A method for rapid identification of resistance of litchi downy mildew to oxadiazon

Abstract

The invention discloses the identification of nucleotide point mutations in the cytochrome b protein-related gene PlCyt b of litchi downy mildew pathogen and its application in monitoring resistance to the fungicide oxadiazine, and specifically discloses a molecular detection method and special primers for identifying the resistance of litchi downy mildew pathogen PlCyt b gene 370 or 372 nucleotide mutations to oxadiazine. The molecular detection method provided by the invention has high sensitivity, good stability and short detection cycle, and can be used for high-throughput monitoring of the frequency of resistance genes and the occurrence and development of resistance of litchi downy mildew pathogen to the fungicide oxadiazine in the field.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, relates to the identification of nucleotide point mutations in the cytochrome b protein-related gene PlCyt b of litchi downy mildew pathogen and its application in the detection of resistance to the fungicide oxadiazine, and specifically relates to a molecular detection method and special primers for rapid identification of nucleotide point mutations in the PlCyt b gene of litchi downy mildew pathogen and its resistance to oxadiazine. Background Art

[0002] Phytophthora litchi Chen ex Ko et al., classified as Oomycota, Peronosporales, Peronosporaceae, Phytophthora, is an important pathogenic oomycete in litchi production. Lychee downy mildew can infect young shoots, flower spikes, young fruits, fruit stalks and mature fruits of litchi, causing flower and fruit drop and rot, among which the fruit is the most harmful, seriously affecting the yield and quality of litchi. At present, there are 68 types of fungicides registered for the prevention and control of litchi downy mildew in my country, and the active ingredients mainly include single-site fungicides such as metalaxyl, azoxystrobin, cyazofamid and dimethomorph. However, with the irrational and frequent use of these fungicides, many plant pathogenic oomycetes have developed serious resistance to the above fungicides. Therefore, major international agrochemical companies have been committed to developing new fungicides with new mechanisms of action and no positive cross-resistance with existing fungicides on the market, for the prevention and control of plant pathogenic oomycete diseases such as litchi downy mildew and management of drug resistance.

[0003] Oxamoxadone is a new type of oomycete inhibitor developed by DuPont, mainly used to control late blight and downy mildew on vegetables and fruit trees. Oxamoxadone belongs to the oxazolidine fungicide class, which can bind to the Qo site on the mitochondrial cytochrome bc1 complex (complex III), blocking the transfer of electrons from cytochrome b to cytochrome c1, thereby interfering with the production of ATP by pathogens and achieving the purpose of inhibiting pathogens. The Fungicide Resistance Action Committee (FRAC) classifies oxamoxadone as a QoI fungicide based on its mode of action. Oxamoxadone obtained pesticide registration in my country in 2013, and is mainly used to control important diseases caused by ascomycetes, basidiomycetes, and oomycetes, such as powdery mildew, rust, glume blight, web blotch, downy mildew, late blight, etc. The current Fungicide Resistance Action Committee (FRAC) has classified its inherent resistance risk as high, and resistance risk management is required during use. This laboratory has obtained litchi downy mildew strains with high-level resistance to oxathiapiprolin through the method of drug domestication, and some high-level resistant strains have high survival fitness, indicating that the indoor resistance risk of litchi downy mildew to oxathiapiprolin is medium to high. Therefore, when using oxathiapiprolin to control plant pathogenic oomycete diseases, it is necessary to strengthen resistance monitoring and provide timely warnings for the occurrence of oxathiapiprolin resistance, so as to guide the scientific use of oxathiapiprolin, delay the development of its resistance, and extend the service life of the agent.

[0004] Conventional methods for detecting fungicide resistance include: mycelium growth rate method, mycelium dry weight determination method, spore germination determination method and agar spreading method. However, these methods require the isolation and purification of pathogens first, and then the pathogens are inoculated on drug-containing culture media or on living plants or tissues treated with fungicides, and the results can only be investigated after a certain period of time. Using conventional methods, when the frequency of resistant strains in the field is greater than 1%, they can be detected (for example, if there is a 95% probability of detecting resistant strains with a frequency of 1%, the sample size required for detection needs to be greater than 300), so it has the disadvantages of low sensitivity, large workload, and long test cycle.

[0005] With the rapid development of molecular biology technology and the continuous expansion of its application scope, restriction enzyme PCR and allele-specific PCR molecular technology have begun to be used in the detection of pathogen resistance. Compared with traditional detection methods, it not only saves detection time and improves work efficiency, but also enhances the sensitivity of detection. The detection frequency is 10 -5 ~10 -4 , is more suitable for detecting low-frequency resistance genes and is also regarded as an ideal method for early diagnosis of resistance in the field. Therefore, molecular detection technology will play an increasingly important role in the sustainable management system of diseases. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a protein related to the resistance of litchi downy mildew to oxadiazine and its encoding gene, as well as its application as a screening marker for the resistance of litchi downy mildew to oxadiazine in the identification of the resistance of litchi downy mildew to oxadiazine.

[0007] In order to achieve the object of the present invention, the technical solution of the present invention is as follows:

[0008] One object of the present invention is to provide a protein related to the resistance of litchi downy mildew fungus to oxadiazine, which is a protein shown in the following 1) or 2):

[0009] 1) A protein consisting of the amino acid residue sequence of SEQ ID NO: 13 in the sequence listing;

[0010] 2) A protein derived from SEQ ID NO: 13 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added to the amino acid residue sequence of SEQ ID NO: 13 and related to the function of famoxadone resistance.

