A primer probe set for identifying scorpion and real-time fluorescence PCR identification method

Abstract

The present invention belongs to the field of medicinal material identification, and specifically relates to a primer probe set and a real-time fluorescence PCR identification method for identifying striped scorpion. The present invention takes striped scorpion as the research object, and based on the mitochondrial gene sequence of East Asian scorpion, striped scorpion and other common confused products, spiked messenger scorpion, the specific primers and probes of striped scorpion are studied and found, and the primers, probes and fluorescence PCR method are applied to striped scorpion medicinal materials, powder and Chinese patent medicine containing the medicinal materials, to identify the striped scorpion medicinal materials from the DNA level. The method is fast, accurate, effective and safe, and can realize the qualitative detection of striped scorpion medicinal materials.

Description

Technical Field

[0001] The invention belongs to the field of medicinal material identification, and particularly relates to a primer probe set for identifying a scorpion and a real-time fluorescence PCR identification method. Background Art

[0002] The whole scorpion is a commonly used animal traditional Chinese medicine in my country. It has a wide geographical distribution and a long history of medicinal use. It is mainly used to treat viral diseases and has anti-asthma, anticoagulant, and antithrombotic pharmacological effects. The source of the whole scorpion in the 2020 edition of the "Chinese Pharmacopoeia" is the dried body of the East Asian scorpion of the Scorpionidae family. However, due to the wide distribution area of ​​scorpions, large intra- and inter-species variations, and complex sources of medicinal materials, there are many mixed and counterfeit East Asian scorpions on the market. However, due to the lack of reliable inspection and detection methods, the efficacy research and accurate clinical use of the whole scorpion are seriously affected. In addition to the East Asian scorpions specified in the Pharmacopoeia, the types of scorpions currently circulating in the market also include striped scorpions, spiked messenger scorpions, etc. The striped scorpion is a true scorpion. Mesobuthus The medicinal materials of the genus are currently common counterfeits of the East Asian scorpion. For the complete form of the whole scorpion medicinal materials, the two can be distinguished by body color and individual size, but due to the chaos and irregularity of the medicinal materials market, the commercially available whole scorpion medicinal materials are often mixed with residual fragments, and the exact origin of the residual fragments cannot be identified from the perspective of properties; the DNA barcoding technology using animal cytochrome C oxidase subunit I (COI) as a primer under the Guiding Principles for the Molecular Identification of Chinese Medicinal Materials by DNA Barcoding in the Fourth General Rules of the 2020 Edition of the Chinese Pharmacopoeia can identify the medicinal materials of the East Asian scorpion, the striped scorpion and the spiked messenger scorpion from the DNA level, but it is not applicable to mixed samples and finished medicines made from the original powder of medicinal materials. Summary of the invention

[0003] In view of the problem that the authenticity cannot be accurately identified in the prior art, the present invention provides a primer probe set for identifying the spotted scorpion.

[0004] The present invention also provides a fluorescent PCR method for real-time identification of Scorpio streaked-spotted using the primer probe set, which supplements and improves the inspection and detection method of Scorpio streaked-spotted, and standardizes the market order of whole scorpion medicinal materials; compared with DNA barcode technology, the real-time fluorescent PCR method provided by the present invention is more accurate and faster, does not require first-generation sequencing, and saves experimental costs. It can quickly and accurately identify Scorpio streaked-spotted for mixed samples and finished medicines using raw powder of medicinal materials as medicine.

[0005] The technical solution adopted by the present invention to achieve the above-mentioned purpose is:

[0006] The present invention provides a primer probe set for identifying a scorpion, wherein the primer probe set is:

[0007] AF (as shown in SEQ ID NO.1):

[0008] 5'-ATGCTGAAGTATTTTTGTAGTT-3';

[0009] AR (as shown in SEQ ID NO.2):

[0010] 5'-TAACAATAATGTACTCTTTTCG-3';

[0011] AP (as shown in SEQ ID NO.3):

[0012] 5'-FAM-AGAAGTTCAAAGAGCACTAAAAGCAA-BQ1-3'.

