Nucleic acid aptamer specifically binding to valproate small molecules, kits and uses thereof
Patent Information
- Application Number
- CN202310163142.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-24
- Publication Date
- 2026-08-11
- Estimated Expiration
- 2043-02-24
AI Technical Summary
[0006]主要缺陷在于:丙戊酸钠作为一种常用的抗癫痫药,其血药浓度和用法用量对于病人来说都是极其重要的,准确测量不同病人在不同用药时间内的血药浓度可以帮助病人准确和合理用药,大大提高药物的作用并降低副作用
[0032] 1) This invention screens and obtains sodium valproate nucleic acid aptamers with high affinity and high specificity.
Smart Images

Figure CN116200392B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, and relates to nucleic acid aptamers, especially to nucleic acid aptamers, kits and applications that specifically bind to small molecules of sodium valproate. Background Technology
[0002] Sodium valproate is a nitrogen-free, broad-spectrum antiepileptic drug. It has varying degrees of antagonistic effect against seizures induced by various methods. It is effective against all types of epilepsy in humans, including various types of petit mal seizures, myoclonic seizures, focal seizures, grand mal seizures, and mixed epilepsy. It is rapidly and completely absorbed orally, mainly distributed in the extracellular fluid, and in the blood, most of it is bound to plasma proteins. It is often used for patients with various types of epilepsy who have not responded to other antiepileptic drugs, especially for petit mal seizures.
[0003] In addition, sodium valproate can be used to treat febrile seizures, movement disorders, chorea, porphyria, schizophrenia, pain caused by herpes zoster, adrenal dysfunction, and to prevent alcohol withdrawal syndrome.
[0004] Oral absorption via the gastrointestinal tract is rapid and complete, with peak plasma concentrations reached in approximately 1–4 hours. Bioavailability is nearly 100%, with an effective plasma concentration of 50–100 μg / mL. Plasma protein binding is approximately 94% at a plasma concentration of approximately 50 μg / mL and approximately 80–85% at a plasma concentration of approximately 100 μg / mL. Significant adverse reactions may occur at plasma concentrations exceeding 120 μg / mL. As plasma concentration increases, the free fraction increases, thus increasing the gradient for entry into brain tissue (the concentration in cerebrospinal fluid is 10–20% of the plasma concentration), with a half-life (T1 / 2) of 7–10 hours. It is mainly distributed in extracellular fluid and in the liver, kidneys, intestines, and brain tissue. Most of it is metabolized by the liver, including through glucuronic acid conjugation and certain oxidation processes, and is primarily excreted by the kidneys, with small amounts excreted in feces and exhaled. It can cross the placenta and is secreted into breast milk.
[0005] Nucleic acid aptamers are DNA or RNA molecules isolated through systematic evolution of ligands using exponential enrichment (SELEX) technology. They can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells, thus showing broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, nucleic acid aptamers have advantages such as smaller molecular weight, better stability, easier modification, no immunogenicity, shorter production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification.
[0006] The main drawback is that sodium valproate, as a commonly used antiepileptic drug, has extremely important blood concentrations and dosages for patients. Accurately measuring blood concentrations in different patients at different times of administration can help patients use the drug accurately and rationally, greatly improving its efficacy and reducing side effects. Currently, the main methods for detecting sodium valproate content in clinical practice are point titration, permanent shutdown calibration, and HPLC. The first two methods lack sensitivity and are relatively complex to operate, making them unsuitable for high-throughput detection, while HPLC is also relatively expensive and requires relatively complicated pretreatment. Summary of the Invention
[0007] To address the aforementioned issues, the first aspect of this invention provides a nucleic acid aptamer that specifically binds to small molecules of sodium valproate. By screening and obtaining sodium valproate nucleic acid aptamers with high affinity and high specificity, a new strategy can be provided for the detection of sodium valproate, replacing traditional methods, reducing costs, and improving the accuracy and reliability of sodium valproate detection results. Utilizing multiple detection platforms, this approach is of great significance for precise medication for patients.