[0011] The above SEQ ID NO: 13 is as follows:

[0012]

[0013] Wherein, X (124th position from the amino terminal) = M or V or I.

[0014] Among them, in the protein related to the resistance to oxadiazine of litchi downy mildew, the 124th amino acid is methionine, which means it is sensitive to oxadiazine. When the 124th amino acid from the N-terminus mutates from methionine to valine or the 124th amino acid mutates to isoleucine (the mutation site exists alone), the litchi downy mildew fungus shows resistance to oxadiazine.

[0015] In one embodiment of the present invention, the sequence of the protein (cytochrome b protein) associated with resistance to oxadipone in litchi downy mildew is as shown in SEQ ID NO: 13. When the 124th amino acid from the N-terminus in SEQ ID NO: 13 is methionine (X=M), the litchi downy mildew is sensitive to oxadipone. When the 124th amino acid from the N-terminus of SEQ ID NO: 13 is valine (X=V) or isoleucine (X=I), the litchi downy mildew is resistant to oxadipone.

[0016] The present invention also provides a gene encoding a protein related to famoxadone resistance.

[0017] The cDNA nucleotide sequence of the coding gene is shown in 1), 2) or 3) below:

[0018] 1) the nucleotide sequence of SEQ ID NO: 14 in the sequence listing;

[0019] 2) a DNA molecule that can be recombined with the DNA sequence described in 1) under stringent conditions and encodes a protein related to the function of famoxadone resistance;

[0020] 3) A DNA molecule having a homology of more than 90% with the nucleotide sequence of SEQ ID NO: 14 in the sequence listing and encoding a protein related to the function of famoxadone resistance.

[0021] The above SEQ ID NO: 14 is as follows:

[0022]

[0023] In SEQ ID NO: 14, the 370th nucleotide from the 5' end is r=a or g, and the 372nd nucleotide from the 5' end is r=a or g.

[0024] In one embodiment of the present invention, the encoding gene is as shown in SEQ ID NO: 14, the 370th nucleotide from the 5' end of SEQ ID NO: 14 is A (r=a) and the 372nd nucleotide from the 5' end is G (r=g), which is a genotype sensitive to oxadiazine.

[0025] When the 370th nucleotide from the 5' end is mutated to G (the 370th nucleotide from the 5' end of SEQ ID NO: 14 r=g, and the 372nd nucleotide from the 5' end is r=g) or the 372nd nucleotide from the 5' end is A (the 370th nucleotide from the 5' end of SEQ ID NO: 14 r=a, and the 372nd nucleotide from the 5' end is r=a), it is a genotype resistant to oxadiazine.

[0026] The expression cassette, recombinant expression vector or transgenic recombinant bacteria containing the above-mentioned coding gene also fall within the protection scope of the present invention.

[0027] Another object of the present invention is to provide the use of cytochrome b protein of litchi downy mildew pathogen or its encoding gene in identifying drug resistance of litchi downy mildew pathogen.

[0028] In one embodiment of the present invention, by detecting whether the 124th amino acid from the N-terminus of the cytochrome b protein of litchi downy mildew pathogen is changed from methionine to valine or isoleucine, if the 124th amino acid is changed from methionine to valine or isoleucine, its resistance to oxadiazine is improved; wherein, the cytochrome b protein of litchi downy mildew pathogen is the protein shown in SEQ ID NO: 13 in the sequence table.

[0029] By detecting that the 370th nucleotide from the 5' end of the coding gene of the cytochrome b protein of the litchi downy mildew pathogen is G or the 372nd nucleotide from the 5' end is A, its resistance to oxadiazine is improved; the coding gene of the cytochrome b protein of the litchi downy mildew pathogen is the coding gene shown in SEQ ID NO:14.

[0030] Another object of the present invention is to provide a primer set for detecting or assisting in detecting whether there is a mutation site in the PlCyt b gene in litchi downy mildew pathogen, which is composed of the DNA molecules described in SEQ ID NO:4 and SEQ ID NO:7 in the sequence list or the DNA molecules shown in SEQ ID NO:10 and SEQ ID NO:12 in the sequence list.

[0031] The application of the primer set in identifying the drug resistance of litchi downy mildew also belongs to the protection scope of the present invention; the drug resistance refers to the resistance of litchi downy mildew to oxadiazon.

[0032] The present invention also provides a method for detecting or assisting in detecting whether there is a mutation site in the PlCyt b gene in litchi downy mildew pathogen, comprising the following steps:

[0033] Taking the genomic DNA of the litchi downy mildew strain to be tested as a template, PCR amplification is performed using the primer pairs shown in SEQ ID NO:4 and SEQ ID NO:7 or SEQ ID NO:10 and SEQ ID NO:12. If SEQ ID NO:4 and SEQ ID NO:7 can amplify a 372bp band or SEQ ID NO:10 and SEQ ID NO:12 can amplify a 505bp band, then the PlCyt b gene in the litchi downy mildew pathogen to be tested has a mutation site or a candidate has a mutation site.

[0034] In the PCR amplification, the annealing temperature of the primer pair SEQ ID NO:4 and SEQ ID NO:7 is 65°C, and the annealing temperature of the primer pair SEQ ID NO:10 and SEQ ID NO:12 is 63°C.