[0013] Furthermore, the gene sequence of Scorpio yezoensis specifically recognized by the primer probe set (as shown in SEQ ID NO.4) is:

[0014] AGGGCTGCACCTAAGGTTAAGGCAAGGAGTGTTAAGAAAGAAATAGGAGTGGTTATTTCATTTTTTTCATATGCTGAAGTATTTTTGTAGTTTATATTAGAAGTTCAAAGAGCACTAAAAGCAAGTCGAAAAGAGTACATTATTGTTAGGCCAAAGGAAATTAAGATGAGAAGAGAAATAATTTGATTAGATTGGCTAGTTAGAAGGCCCTC.

[0015] The present invention also provides a detection kit containing the primer probe set for identifying the spotted scorpion.

[0016] Another object of the present invention is to provide a fluorescent PCR method for real-time identification of scorpions using the primer probe set for identifying scorpions, comprising the following steps:

[0017] (1) Extracting template DNA from the sample to be tested;

[0018] (2) Preparation of PCR reaction system: fluorescent PCR reaction mixture, probe, upstream and downstream primers, test solution, sterile ultrapure water;

[0019] (3) The control reaction system is a reaction system in which an equal volume of control medicinal material solution is used to replace the test solution; the blank control reaction system is a reaction system in which an equal volume of sterile ultrapure water is used to replace the test solution; two replicates are set for the test sample and the control, and the CT value is the average of the two replicates as the final result;

[0020] (4) Conduct PCR reaction and perform qualitative detection.

[0021] Furthermore, in step (2), the PCR reaction system is specifically as follows: the total volume is 20 µl, and 10 µl of fluorescent PCR reaction mixture (2×), 1 µl of probe (0.5 µmol / L), 1 µl of upstream and downstream primers (0.5 µmol / L), and 0.5 µl of test solution are added respectively.

[0022] The identification method provided by the present invention comprises the following parameters for the PCR reaction: stage 1: 95° C., 3 minutes; stage 2: 95° C., 10 seconds, 57° C., 35 seconds, and 40 cycles.

[0023] Furthermore, the judgment principle in the identification process is: the East Asian scorpion and the spiked messenger scorpion have no logarithmic increase in fluorescence, while the striped scorpion has a logarithmic increase in fluorescence, and the corresponding CT value is <30.0.

[0024] The beneficial effects of the present invention are as follows: the present invention takes the striped scorpion as the research object, and based on the mitochondrial gene sequences of the East Asian scorpion, the striped scorpion and other commonly confused species, the spiked messenger scorpion, studies and finds out specific primers and probes for the striped scorpion, and applies the primers, probes and fluorescent PCR method to striped scorpion medicinal materials, powder and Chinese patent medicine containing the medicinal materials. The method is fast, accurate, effective and safe, and can realize the qualitative detection of the striped scorpion medicinal materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the amplification curve of Scorpion yezoensis using primers and probe targeting sequence B;

[0026] Figure 2 is the amplification curve of the East Asian scorpion using primers and probe targeting sequence B;

[0027] Figure 3 is the amplification curve of the spiked messenger scorpion with primers and probe targeting sequence B;

[0028] Figure 4 The specific amplification curve of the East Asian scorpion used in the identification method of the present invention;

[0029] Figure 5 is the specific amplification curve of the spiked messenger scorpion in the identification method of the present invention;

[0030] Figure 6 is the specific amplification curve of Scorpion streaked scorpion in the identification method of the present invention;

[0031] Figure 7 This is the result diagram of the repeatability test;

[0032] Figure 8 This is the result diagram of the precision test;

[0033] Fig. 9 is the detection limit result diagram;

[0034] Fig.10 This is the real-time fluorescence amplification curve of the sample. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further explained and illustrated by means of specific embodiments below.