[0008] Secondly, the present invention provides a kit comprising a nucleic acid aptamer that specifically binds to the aforementioned sodium valproate small molecule.
[0009] Thirdly, the present invention provides the application of the above-mentioned nucleic acid aptamer that specifically binds to sodium valproate small molecules.
[0010] To achieve the above objectives, the present invention adopts the following technical solution:
[0011] This invention first provides a nucleic acid aptamer that specifically binds to a small molecule of sodium valproate, comprising the nucleotide sequence shown in SEQ ID No. 1; or, a nucleotide sequence that has high homology with the nucleotide sequence of SEQ ID No. 1 and can specifically bind to a small molecule of sodium valproate; or a nucleotide sequence derived from the nucleotide sequence shown in SEQ ID No. 1 that can specifically bind to a small molecule of sodium valproate; wherein, the molecular formula of the small molecule of sodium valproate is:
[0012]
[0013] As a preferred embodiment of the present invention, the high homology refers to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homology with the nucleotide sequence shown in SEQ ID Nos.1.
[0014] As a preferred embodiment of the present invention, the nucleic acid aptamer comprises a nucleotide sequence complementary to the nucleotide sequence and maintains affinity.
[0015] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer includes base modifications and maintains affinity.
[0016] As a preferred embodiment of the present invention, the base modification is thiomodification, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.
[0017] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer contains a marker and maintains affinity.
[0018] As a preferred embodiment of the present invention, the marker is a fluorescent marker, a radioactive marker, a therapeutic marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.
[0019] As a preferred embodiment of the present invention, the method for screening nucleic acid aptamers that specifically bind to sodium valproate small molecules includes the following steps:
[0020] 1) Fixed document library;
[0021] 2) Magnetic bead and library incubation;
[0022] 3) Document cleaning;
[0023] 4) Target elution;
[0024] 5) Q-PCR detection;
[0025] 6) ePCR amplification;
[0026] 7) Single-chain preparation;
[0027] 8) Repeat steps 2)-7) 11 times, using the secondary library obtained in the previous operation as the starting nucleic acid library for each operation;
[0028] The sequence of primer Lib1S1-CS-biotin is shown in SEQ ID No. 4.
[0029] The present invention also provides a kit comprising the above-described nucleic acid aptamers that specifically bind to sodium valproate small molecules.
[0030] Finally, this invention provides an application for the biodetection of sodium valproate small molecules using nucleic acid aptamers that specifically bind to the above-mentioned sodium valproate small molecules.
[0031] Compared with the prior art, the present invention has the following beneficial effects:
[0032] 1) This invention screens and obtains sodium valproate nucleic acid aptamers with high affinity and high specificity.
[0033] 2) This invention provides a new strategy for the detection of sodium valproate, replacing traditional methods, reducing costs, and improving the accuracy and reliability of sodium valproate detection results. Utilizing multiple detection platforms is of great significance for precise medication for patients. Attached Figure Description
[0034] Figure 1 This is a sequence and secondary structure prediction diagram of the nucleic acid aptamer of this invention.
[0035] Figure 2 This invention provides a CD spectrum detected at wavelengths of 220-320nm.
[0036] Figure 3 This is the titration curve of sodium valproate and monoclonal antibody 16 according to the present invention.
[0037] Figure 4 This is the linear fitting graph of the present invention.
[0038] Figure 5 This is the regression curve of the present invention.
[0039] Figure 6 This is the chromatogram of the control group of this invention.
[0040] Figure 7 This is the chromatogram of the experimental group of this invention. Detailed Implementation
[0041] To facilitate understanding of the technical means, creative features, objectives, and effects of this invention, the invention is further described below with reference to specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the scope of protection of this invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0042] Example 1
[0043] Screening for specific binding of sodium valproate aptamers
[0044] I. Design of DNA Library and Primers
[0045] Random single-stranded DNA library: 5'-CGAGCATAGGCAGAACTTACGAC-36N-GTCGTAAGAGCGAGTCATTC-3'
[0046] Wherein, "36N" represents a sequence consisting of 36 arbitrary nucleotide bases linked together. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0047] Primer information is shown in Table 1, and the primers were synthesized by General Biotech (Anhui) Co., Ltd.
