduced into Escherichia coli, and the recombinant plasmid is extracted to obtain; The nucleotide sequence of the circular RNA loop framework is shown in SEQ ID NO.2; The lentiviral vector is pLVX-EF1α-IRES-ZsGreen1; the double enzyme digestion is performed by EcoRⅠ and XbaⅠ; and the Escherichia coli is Escherichia coli DH5α.

Images