[0036] Detailed information on whole scorpion medicinal materials is shown in Table 1.

[0037] Table 1 Sample collection

[0038]

[0039] Example 1

[0040] 1. Establishment of fluorescence quantitative PCR method

[0041] 1. Instruments and reagents for drug testing

[0042] Electronic analytical balance (Sartorius CP225D), water purifier, centrifuge (Eppendorf 2545), mini centrifuge, constant temperature mixer (Ruicheng Instrument Co., Ltd. TS100), real-time quantitative PCR instrument (ABI, QuantStudio5), animal genomic DNA extraction kit (TIANGEN, DP304-02), BestarTMqPCR Master Mix (DBI, P-2025259), primers (synthesized by Shanghai Shenggong Biotechnology Co., Ltd.), anhydrous ethanol of analytical grade, East Asian scorpion (China National Institute for Food and Drug Control, batch number: 121696-201401).

[0043] 2. Sample processing and DNA extraction

[0044] 2.1 Sample processing

[0045] Take the medicinal materials, wipe the surface of the medicinal materials with 75% ethanol, dry the surface moisture, put them in a mortar and grind them into extremely fine powder for later use.

[0046] 2.2 DNA extraction

[0047] 2.2.1 Template DNA extraction

[0048] Sample template DNA extraction: Take about 30 mg of the test sample powder and place it in a 1.5 ml centrifuge tube. Use the blood / cell / tissue genomic DNA extraction kit (DP304, TIANGEN) to extract DNA. Specific operation: Add 20 µl of Proteinase K solution and mix well. Place at 56°C until the tissue is dissolved. Add 200 µl of buffer GB and mix thoroughly by inversion. Place at 70°C for 10 minutes. The solution should be clear. Centrifuge briefly to remove the water droplets on the inner wall of the tube cap. Add 200 µl of anhydrous ethanol and shake thoroughly for 15 seconds. At this time, flocculent precipitation may appear. Centrifuge briefly to remove the water droplets on the inner wall of the tube cap. Add the obtained solution and flocculent precipitation to an adsorption column GB3 (the adsorption column is placed in the collection tube), centrifuge at 12000rpm (~13400×g) for 30 seconds, pour out the waste liquid, and put the adsorption column GB3 back into the collection tube. Add 500µl of buffer GD to the adsorption column CB3, centrifuge at 12000rpm (~13400×g) for 30sec, discard the waste liquid, and place the adsorption column CB3 in a collection tube. Add 600µl of buffer PW to the adsorption column CB3, centrifuge at 12000rpm (~13400×g) for 30sec, discard the waste liquid, and place the adsorption column CB3 in a collection tube. Add 500µl of buffer PW to the adsorption column CB3, centrifuge at 12000rpm (~13400×g) for 30sec, discard the waste liquid, and place the adsorption column CB3 in a collection tube. Place the adsorption column CB3 back in the collection tube, centrifuge at 12000rpm (~13400×g) for 2min, and discard the waste liquid. Leave the adsorption column CB3 at room temperature for a few minutes to completely dry the residual rinse liquid in the adsorption material. Transfer the adsorption column CB3 into a clean centrifuge tube, add 50µl of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 minutes, centrifuge at 12000rpm (~13400×g) for 2 minutes, collect the solution into the centrifuge tube to obtain the DNA solution, which is the test solution.

[0049] Positive control: Grind the medicinal material of Scorpion taenia fasciatus (No. TB-01) into extremely fine powder, take about 30 mg, and prepare the positive medicinal material solution using the same sample template DNA solution preparation method.

[0050] Negative control: Take the East Asian scorpion control medicinal material, grind it into extremely fine powder, take about 30 mg, and prepare the negative control medicinal material solution using the same sample template DNA solution preparation method.