[0035] In the method, the mutation site refers to the nucleotide at position 370 from the 5' end of the PlCyt b gene in the litchi downy mildew pathogen being G or the nucleotide at position 372 from the 5' end being A, thereby causing the amino acid at position 124 from the N-terminus of the cytochrome b protein of the litchi downy mildew pathogen to mutate from methionine to valine or to isoleucine.

[0036] In the method, the mutated cytochrome b protein of litchi downy mildew pathogen is as shown in SEQ ID NO:13, wherein the 124th amino acid from the N-terminus of SEQ ID NO:13 is valine (Xaa=V) and / or the 124th amino acid is isoleucine (X=I), and the mutated PlCyt b gene in litchi downy mildew pathogen is as shown in SEQ ID NO:14, wherein the 370th nucleotide from the 5' end of SEQ ID NO:14 is G (the 370th nucleotide from the 5' end of SEQ ID NO:14 r=g, and the 372nd nucleotide from the 5' end of SEQ ID NO:14 r=g) or the 372nd nucleotide from the 5' end of SEQ ID NO:14 is A (the 370th nucleotide from the 5' end of SEQ ID NO:14 r=a, and the 372nd nucleotide from the 5' end of SEQ ID NO:14 r=a).

[0037] The present invention also provides application of the method in identifying drug resistance of litchi downy mildew pathogen; the drug resistance refers to drug resistance of litchi downy mildew pathogen to oxadiazon.

[0038] The litchi downy mildew pathogen having the mutation site has or is a candidate for having drug resistance.

[0039] Another object of the present invention is to provide a mutation site of the PlCyt b gene or protein in litchi downy mildew pathogen.

[0040] The present invention provides a mutation site of the PlCyt b gene in the litchi downy mildew pathogen, wherein the 370th nucleotide from the 5' end of the genome sequence of the PlCyt b gene of the litchi downy mildew pathogen mutates to G or the 372nd nucleotide from the 5' end mutates to A, and the two nucleotide mutations exist alone.

[0041] The two mutation sites of the cytochrome b protein in the litchi downy mildew pathogen provided by the present invention are that the 124th amino acid from the N-terminus of the cytochrome b protein in the litchi downy mildew pathogen is valine or isoleucine, and the two amino acid mutations exist separately.

[0042] The mutation site refers to the mutation of the 370th nucleotide from the 5' end of the PlCyt b gene in the litchi downy mildew pathogen to G or the mutation of the 372nd nucleotide from the 5' end to A relative to the genotype sensitive to oxadiazine. As a result, the 124th amino acid from the N-terminus of the cytochrome b protein of the litchi downy mildew pathogen changes from methionine to valine or isoleucine.

[0043] The application of any of the above mutation sites in identifying the drug resistance of litchi downy mildew also falls within the protection scope of the present invention; in the above application, the litchi downy mildew pathogen with the mutation site has or is a candidate for drug resistance. The drug resistance refers to the resistance of litchi downy mildew pathogen to oxadiazine.

[0044] The molecular detection method provided by the present invention has high sensitivity, good stability and short detection cycle, and can be used to monitor the frequency of resistance genes of litchi downy mildew fungi to the fungicide oxadiazon in the field in a high-throughput manner, as well as the occurrence and development of resistance, so as to achieve early warning of resistant diseases, guide timely adjustment of the prevention and control strategy of litchi downy mildew disease, promote scientific use of drugs, delay the occurrence and development of drug resistance, and play an important role in the sustainable management system of diseases.

[0045] The method provided by the present invention for detecting the point mutation of resistance of litchi downy mildew to oxadiazine can perform high-sensitivity, simple and rapid molecular detection on resistant strains, and timely understand the dynamics of drug resistance, which is of great significance for formulating reasonable disease management plans and effectively controlling the development of drug-resistant populations. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Amino acid sequence alignment of sensitive and resistant strains of litchi downy mildew (M124 V / I) A. PlCyt b gene pattern of litchi downy mildew and the position of the M124V / I point mutation on the gene; B. Amino acid sequence alignment of PlCyt b protein of litchi downy mildew sensitive and resistant strains to oxadiazine.

[0047] GDHZ-6, FJFZ-34 and FJZZ-1 are sensitive strains; GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24 and FJFZ-34-4 are resistant strains carrying M124V type point mutations; GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, FJFZ-34-2 and FJFZ-34-3 are resistant strains carrying M124I type point mutations.

[0048] Figure 2 This is the wild-type binding mode of oxathiapiprolin and PlCyt b protein of litchi Downy Phytophthora. A. Amino acids that interact with oxathiapiprolin and PlCyt b protein; B. The binding posture and binding energy of oxathiapiprolin and PlCyt b protein.

[0049] Figure 3 This is the binding mode of oxathiapiprolin and litchi Downy Phytophthora M124V-PlCyt b. A. Amino acids that interact with oxathiapiprolin and M124V-PlCytb protein; B. The binding posture and binding energy of oxathiapiprolin and M124V-PlCyt b protein.

[0050] Figure 4 This is the binding mode of oxathiapiprolin and litchi Downy Phytophthora M124I-PlCyt b. A. Amino acids that interact with oxathiapiprolin and M124I-PlCytb protein; B. The binding posture and binding energy of oxathiapiprolin and M124I-PlCyt b protein.