[0048] Table 1. Primers and sequences for sodium valproate
[0049]
[0050] In this primer, S represents the forward primer, A represents the reverse primer, the 25 A's in the sequence represent a polyA tail composed of 25 adenosine nucleotides (A), and "Spacer 18" represents an 18-atom hexaethylene glycol intermediate arm. The structural formula of "Spacer 18" used in the above 3' primers is shown in formula (I).
[0051]
[0052] Primers were prepared into 100 μM stock solutions using DPBS buffer (DPBS: 100 mM, NaCl: 150 mM, KCl: 1 mM, MgCl2: 1 mM, CaCl2: 1 mM; pH 6.0, 25 °C) and stored at -20 °C for later use.
[0053] II. Magnetic Bead Screening
[0054] The magnetic bead method was used for screening, and a total of eleven rounds of screening were conducted. The screening process for each round is shown in Table 2.
[0055] Table 2. Sodium valproate aptamer screening process
[0056]
[0057]
[0058]
[0059] The specific filtering method is as follows:
[0060] 1. Fixed document library
[0061] 1.1 Library Dissolution: Take out the Lib1-79nt library and Lib1-CS-biotin primer powder tubes and centrifuge at 12000 rpm for 10 min. Add 130 μL of selection buffer to the Lib1-79nt library to dilute it to 10 μM. Add 50 μL of selection buffer to the Lib1-CS-biotin primer powder to dilute it to 100 μM. Vortex the diluted library and Lib1-CS-biotin separately to dissolve them completely, and then centrifuge at 12000 rpm for 1 min.
[0062] 1.2 Mixing the library and primers: Add 26 μL of the dissolved Lib1-CS-biotin primers to the dissolved Lib1-79nt library and mix well to make the final concentration of Lib1-CS-biotin primers approximately 10 μM. Centrifuge at 12000 rpm for 1 min.
[0063] 1.3 Library and primer complementary pairing: The mixed Lib1-79nt library and Lib1-CS-biotin primers were aliquoted into eight-tube PCR instruments and subjected to slow annealing using a PCR instrument (the slow annealing conditions were: 95℃ for 10 min, slow cooling to 60℃ for 1 min, and then slow cooling to 25℃, with a cooling rate of 0.1℃ / second for each step), and held at 25℃ for 1 min for later use.
[0064] 2. Magnetic Beads and Library Incubation
[0065] 2.1 Take a small amount of the library with good reversibility and mix it with Lib1-CS-biotin (step 1.3) for UV concentration detection and record the UV detection A260 data C1.
[0066] 2.2 Take 1 mL of magnetic beads and wash them with 400 μL of screening buffer each time, for a total of 5 to 6 washes. (For the last wash, the magnetic beads can be temporarily stored in the screening buffer to prevent them from drying out and becoming inactive. Remove the screening buffer before adding them to the library.)
[0067] 2.3 After the renaturation was completed, the library and Lib1-CS-biotin mixture were added to the washed magnetic beads, mixed well, and incubated on a rotating shaker at room temperature for 60 min. All magnetic beads were adsorbed with a strong magnet, and a small amount of supernatant was taken with a pipette to detect the UV A260 value C2. The C2 / C1 value was used to determine the concentration of nucleic acids in the supernatant that were not immobilized on the magnetic beads, and the immobilization efficiency of the library was determined. The first round of immobilization efficiency was 95.5%.
[0068] 3. Document cleaning
[0069] 3.1 Fix the magnetic beads with a magnet, aspirate the supernatant, add 400 μL of DPBS to the magnetic beads, remove the strong magnet, gently suspend the magnetic beads with a pipette tip, and then transfer the magnetic beads to a new 1.5 mL centrifuge tube; (starting from the second round of screening, the volume of screening buffer for each washing step is reduced to 200 μL).