[0051] 2.3 Establishment of real-time fluorescence PCR method

[0052] 2.3.1 Probe and primer design

[0053] The COI sequence or mitochondrial sequence of Scorpio scorpio, East Asian Scorpion and Spiny Messenger Scorpion were downloaded from GenBank database, and homologous alignment was performed with the sequence obtained using BioEdit software. After manual correction, differential SNP sites were found. Through software analysis, primers and probes were designed in the conserved and interspecific differential regions within the species. The 5' end of the probe was labeled with the fluorescent group FAM, and the 3' end was labeled with the quencher group BHQ1. Primer Premier 5.0 software was used to design specific identification primers and probes for Scorpio scorpio.

[0054] Scorpion scorpion primer and probe (number: A) sequence (as shown in SEQ ID NO.4) Source:

[0055] AGGGCTGCACCTAAGGTTAAGGCAAGGAGTGTTAAGAAAGAAATAGGAGTGGTTATTTCATTTTTTTCATATGCTGAAGTATTTTTGTAGTTTATATTAGAAGTTCAAAGAGCACTAAAAGCAAGTCGAAAAGAGTACATTATTGTTAGGCCAAAGGAAATTAAGATGAGAAGAGAAATAATTTGATTAGATTGGCTAGTTAGAAGGCCCTC.

[0056] Scorpion scorpion primer and probe (number: B) sequence (as shown in SEQ ID NO.5) Source:

[0057] ATATCATTGTTTGTAAGGAAAAATAAATTTTGTTTGTGGAGGTTAAGAGGGGAGAGAAAAACTCAAAGAATGAATCCGAGTAATATTCCGAATAAAATTAAAAGAATCCCTGAAGTTTTTAAGAGTGGGGGAAGAAAGAAAGGGGAGGAGTTCATAATAA TTCAATTTAGGGCTGCACCTAAGGTTAAGGCAAGGAGTGTTAAGAAAGAAATAGGAGTGGTTATTTCATTTTTTTCATATGCTGAAGTATTTTTGTAGTTTATATTAGAAGTTCAAAGAGCACTAAAAGCAAGTCGAAAAGAGTACATTATTGTTAGGCCA.

[0058] The sequences of the identification probes and primers are shown in Table 2.

[0059] Table 2 Probe and primer sequence list

[0060]

[0061] 2.3.2 Probe and primer screening

[0062] The total volume of the PCR reaction system was 20µl, and 10µl of fluorescent PCR reaction mixture (2×), 1µl of probe (0.5µmol / L), 1µl of upstream and downstream primers (0.5µmol / L), 0.5µl of test solution, and 6.5µl of sterile ultrapure water were added. The positive control reaction system was a reaction system in which an equal volume of positive medicinal material solution was substituted for the test solution; the negative control reaction system was a reaction system in which an equal volume of negative control solution was substituted for the test solution; and the blank control reaction system was a reaction system in which an equal volume of sterile ultrapure water was substituted for the test solution. Two replicates were set for the test sample and the control, and the CT value was taken as the average of the two replicates as the final result.

[0063] PCR reaction: The above reaction system was placed in a fluorescent quantitative PCR instrument and the following parameters were set: stage 1: 95°C, 3 minutes; stage 2: 95°C, 10 seconds, 57°C, 35 seconds, 40 cycles.

[0064] Results For the primers and probes (AF, AR, AP) targeting sequence (No. A), the scorpion (No. TB-01) had an S-type fluorescence amplification curve, while the East Asian scorpion control medicinal material (No. DYDZ) and the spiked messenger scorpion medicinal material (No. JC-01) had no fluorescence amplification curve, and the specificity and effectiveness were good. For the primers and probes (BF, BR, BP) targeting sequence (No. B), the scorpion (No. TB-01) had an S-type fluorescence amplification curve, while the East Asian scorpion control medicinal material (No. DYDZ) and the spiked messenger scorpion medicinal material (No. JC-01) also had fluorescence amplification curves, and the specificity of the primers and probes was poor, so the primers and probes targeting sequence (No. A) were selected for the experiment. The specific results are shown in Table Figure 1-Figure 3 .