[0051] Figure 5 Screening of AS-PCR primers and annealing temperature for M124V point mutation; A is M124V-R1; B is M124V-R2; C is M124V-R3; D is M124V-R4.

[0052] Figure 6 AS-PCR primers and annealing temperature screening for M124I point mutation A is M124I-R1; B is M124I-R2; C is M124I-R3; D is M124I-R4.

[0053] Figure 7 M124V point mutation AS-PCR was used to detect resistant strains of litchi downy mildew (65℃); GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1 were sensitive strains; GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-4, GDHZ-6-7 and GDHZ-6-8 were resistant strains, among which GDHZ-6-7 and GDHZ-6-8 were resistant strains carrying the M124I mutation site.

[0054] Figure 8 M124I point mutation AS-PCR was used to detect resistant strains of litchi downy mildew (63℃); GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1 were sensitive strains; GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, FJFZ-34-2, FJFZ-34-3, FJZZ-1-11 and FJZZ-1-17 were resistant strains, among which FJZZ-1-11 and FJZZ-1-17 were resistant strains carrying the M124V mutation site. DETAILED DESCRIPTION

[0055] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0057] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0058] The above strains are only the materials used in the examples of the present invention. In fact, when applying the screening markers described in the present invention, any commercially available oomycete strains can be used.

[0059] In the text, "resistant strains" refer to litchi downy mildew fungi that are resistant to the fungicide oxadipamide; "sensitive strains" refer to litchi downy mildew fungi that are sensitive to the fungicide oxadipamide.

[0060] The litchi downy mildew strains used in the following examples are: strains GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1 are sensitive strains, and strains GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-2, FJFZ-34-3 and FJFZ-34-4 are resistant strains.

[0061] The above-mentioned strains GDHZ-5 and GDHZ-6 were collected from Huizhou City, Guangdong Province, China; FJZZ-1 was collected from Zhuzhou City, Fujian Province, China; FJFZ-34 was collected from Fuzhou City, Fujian Province, China; HN10-1 was collected from Haikou City, Hainan Province, China; GDHZ-6-7, GDHZ-6-8, GDHZ-6-9 and GDHZ-6-10 were obtained by domesticating GDHZ-6 with chemicals under laboratory conditions; FJZZ-1-11, FJZZ-1-17 and FJZZ-1-24 were obtained by domesticating FJZZ-1 with chemicals under laboratory conditions; FJFZ-34-2, FJFZ-34-3 and FJFZ-34-4 were obtained by domesticating FJFZ-34 with chemicals under laboratory conditions; all strains were identified as litchi downy mildew pathogens by existing morphological and molecular biological methods. The drug resistance of each of the above strains was verified by colony growth assay.

[0062] Example 1: Induction of resistant mutants of litchi downy mildew to oxadiazon

[0063] Sensitive strains of litchi downy mildew pathogen GDHZ-6, FJZZ-1 and FJFZ-34 were used as parents for the induction test of resistant mutants.

[0064] V8 medium: V8 vegetable juice 100 mL, CaCO3 1.4 g, agar powder 15 g, distilled water to 1 L, moist heat sterilization at 121℃ for 20 min.

[0065] The experimental steps are as follows:

[0066] 1) The parent of the litchi downy mildew pathogen was pre-cultured on V8 medium at 25°C for 7 days, and bacterial cakes with a diameter of 5 mm were obtained, 150 pieces / dish;

[0067] 2) Inoculate the bacterial cake with the mycelium side facing downward on a 10 μg / mL oxadiazine-containing medium and culture at 25°C in the dark for 10 days;

[0068] 3) After new hyphae grow around the bacterial cake, inoculate the newly grown hyphae onto a V8 medium without drugs for expansion culture, then take the bacterial cake according to step 1) and inoculate onto a 20 μg / mL oxadiazine-containing medium for further culture;

[0069] 4) Repeat step 3), and the drug concentration in the culture medium is gradually increased to 10 μg / mL, 20 μg / mL, 40 μg / mL, 80 μg / mL, and 100 μg / mL. Until a strain that can grow normally on a 100 μg / mL drug-containing medium and remains resistant after 10 generations on a blank V8 medium is obtained, which is an oxadiazine-resistant mutant. GDHZ-6-7, GDHZ-6-8, GDHZ-6-9 and GDHZ-6-10 were obtained by domesticating GDHZ-6 with pesticides under laboratory conditions; FJZZ-1-11, FJZZ-1-17 and FJZZ-1-24 were obtained by domesticating FJZZ-1 with pesticides under laboratory conditions; FJFZ-34-2, FJFZ-34-3 and FJFZ-34-4 were obtained by domesticating FJFZ-34 with pesticides under laboratory conditions; all strains were identified as litchi downy mildew pathogens by existing morphological and molecular biological methods. The above strains were all verified for drug resistance by colony growth assay.

[0070] Example 2: Sensitivity of Lychee Downy Phytophthora to Oxalodipine

[0071] The mutants resistant to litchi downy mildew are GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-2, FJFZ-34-3 and FJFZ-34-4; the strains sensitive to litchi downy mildew are GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1.

[0072] V8 medium: V8 vegetable juice 100 mL, CaCO3 1.4 g, agar powder 15 g, distilled water to 1 L, moist heat sterilization at 121℃ for 20 min.