[0070] 3.2 Fix the magnetic beads with a strong magnet, aspirate the supernatant (this sample is named wash1 and retained for qPCR detection), add 400 μL of screening buffer to the magnetic beads, remove the strong magnet, gently suspend the magnetic beads with a pipette tip, and transfer the magnetic beads to a new 1.5 mL centrifuge tube; repeat this step 3 times to obtain wash2, wash3, and wash4 samples in sequence.
[0071] 3.3 After adding 400 μL of screening buffer to the magnetic beads from the previous step, tighten the centrifuge tube cap and incubate on a rotating shaker at room temperature for 60 min; fix the magnetic beads with a strong magnet, aspirate the supernatant and label it Elutin-, and keep the sample for later testing; (this step is a reverse screening step, and the volume will be changed to 200 μL for subsequent reverse screening).
[0072] 3.4 Remove the strong magnet, add 400 μL of screening buffer to the centrifuge tube, gently suspend the magnetic beads with a pipette tip, and then transfer the magnetic beads to a new 1.5 mL centrifuge tube (prepare the screening target during this time). After fixing the magnetic beads with the strong magnet, aspirate the supernatant (wash6) and keep the sample for qPCR detection. Add the prepared target in time for elution and incubation to prevent the magnetic beads from drying out and becoming inactive.
[0073] 4. Target elution 4.1:
[0075] The sodium valproate small molecule target was diluted to a final concentration of 1 μM and mixed to a total volume of 200 μL. This was then added to the magnetic beads washed in the previous step (3.4) and incubated on a rotating shaker at room temperature for 40 min. 4.2:
[0077] Secure the magnetic beads with a strong magnet, and transfer the supernatant into a new centrifuge tube, labeling it Elution+. (This step is a positive sieve).
[0078] 5. Q-PCR detection
[0079] 5.1 Take the qPCR mix and melt it at low temperature (4-20℃), then centrifuge at 5000 rpm for 30 seconds.
[0080] 5.2 Take an eight-tube qPCR array and add 30 μL of qPCR mix to each well. Add 2 μL each of the Elution and Wash 1–6 samples to the qPCR mix separately. Reserve one tube of blank qPCR mix with 2 μL of selection buffer as a negative control. After capping the tubes, briefly centrifuge to mix the samples and begin quantitative real-time PCR detection. The PCR reaction parameters can be set as shown in the following example:
[0081] STEP 1 (Initial denaturation): 95℃ for 2 min;
[0082] STEP2 (denaturation): 95℃ for 0.5 min;
[0083] STEP3 (annealing): 60℃ for 0.5 min;
[0084] STEP 4 (Extension): 72℃ for 0.5 min;
[0085] STEP5 (Loop): Go to STEP2 for 25 cycles.
[0086] 5.3 qPCR result analysis: The screening results are used to determine the screening status of this round. If a standard curve of the library is required, a standard curve experiment should be performed on the library before screening.
[0087] 6. ePCR amplification
[0088] 6.1 Melt and centrifuge 2 mL of PCR mix, then add it to a 50 mL centrifuge tube. Add the Elution+ obtained in 4.2 and gently shake the centrifuge tube to mix thoroughly. Add 8 mL (4 times the volume of PCR Mix) of ePCR microdroplet-generating oil, vortex for 1–2 min using a high-power vortex mixer, and let stand for 1–3 min. If no clear liquid layering occurs, evenly distribute the vortexed emulsion into 12-row 8-tube PCR tubes for PCR amplification (see Table 3 for ePCR mix formulation).
[0089] 6.2 The following example can be used as a reference for setting PCR reaction parameters:
[0090] The PCR reaction settings were configured based on the template, primers, PCR product length, and GC content of Lib1-79nt.
[0091] STEP1 (Initial denaturation): 95℃ for 1 min;
[0092] STEP2 (denaturation): 95℃ 1min → 60℃ 1min → 72℃ 1min;
[0093] STEP3 (Loop): Go to STEP2 for 25 cycles;
[0094] STEP4 (Final Extension): 72℃ for 5 minutes;
[0095] STEP5 (Temporary Storage): 4℃ forever.