[0065] By examining a series of test parameters such as the concentration of primers and probes (AF, AR, AP) of the sequence (number A), the number of amplification cycles, etc., the system of fluorescent PCR reaction was determined according to the test results as follows:

[0066] The total volume is 20µl, and 10µl of fluorescent PCR reaction mixture (2×), 1µl of probe (0.5µmol / L), 1µl of upstream and downstream primers (0.5µmol / L), 0.5µl of test solution, and 6.5µl of sterile ultrapure water are added. The positive control reaction system is a reaction system in which an equal volume of positive medicinal material solution is substituted for the test solution; the negative control reaction system is a reaction system in which an equal volume of negative control solution is substituted for the test solution; the blank control reaction system is a reaction system in which an equal volume of sterile ultrapure water is substituted for the test solution. Two replicates are set for the test sample and the control, and the CT value is the average of the two replicates as the final result.

[0067] PCR reaction conditions: The above reaction system was placed in a fluorescent quantitative PCR instrument and the following parameters were set: stage 1: 95°C, 3 minutes; stage 2: 95°C, 10 seconds, 57°C, 35 seconds, 40 cycles.

[0068] Quality requirements: The experiment should meet the following conditions simultaneously: (1) The blank control has no logarithmic increase in fluorescence or the corresponding CT value is greater than 35.0; (2) The negative control has no logarithmic increase in fluorescence or the corresponding CT value is greater than 35.0; (3) The positive control has a logarithmic increase in fluorescence and the corresponding CT value is less than 30.0.

[0069] Results: East Asian scorpion and scorpion with sharp stings had no logarithmic increase in fluorescence, while scorpion with striped streaks had logarithmic increase in fluorescence, and the corresponding CT value was <30.0. Figure 4-Figure 6 shown.

[0070] 2.3.3 Methodological test

[0071] 2.3.3.1 Repeatability test

[0072] Take the medicinal material of Scorpion (No. TB-01), wipe the surface of the medicinal material with 75% ethanol, dry the surface moisture, grind it into extremely fine powder in a mortar, take six parallel samples, each about 30 mg, put them in 1.5 ml centrifuge tubes, and extract them with an animal genomic DNA extraction kit to obtain a template DNA solution.

[0073] The results were determined according to the determined method and conditions. The average CT value of the 6 samples of Scorpion fasciatus medicinal materials was 24.035, and the RSD was 1.3%, indicating that the method had good repeatability. The results are shown in Table 3 and Figure 7 .

[0074] Table 3 Repeatability test results

[0075]

[0076] 2.3.3.2 Precision

[0077] Take the medicinal material of Scorpion fasciatus (No. TB-01), put it in a mortar and grind it into extremely fine powder, take about 30 mg, put it in a 1.5 ml centrifuge tube, extract it with an animal genomic DNA extraction kit, and obtain a template DNA solution.

[0078] The determination was carried out according to the determined method and conditions, with six replicate wells. The average CT value was 24.598 and the RSD was 1.1%, indicating good precision. The results are shown in Table 4 and Figure 8 .

[0079] Table 4 Precision investigation results

[0080]

[0081] 2.3.3.3 Detection limit

[0082] In order to investigate the detection sensitivity of the method, the powder of the East Asian scorpion control medicinal material was mixed with different proportions of the powder of the scorpion medicinal material (No. TB-01) for experiments. The proportions of the scorpion powder were 1.2%, 3.0%, 5.1%, 9.8%, 20.7%, and 50.4%, respectively. The mixture was placed in a 1.5 ml centrifuge tube and extracted with an animal genomic DNA extraction kit to obtain a template DNA solution.

[0083] The results showed that when the incorporation ratio was 9.8%, there was a logarithmic increase in fluorescence and the CT value was 28.505<30, which was considered to be the detection of Scorpio fasciatus. Considering the market status of medicinal materials and decoction pieces and the errors caused by experimental environment and other factors, the incorporation ratio of 10% was temporarily set as the detection limit. The results are shown in Table 5 and Fig. 9 .