[0073] The experimental steps are as follows:

[0074] 1) Oxazolin is prepared with dimethyl sulfoxide (DMSO) as solvent at a concentration of 10 5 μg / mL mother solution. The sensitivity of sensitive strains of litchi downy mildew to oxathiapiprolin was determined by diluting the oxathiapiprolin mother solution with DMSO into working solutions of corresponding concentrations. The final concentrations of oxathiapiprolin in the drug-containing medium were 0.04μg / mL, 0.08μg / mL, 0.20μg / mL, 0.40μg / mL, 0.8μg / mL and 1μg / mL, respectively. The sensitivity of resistant strains of litchi downy mildew to oxathiapiprolin was determined by diluting the oxathiapiprolin mother solution with DMSO into working solutions of corresponding concentrations. The final concentrations of oxathiapiprolin in the drug-containing medium were 5μg / mL, 10μg / mL, 20μg / mL, 40μg / mL, 80μg / mL, and 100μg / mL. Salicylic acid (SHAM) with a final concentration of 100μg / mL was used throughout the experiment to inhibit the bypass oxidation pathway of the pathogen.

[0075] 2) Cool the sterilized V8 medium to 45°C, add 100 μL of the corresponding drug working solution to 100 mL of V8 medium and mix well, pour the drug-containing medium into a culture dish with a diameter of 9 cm, use SHAM treatment as the blank control, and set up 3 technical replicates for each concentration of drug-containing medium.

[0076] 3) After pre-culturing litchi downy mildew on a V8 plate for 4 days, a bacterial cake with a diameter of 0.5 cm was punched along the edge of the colony using a borer, and the mycelium surface was inoculated downward on the drug-containing and control culture medium plates prepared in step 2), and the plates were placed in a 25°C incubator in the dark for incubation. The colony diameter was measured after 4 days.

[0077] 4) The colony diameter was measured by the cross method, and the inhibition rate of each concentration of the agent on the mycelial growth of the test strain was calculated based on the colony diameter. The inhibition rate was then converted into a probability value (Y), and the concentration of the agent was converted into a logarithmic value with a base of 10 (X). The virulence regression equation Y = a + bX and the correlation coefficient R of the tested litchi downy mildew strain were respectively obtained using the DPS data processing software. 2 and effectively inhibited the concentration of EC 50 value and calculate the resistance multiple.

[0078] Resistance multiple = EC of resistant strain 50 EC / susceptible strains 50

[0079] The results are shown in Table 1:

[0080] Table 1. Sensitivity of tested litchi downy mildew strains to oxadiazon

[0081] strain Virulence regression equation <![CDATA[EC 50 ]]> <![CDATA[R 2 ]]> GDHZ-5 Y=0.98+1.69X 0.261 0.990 GDHZ-6 Y=1.02+1.98X 0.298 0.976 FJZZ-1 Y=0.79+1.58X 0.302 0.951 FJFZ-34 Y=0.83+1.14X 0.188 0.956 HN10-1 Y=0.73+1.17X 0.236 0.997 GDHZ-6-7 / >100 / GDHZ-6-8 / >100 / GDHZ-6-9 / >100 / GDHZ-6-10 / >100 / FJZZ-1-11 / >100 / FJZZ-1-17 / >100 / FJZZ-1-24 / >100 / FJFZ-34-2 / >100 / FJFZ-34-3 / >100 / FJFZ-34-4 / >100 /

[0082] The sensitivity of litchi downy mildew to oxadiazine was tested and the results showed that the average EC values ​​of the sensitive strains of litchi downy mildew GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1 were 50 was 0.257 μg / mL, while the average EC of the resistant strains GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-2, FJFZ-34-3, and FJFZ-34-4 50 All were greater than 100 μg / mL, significantly higher than the average EC of sensitive strains 50 As shown in Table 1.

[0083] Example 3: Discovery of mutation sites of the PlCytb gene and cytochrome b protein in Phytophthora litchii

[0084] 1. Strain culture

[0085] 1. Strains: The resistant strains are GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-2, FJFZ-34-3 and FJFZ-34-4; the sensitive strains are GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1.

[0086] 2. Methods:

[0087] Strain culture: V8 medium (V8 vegetable juice 100mL, CaCO3 1.4g, agar powder 15g, distilled water to 1L, 121℃, sterilized for 20min) was used to culture litchi downy mildew at 25℃. The pre-cultured litchi downy mildew pathogens sensitive and resistant strains were inoculated on V8 medium covered with cellophane, cultured in the dark at 25℃ for 4 days, collected mycelium, frozen in liquid nitrogen and stored at -80℃ for genomic DNA extraction.