[0096] 6.3 Recovery of amplification products:
[0097] Remove the caps from four 8-tube PCR tubes and arrange them in a row with the openings facing the same side. Wrap cotton thread around one end of each PCR tube and place them into a 50mL centrifuge tube. Secure the other end of the thread to the centrifuge tube cap to prevent the PCR tubes from sinking to the bottom during centrifugation. Place the centrifuge tube in an angle centrifuge with the PCR tube openings facing outwards and centrifuge at 2500–3000 rpm for 1 minute. After centrifugation, when opening the centrifuge tube caps, hold the cotton thread to prevent the PCR tubes from sinking to the bottom and lift the thread to remove all the PCR tubes. Collect the emulsion product from all the PCR tubes at the bottom and pour it into a 15mL centrifuge tube. Repeat the centrifugation process, and aliquot all the PCR amplification products into two 15mL centrifuge tubes.
[0098] 6.4 Butanol-concentrated PCR product:
[0099] Divide the PCR product into two 15mL centrifuge tubes. Add 50–100 μL of ultrapure water to each tube, then add 8 mL of n-butanol to each tube. Cap the tubes and invert them approximately 10 times to mix thoroughly. Centrifuge at 7500g for 10 minutes. After centrifugation, the solution will become clear and separate into layers. Aspirate the clear upper layer and the oily emulsion in the middle layer. Transfer the bottom layer of PCR amplification product to the corresponding 1.5mL centrifuge tube according to its volume. If the volume is greater than 150μL, it is recommended to add approximately 5 times the volume of n-butanol and invert to mix until the liquid becomes slightly turbid (do not allow the solution to become clear). Centrifuge at 12000rpm for 2 minutes. Aspirate the n-butanol from the upper layer until the bottom PCR product is concentrated to approximately 100μL.
[0100] Table 3. ePCR mix formulation
[0101]
[0102]
[0103] 7. Single-chain preparation
[0104] Purification of amplification products with n-butanol: Collect all ePCR products into 15mL conical centrifuge tubes, add 2 volumes of n-butanol, and vortex to mix thoroughly; centrifuge at 9000rpm for 10 minutes at 25°C using a benchtop centrifuge; discard the upper phase (n-butanol) to obtain concentrated PCR amplification products, add TBE / urea denaturing buffer at a volume ratio of 1:1, boil for 15 minutes to denature the DNA, then incubate on ice for 1 minute, and perform urea-denaturing polyacrylamide gel electrophoresis on all samples at 300V until bromophenol blue reaches the bottom of the gel, separating the elongated FAM-labeled strands from the reversed strands. The formulation of 7M urea-denaturing polyacrylamide gel is shown in Table 4.
[0105] Table 4. Formulation of modified polyacrylamide gel
[0106] Urea 3.78g 40% polyacrylamide 1.8mL 5*TBE 1.8mL <![CDATA[ddH2O]]> 2.25mL 10% APS 60μL TEMED 15μL
[0107] Gel extraction and recovery of FAM-tagged strands: Remove the gel and place it on a plastic membrane. Ex (nm): 495, Em (nm): 517 to detect the desired FAM-tagged ssDNA. Use a clean blade to cut the target band directly, transfer the strip to a 1.5 mL EP tube and crush it. Add 1 mL ddH2O and boil in a water bath for 10 minutes to transfer the ssDNA from the gel to a solution. Centrifuge to remove gel fragments and retain the supernatant. Purify the supernatant with n-butanol using the same method as in 6.4. Dialyze the obtained DNA single strands overnight using a 3KD dialysis bag; this can then be used as the library for the next round of screening.
[0108] The magnetic bead method was repeated for 11 rounds, with each operation using the secondary library obtained in the previous operation as the starting nucleic acid library.
[0109] In the screening method, the screening pressure can be increased round by round to enhance the enrichment of nucleic acid aptamers and shorten the screening process. Increasing the screening pressure includes reducing the amount of single-stranded DNA library used, the amount of target small molecules used, and the incubation time for both; increasing the washing time; increasing the number of washing cycles; and increasing the amount of reverse screening magnetic beads used.