[0084] Table 5 Results of investigation on the proportion of incorporation

[0085]

[0086] 2.4 Sample determination

[0087] The established method was used to perform real-time fluorescence PCR identification on the collected scorpions, East Asian scorpions, and spiked messenger scorpions. For the scorpion samples, the results showed that both batches of scorpions had fluorescence amplification curves, and the corresponding CT values ​​were <30, and the test results were positive; while the East Asian scorpion and the spiked messenger scorpion had no fluorescence amplification curves, and the test results were negative. Fig.10 and Table 6.

[0088] Table 6 Sample measurement results

[0089]

[0090] Note: “—” represents amplification curve without fluorescence.

Claims

1. A primer probe set for identifying Scorpio yezoensis, characterized in that: The primer probe set is: AF: 5'-ATGCTGAAGTATTTTTGTAGTT-3'; AR: 5'-TAACAATAATGTACTCTTTTCG-3'; AP: 5'-FAM-AGAAGTTCAAAGAGCACTAAAAGCAA-BQ1-3'.

2. The primer-probe set for identifying Scorpio yezoensis according to claim 1, characterized in that: The gene sequence of the scorpion specifically identified by the primer probe set is: AGGGCTGCACCTAAGGTTAAGGCAAGGAGTGTTAAGAAAGAAATAGGAGTGGTTATTTCATTTTTTTCATATGCTGAAGTATTTTTGTAGTTTATATTAGAAGTTCAAAGAGCACTAAAAGCAAGTCGAAAAGAGTACATTATTGTTAGGCCAAAGGAAATTAAGATGAGAAGAGAAATAATTTGATTAGATTGGCTAGTTAGAAGGCCCTC.

3. A detection kit containing the primer-probe set for identifying the spotted scorpion as claimed in claim 1.

4. A fluorescent PCR method for real-time identification of Scorpio yezoensis using the primer probe set for identifying Scorpio yezoensis according to claim 1, characterized in that: The following steps are involved: (1) Extracting template DNA from the sample to be tested; (2) Preparation of PCR reaction system: fluorescent PCR reaction mixture, probe, upstream and downstream primers, test solution, sterile ultrapure water; (3) The control reaction system is a reaction system in which an equal volume of control medicinal material solution is used to replace the test solution; the blank control reaction system is a reaction system in which an equal volume of sterile ultrapure water is used to replace the test solution; two replicates are set for the test sample and the control, and the CT value is the average of the two replicates as the final result; (4) Conduct PCR reaction and perform qualitative detection.

5. The primer probe set for identifying Scorpio yezoensis according to claim 4 is used for a fluorescent PCR method for real-time identification of Scorpio yezoensis, characterized in that: In step (2), the PCR reaction system is specifically as follows: the total volume is 20 µl, and 10 µl of fluorescent PCR reaction mixture, 1 µl of a probe with a concentration of 0.5 µmol / L, 1 µl of upstream and downstream primers with a concentration of 0.5 µmol / L, and 0.5 µl of a test solution are added.

6. The fluorescent PCR method for real-time identification of Scorpio yezoensis using the primer probe set for identifying Scorpio yezoensis according to claim 4, characterized in that: The parameters of the PCR reaction are: stage 1: 95°C, 3 minutes; stage 2: 95°C, 10 seconds, 57°C, 35 seconds, 40 cycles.

7. A fluorescent PCR method for real-time identification of Scorpio yezoensis using the primer probe set for identifying Scorpio yezoensis according to any one of claims 4 to 6, characterized in that: The judgment principle in the identification process is: the East Asian scorpion and the spiked messenger scorpion have no logarithmic increase in fluorescence, while the striped scorpion has a logarithmic increase in fluorescence, and the corresponding CT value is <30.0.

Images