[0088] 2. Extract genomic DNA of sensitive and resistant strains of litchi downy mildew respectively:

[0089] 1) Take an appropriate amount of mycelium frozen in liquid nitrogen, grind it into powder with a mortar and pestle, and place it in a 2 mL centrifuge tube;

[0090] 2) Add 800 μL of 3% CTAB solution (preheated at 65°C) to the centrifuge tube, and then place in a 65°C water bath for 1 hour, mixing by inversion for 15 minutes;

[0091] 3) Add equal volumes of phenol:chloroform:isoamyl alcohol (25:24:1) to the centrifuge tube, mix well, and centrifuge at 12000g for 10 min at room temperature;

[0092] 4) Pipette 600 μL of supernatant into a new 2 mL sterile centrifuge tube, add an equal volume of chloroform:isoamyl alcohol (24:1), place on a 3D shaker at 75 rpm, room temperature, for 10 min;

[0093] 5) Centrifuge at 12000g for 10 min at room temperature, take 400 μL of supernatant into a new centrifuge tube, add 0.6 times the volume of isopropanol, and place in a -20°C refrigerator for 30 min;

[0094] 6) Centrifuge at 12000g, 4°C, 10 min, remove the supernatant and keep the precipitate, which is DNA;

[0095] 7) Add 800 μL of 75% ethanol to the centrifuge tube and tap the tube wall to wash the DNA;

[0096] 8) 7500g, 4°C, 5 min, centrifuge to remove supernatant, and dry under reduced pressure to remove alcohol;

[0097] 9) Add 30-50 μL ddH2O to the tube containing DNA, measure the DNA concentration and purity, and store at -20°C for later use.

[0098] 3. Amplification of the cytochrome b gene PlCyt b of sensitive strains of litchi downy mildew

[0099] Primers PlCyt bF (5'-ATGAGATGGAATAAAAAATCATTATT TGCGGTTGT-3', SEQ ID NO: 1) and PlCyt bR (5'-TTATTTTTTATTAATATTATAACGTACTAAATAAGTTTCT-3', SEQ ID NO: 2) were used to amplify the full-length PlCyt b gene encoding litchi downy mildew.

[0100] PCR reaction system (20 μL reaction system): Easy Taq 0.5 μL, dNTPs 2 μL, Easy Taq Buffer 2 μL, PlCyt bF 0.8 μL (10 μM), PlCyt bR 0.8 μL (10 μM), genomic DNA 100 ng (1 μL), ddH2O to 20 μL. PCR reaction program is as follows: 94.0℃ for 3 min; then 94.0℃ for 30 s, 55℃ for 30 s, 72.0℃ for 80 s, 35 cycles; finally 72.0℃ for 10 min; stored at 12℃.

[0101] The PCR product was sequenced. The cytochrome b protein PlCyt b gene of the sensitive strain of litchi downy mildew fungus is 1155 bp in length, has no introns, and has a sequence as shown in SEQ ID NO: 14. The 370th nucleotide from the 5' end of SEQ ID NO: 14 is A (r=a) and the 372nd nucleotide from the 5' end is G (r=g), encoding an amino acid sequence as shown in SEQ ID NO: 13, and the 124th amino acid at the N-terminus of SEQ ID NO: 13 is methionine (X=M).

[0102] The above SEQ ID NO: 13 is as follows:

[0103]

[0104] Wherein, X (124th position from the amino terminal) = M or V or I.

[0105] The above SEQ ID NO: 14 is as follows:

[0106]

[0107] In SEQ ID NO: 14, the 370th nucleotide from the 5' end is r=a or g, and the 372nd nucleotide from the 5' end is r=a or g.

[0108] 4. Sequence Alignment

[0109] The full length of the PlCyt b gene of the resistant strains GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-2, FJFZ-34-3 and FJFZ-34-4 and the sensitive strains GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1 were sequenced. The sequences were analyzed and compared by DANMAN software, and two separate resistance mutation types, M124V and M124I, were found in the oxadiazine-resistant strains. The specific results are as follows:

[0110] In the sensitive strain, the 370th nucleotide from the 5' end of the genomic sequence of the gene PlCyt b is A (the 370th nucleotide from the 5' end of SEQ ID NO: 14 is A (r = a), and the 124th amino acid from the N-terminus of the corresponding PlCyt b protein is methionine (Met) (the 124th amino acid from the N-terminus of SEQ ID NO: 13 is methionine (X = M), while the 370th nucleotide from the 5' end of the genomic sequence of the gene PlCyt b in the resistant strains GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24 and FJFZ-34-4 is G (the 370th nucleotide from the 5' end of SEQ ID NO: 14 is r = g, and the 372nd nucleotide from the 5' end is r = g), and the corresponding PlCyt The 124th amino acid from the N-terminus of the PlCyt b protein is valine (Val) (the 124th amino acid from the N-terminus of SEQ ID NO: 13 is valine (X=V); the 372nd nucleotide from the 5' end of the genomic sequence of the gene PlCyt b in the resistant strains GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, FJFZ-34-2 and FJFZ-34-3 is A (the 370th nucleotide from the 5' end of SEQ ID NO: 14 is r=a, and the 372nd nucleotide from the 5' end is r=a), and the corresponding PlCyt b protein has an isoleucine (I) at the 124th amino acid from the N-terminus (the 124th amino acid from the N-terminus of SEQ ID NO: 13 is isoleucine (X=I) ( Figure 1 ).

[0111] The results showed that the resistant strain had two separate mutation types on the PlCyt b protein, namely, a point mutation from A to G at the 370th position from the 5' end of the genome (the 370th nucleotide from the 5' end of SEQ ID NO:14 was G (r=g) and the 372nd nucleotide from the 5' end was G (r=g)) and a point mutation from G to A at the 372nd position (the 370th nucleotide from the 5' end of SEQ ID NO:14 was A (r=a) and the 372nd nucleotide from the 5' end was A (r=a)). Analysis of the sequencing peak line graph showed an obvious single peak, and the changes of these two bases also resulted in the mutation of methionine at position 124 to valine and isoleucine, respectively, that is, the 124th amino acid at the N-terminus of SEQ ID NO:13 was valine (X=V); or the 124th amino acid at the N-terminus of SEQ ID NO:13 was isoleucine (X=I), two separate mutation types.