[0110] III. Aptamer Screening and Affinity Testing
[0111] After cloning and sequencing analysis of the enriched library products, several sequences were selected and synthesized by Shanghai Sangon Biotech. Affinity was tested; the methods for affinity testing are detailed in Examples 2 and 3. One sequence was identified as having strong binding ability and, after verification, ideal affinity for sodium valproate; this sequence was named BWSN-Apt-016. The sequence and secondary structure prediction diagram of this nucleic acid aptamer are shown below. Figure 1 As shown.
[0112] BWSN-Apt-016: CGAGCATAGGCAGAACTTACGACGACAACAAGACAGCACCAC ATCAAGGTCCACTGCATGTCGTAAGAGCGAGTCATTC (SEQ ID No. 1).
[0113] Example 2
[0114] Preliminary determination of monoclonal affinity by circular dichroism spectroscopy (JASCO, Japan, model J-1700):
[0115] Test method:
[0116] 1) Dilute the sodium valproate small molecule to 5 μM with DPBS and set aside. Dilute all monoclonal antibodies to 4 μM and set aside.
[0117] 2) Taking clone 16 as an example;
[0118] Experimental group: Take 100 μL of diluted sodium valproate small molecules, add 100 μL of diluted monoclonal antibody, mix well and incubate for 30 min.
[0119] Control group: Take 100 μL of DPBS, add 100 μL of diluted monoclonal antibody, mix well and incubate for 30 min.
[0120] 3) Add the samples from the experimental group and the blank group to quartz cuvettes respectively, and detect the CD spectrum at a wavelength of 220-320nm.
[0121] The experimental results are shown in Figure 2 As can be seen, the peak height of the experimental group is significantly larger, which is speculated to be due to the small molecule binding with the aptamer to produce a new conformation, and the aptamer may have affinity.
[0122] Example 3
[0123] ITC detects the affinity of monoclonal antibodies.
[0124] Instrument brand: GE
[0125] Model: ITC200
[0126] 1) Dilute sodium valproate solution to 2mM (containing 2% methanol) with DPBS, dissolve BWSN-Apt-016 monoclonal antibody to 5uM with DPBS and make the solution contain 2% methanol, and finally prepare DPBS buffer containing 2% methanol.
[0127] 2) After the instrument completes its self-test upon startup, select the automatic cleaning function for the titration needle and titration cell. After cleaning, titrate with ultrapure water to check the instrument's stability and the cleanliness of the titration needle and titration cell. Then, begin sample injection, titrating 280 μL of DPBS buffer containing 2% methanol with 60 μL of sodium valproate solution to obtain control group data. Clean the titration needle and titration cell again, and inject the sample, titrating 280 μL of BWSN-Apt-016 monoclonal diluted solution containing 2% methanol with 60 μL of sodium valproate solution to obtain experimental group data. The experimental titration method is as follows: the first drop is injected as 0.4 μL, and the subsequent 19 drops are injected as 3 μL each, with each injection lasting 20 seconds and an interval of 150 seconds between injections. After the experiment, clean the titration needle and titration cell and turn off the instrument.
[0128] 3) Subtracting the control group data from the experimental group data, the final titration curve of sodium valproate and monoclonal antibody 16 was plotted. The area of each exothermic peak was automatically integrated using software to obtain the binding isotherm curve, as well as data on the binding ratio, dissociation constant, enthalpy change, entropy change, and Gibbs free energy. Results are shown below. Figure 3 ,from Figure 3 It can be seen that the small molecule sodium valproate has a high affinity for the BWSN-Apt-016 monoclonal antibody, reaching 12.4 μM.
[0129] Example 4
[0130] Elisa experiments confirmed that the BWSN-Apt-016 monoclonal antibody can bind to the small molecule sodium valproate.
[0131] Test method:
[0132] 1) Add 100 μL of diluted SA protein at a concentration of 1 mg / mL to the first and second columns of the microplate, and incubate at 4°C for 24 hours.