[0112] Example 4: Verification of resistance-related mutation sites in litchi downy mildew pathogen

[0113] 1. Sequence Alignment

[0114] The amino acid sequence of the PlCyt b protein of litchi downy mildew was sequenced in our laboratory. The crystal structure in the protein data bank (PDB) was searched using the Protein BLAST tool of NCBI. In the search results, the sequence identity between the crystal structure 6ZFU and the PlCyt b protein reached 52.73%, and 6ZFU contained a heme substrate structure. Therefore, the 6ZFU structure can be used as a template for constructing the PlCyt b structure.

[0115] 2. Homology Modeling

[0116] Based on the template protein three-dimensional structure file and sequence alignment file, the structural similarity was inferred from the sequence similarity, and the Modeller v9.19 program was used to perform homology modeling on the PlCyt b protein to obtain a reasonable three-dimensional structural model of the target protein, and the protein model was optimized by molecular mechanics.

[0117] The structure of the PlCyt b protein model was optimized using the Amber14 force field. The optimization process was carried out in two steps: first, 2000 steps of steepest descent optimization were performed, and then 2000 steps of conjugate gradient method were used to further optimize the structure. The final result was used as the model for subsequent analysis.

[0118] 3. Molecular Docking

[0119] The constructed PLCyt b protein and PLCyt b-M124V / I protein structures were subjected to molecular mechanics optimization and used as receptors for molecular docking. Molecular docking was implemented using the AutoDock4.2.6 software package. The structure of the substrate oxadiazine was obtained, hydrogenated, and the MOPAC program was used to optimize the structure and calculate the PM3 atomic charge. Finally, Autodock Tools1.5.6 was used to process the structures of the ligand and receptor respectively, and the docking box was wrapped around the active site. The number of grid points in the XYZ direction was set to 25.13×25.13×25.13, and the grid spacing was The antimycin A bound to the Qi site was used as the center of the docking box, the number of dockings was set to 200, and the other parameters used the default values.

[0120] 4. Results Analysis

[0121] 1) Interaction between oxathiapiprolin and PlCyt b protein and its mutant M124V

[0122] In order to analyze the driving force of the binding of oxathiapiprolin to PlCyt b protein and mutant M124V, the interaction pattern of oxathiapiprolin-protein was analyzed. Oxathiapiprolin is located in a hydrophobic pocket composed of seven amino acid residues, including Phe128, Gly142, Ile146, Ile268, Pro270, Phe274 and Glu271, of which Glu271 and oxathiapiprolin form a hydrogen bond, and Phe274 and oxathiapiprolin form a π-π bond ( Figure 2 A). It can stabilize the binding between oxathiapiprolin and PlCyt b, and the binding energy is -13.43 kcal / moL ( Figure 2 B). However, after the M124V point mutation occurred in the PlCyt b protein, oxathiapiprolin binds to the hydrophobic pocket composed of 9 amino acid residues, including Ile121, Phe128, Thr147, Ile146, Phe150, Leu164, Met294, Phe295 and Leu298, among which Phe128, Phe150, and Phe295 bind to oxathiapiprolin to form a π-π bond ( Figure 3 A). Although the number of amino acid residues involved in the molecular interaction increased, after the M124V mutation, due to the influence of steric hindrance, the posture of oxathiapiprolin changed, the hydrogen bond disappeared, and its binding energy with the target was reduced to -8.65kcal / moL ( Figure 3 B), thereby making the PlCyt b-M124V (the 124th amino acid at the N-terminus of SEQ ID NO: 13 is valine (X=V)) mutant strain show resistance.

[0123] 2) Interaction between oxathiapiprolin and PlCyt b protein and its mutant M124I

[0124] In order to analyze the driving force of the binding of oxathiapiprolin to PlCyt b protein and mutant M124I, the interaction pattern of oxathiapiprolin-protein was analyzed. Oxathiapiprolin is in a hydrophobic pocket composed of seven amino acid residues, including Phe128, Gly142, Ile146, Ile268, Pro270, Phe274 and Glu271, of which Glu271 and oxathiapiprolin form a hydrogen bond, and Phe274 and oxathiapiprolin form a π-π bond ( Figure 2 A). The binding energy between oxadiazine and PlCyt b is -13.43 kcal / moL ( Figure 2B). However, after the M124I point mutation occurred in the PlCyt b protein, oxathiapiprolin binds to the hydrophobic pocket composed of 9 amino acid residues, including Ile124, Phe128, Tyr131, Ile146, Pro270, Phe274, Phe295, Leu298 and Met294, among which Tyr131, Phe128 and Phe274 bind to oxathiapiprolin to form a π-π bond ( Figure 4 A). Although the number of amino acid residues involved in the interaction increased, after the M124I mutation, due to the influence of steric hindrance, the posture of oxadiazine changed, the interactive hydrogen bond disappeared, and its binding energy with the target was weakened to -10.79kcal / moL ( Figure 4 B), thereby making the PlCyt b-M124I (SEQ ID NO: 13 in which the 124th amino acid from the N-terminus is isoleucine (X=I) mutant strain show resistance.