[0133] 2) Clean the ELISA plate
[0134] The microplate was washed with a plate washer, and the washing buffer was DPBS containing 0.05% Tween 20.
[0135] 3) Blocking the ELISA plate
[0136] Add 100 μL of 10 mg / mL BSA blocking buffer to the wells coated with protein and block at 37°C for 2 h (if at 4°C, overnight blocking is required).
[0137] 3) Washing
[0138] After sealing, the plate was washed again with a plate washer.
[0139] 5) Library variation
[0140] The target aptamer clone library was diluted to 400 nM and mixed with matching CS-bition primers for slow renaturation, thus matching the CS-biotin primers to the aptamers.
[0141] The reversion program was 95℃ for 10 min, 60℃ for 1 min, and finally cooled to 25℃ (at a rate of 0.1℃).
[0142] 6) Library incubation
[0143] Add the renatured library to the wells of the coated microplate at 100 μL per well, and incubate with shaking for 15-30 min. After incubation, wash each well 2-2 times with 100 μL of DPBS each time. Finally, add another 100 μL of DPBS to each well and let stand at room temperature for 2-3 h to remove the self-dissociated aptamers. After 2-3 h, remove the supernatant and wash each well 4-5 times with DPBS. Finally, remove all supernatant, blot the microplate dry, and store at 4℃ for later use.
[0144] 7) Target incubation
[0145] Sodium valproate and control molecule were diluted to eight concentrations: 1600 nM, 1400 nM, 1200 nM, 1000 nM, 800 nM, 600 nM, 400 nM, and 200 nM. Sodium valproate was added to eight wells in the second column of the microplate according to the concentration gradient, 100 μL per well. Control molecule was added to eight wells in the second column of the microplate according to the concentration gradient, 100 μL per well. The plates were incubated at room temperature with shaking for 60 min.
[0146] 8) Quantitative Real-Time PCR
[0147] The small molecule will compete for the BWSN-Apt-016 monoclonal affinity from the ELISA plate. Take 2 μL of supernatant from each well and perform real-time PCR detection.
[0148] The experimental results are shown in Figure 4 The results after linear fitting are shown below. Figure 5 The regression curve equation is: y = -176.77x + 3254.2R² = 0.9941.
[0149] Example 5
[0150] Application of sodium valproate aptamer in chromatographic detection pretreatment
[0151] Instrument manufacturer: Waters Corporation
[0152] Model Number: I-Class / XVEO-TQD
[0153] Test method:
[0154] 1) BWSN-Apt-016 was biotinylated (Anhui General Biotechnology), and the modified sequence is as follows:
[0155] Biotin-AAAAAAAAAAAAAAAAAAAAAAAA-Spacer18-CGAGCATAGGCAGAACTTACGACGACAACAAGACAGCACCACATCAAGGTCCACTGCATGTCGTAAGAGCGAGTCATTC.
[0156] 2) Dissolution: Take out the modified primer powder synthesized by General Biotech and centrifuge at 12000 rpm for 10 min. Add DPBS buffer to dissolve, then dilute with DPBS to a final concentration of 1 uM 1000 μL, vortex to mix, and set aside for use.
[0157] 3) Refolding treatment: The diluted solution obtained in step 2 is dispensed into a PCR instrument for refolding. The PCR program is: 95℃ for 10 min, 4℃ for 5 min; thereby forming the aptamer into the desired structure.
[0158] 4) Pipette 1 mL of 10 mg / mL streptavidin magnetic beads (purchased from Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (catalog number: 65001) was used to wash the magnetic beads four times with 1000 μL of DPBS each time. The beads were then hooked with a magnet to remove the supernatant. (During the final wash, the magnetic beads were temporarily stored in a small amount of DPBS to prevent them from drying out.) The resulting magnetic bead solution was then aliquoted into two portions: one 500 μL portion, labeled as the experimental group; and the other 500 μL portion, labeled as the control group, for later use.
[0159] 5) Add 1000 μL of the aptamer liquid obtained in step 3 after the renaturation process to the magnetic beads obtained in step 4, mix well, and shake on a rotary table at room temperature for 60 min.
[0160] 6) Washing and Adsorption: Using a magnet to hold the magnetic beads from the previous step, remove the supernatant and wash them again. Each time, add 1000 μL of wash buffer (DPBS) to the magnetic beads, mix at room temperature for 1 min, then hold the beads with a magnet, let them stand at room temperature for 1 minute, remove the supernatant, and repeat the washing operation 5 times. Finally, add 500 μL of DPBS and mix to bring the volume to a final level. To prevent inconsistent bead volume due to bead loss during washing, the control group magnetic beads were also washed 5 times with 500 μL of DPBS.
[0161] 7) Dilute sodium valproate standard with DPBS to a concentration of 200 μM, 1000 μL, for later use.
[0162] 8) Take the control group magnetic beads and the magnet fishing magnetic beads obtained in step 6, remove the supernatant, add 500 μL of sodium valproate standard diluted with DPBS, mix well, shake on a rotary shaker at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 500 μL of DPBS. Simultaneously, add 500 μL of sodium valproate standard diluted with DPBS to the experimental group magnetic beads obtained in step 6, mix well, shake on a rotary shaker at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 500 μL of DPBS.
[0163] 9) Elute each of the magnetic beads obtained in the previous step with 200 μL of methanol. After mixing, incubate at room temperature for 10 min, then use a strong magnet to adsorb the magnetic beads, collect the supernatant, label it, and use a mass spectrometer to detect the content of sodium valproate.
[0164] This embodiment utilizes sodium valproate standards and enriches and purifies sodium valproate samples using sodium valproate aptamer magnetic beads prepared from the aptamers described in the previous embodiment. The sodium valproate retained by the aptamer binding on the magnetic beads is eluted with methanol, and the concentration of sodium valproate is detected by mass spectrometry. The main purpose is to test the enrichment ability of the aptamer-magnetic bead complex, providing a template for future applications.
[0165] Chromatographic data Figure 6 and Figure 7 As can be seen, the magnetic beads in the control group adsorbed some small molecules of sodium valproate, with a response value of 1,519,000, while the response value of the experimental group was 33,270,000, approximately 22 times that of the blank, showing a significant difference. This provides broad prospects for applications in mass spectrometry and chromatography.
[0166] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A nucleic acid aptamer that specifically binds to a valproate small molecule, characterized in that, The nucleic acid aptamer is the DNA nucleotide sequence shown in SEQ ID No. 1, and the nucleotide sequence of SEQ ID No. 1 is as follows: cgagcataggcagaacttacgacgacaacaagacagcaccacatcaaggtccactgcatgtcgtaagagcgagtcattc.
2. The nucleic acid aptamer that specifically binds to sodium valproate small molecules according to claim 1, characterized in that: The nucleic acid aptamer retains its original specific affinity for sodium valproate small molecules while undergoing base modification; the base modification is at least one of thiomodification, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.
3. The nucleic acid aptamer that specifically binds to sodium valproate small molecules according to claim 1, characterized in that: The nucleic acid aptamer is linked to the marker and maintains binding affinity for the small molecule sodium valproate; the marker is at least one of the following: fluorescent marker, radioactive marker, therapeutic marker, biotin marker, digoxigenin marker, nanoluminescent material marker, small peptide marker, siRNA marker, or enzyme marker.
4. A reagent kit, characterized in that, The nucleic acid aptamer comprising the specific binding of sodium valproate small molecules as described in any one of claims 1 to 3.
5. The use of the nucleic acid aptamer that specifically binds to sodium valproate small molecules as described in any one of claims 1 to 3 in the preparation of sodium valproate in vitro non-diagnostic and therapeutic detection reagents and chromatographic and mass spectrometry sample pretreatment enrichment reagents.
Citation Information
Patent Citations
Novel peptides and scaffolds for use in immunotherapy against head and neck squamous cell carcinoma and other cancers
CA3033115A1
Novel peptides and scaffolds for use in immunotherapy against head and neck squamous cell carcinoma and other cancers
CN109803981A