[0125] V. Conclusion

[0126] Molecular docking was used to study the reasons why mutants M124V and M124I develop resistance. Molecular docking results showed that oxathiapiprolin can bind to the catalytic active site of the protein and bind near the heme. Mutation of Met124 to Val124 and / or Met124 to Ile124 can change the binding mode of oxathiapiprolin to the target. Although the number of surrounding amino acid residues involved in the interaction increases, the hydrogen bonds disappear, and the binding ability of oxathiapiprolin to the active center decreases, which makes the PlCyt b-M124V / M124I mutant strain show drug resistance.

[0127] Example 5: Method for detecting mutation sites in litchi downy mildew pathogen

[0128] 1. Primer Design

[0129] The strain was the strain used in Example 1, and the primers were as shown in Table 2. Allele Specific-PCR primers were designed according to the sequence of the mutant PlCyt b gene, and the last base at the 3'-end of the reverse primer was consistent with the mutated base. In order to increase the specificity of the primer, mismatched bases A, T, G and C were introduced at the second base at the 3'-end of the reverse primer, respectively; the forward primers were as shown in Table 2.

[0130] Table 2. Primers used in AS-PCR detection of litchi downy mildew pathogens to oxadiazon

[0131] Primers Sequence (5'-3') M124V-R1 AAACATAACCCATAAATGCAGTAGCCAC(SEQ ID NO:3) M124V-R2 AAACATAACCCATAAATGCAGTAGCCTC(SEQ ID NO:4) M124V-R3 AAACATAACCCATAAATGCAGTAGCCGC(SEQ ID NO:5) M124V-R4 AAACATAACCCATAAATGCAGTAGCCCC(SEQ ID NO:6) M124V-F ATGAGATGGAATAAAAAATCATTATTTGC(SEQ ID NO:7) M124I-R1 AGGTAAAACATAACCCATAAATGCAGTAGCT(SEQ ID NO:8) M124I-R2 AGGTAAAACATAACCCATAAATGCAGTAGAT(SEQ ID NO:9) M124I-R3 AGGTAAAACATAACCCATAAATGCAGTAGTT(SEQ ID NO:10) M124I-R4 AGGTAAAACATAACCCATAAATGCAGTAGGT(SEQ ID NO:11) M124I-F TCATCCAGATTTACGAAGAATTTTAACTGA(SEQ ID NO:12)

[0132] In this method, the last base at the 3'-end of the downstream primer is consistent with the mutant, the penultimate base is also changed at the same time, and amplification is performed in combination with different annealing temperatures to improve primer specificity.

[0133] The PCR reaction system is as follows:

[0134] 20μL PCR system: Easy Taq 0.5μL, dNTPs 2μL, Easy Taq Buffer 2μL, M124V / M124I-R (1 / 2 / 3 / 4) 0.8μL (10μM), M124V / IM124-F 0.8μL (10μM), genomic DNA 100ng (1μL), ddH2O to 20μL.

[0135] The PCR reaction conditions were as follows: 94°C for 3 min first; then 94°C for 30 s, 55-65°C for 30 s, 72°C for 45 s, 35 cycles; finally 72°C for 10 min; and stored at 12°C.

[0136] The results of PCR product amplification showed that M124V-R2, R3 and R4 could amplify a 372 bp band from the resistant strain at an annealing temperature of 65°C, but could not amplify a band from the sensitive strain ( Figure 5 B / C / D), considering the primer specificity, M124V-R2 / M124V-F was selected. Primers M124I-R1 and R2 could not distinguish between resistant strains and sensitive strains at an annealing temperature of 55-65°C ( Figure 6 A / B). M124I-R3 and R4 were able to amplify a 505 bp band from the resistant strain at an annealing temperature of 63°C, but could not amplify a band from the sensitive strain ( Figure 6 C / D), considering the primer specificity, M124I-R3 / M124I-F was selected. The above results show that the primer pairs M124V-R2 / M124V-F and M124I-R3 / M124I-F can detect the M124V and M124I resistance sites respectively, so the primer pairs M124V-R2 / M124V-F (65°C) and M124I-R3 / M124I-F (63°C) were selected as AS-PCR primers to detect the above mutation sites. The amplification product of primer M124V-R2 / M124V-F is nucleotides 1-372 in SEQ ID NO: 14; the amplification product of primer M124I-R3 / M124I-F is 133bp upstream of Plcyt b to nucleotides 1-372 of Plcyt b.

[0137] Detection of mutation sites

[0138] The genomic DNA of the litchi downy mildew pathogen to be tested is used as a template, and PCR amplification is performed with primer pairs M124V-R2 / M124V-F and M124I-R3 / M124I-F, and then agarose gel electrophoresis is performed. If a fragment can be amplified from the genomic DNA of the strain, the strain is determined to be a resistant strain. If a fragment cannot be amplified, the tested litchi downy mildew strain is determined to be a sensitive strain.

[0139] The PCR amplification system and reaction conditions were consistent with those in the experiment, the annealing temperature of the primer pair M124V-R2 / M124V-F was 65°C, and the annealing temperature of the primer pair M124I-R3 / M124I-F was 63°C.

[0140] The strains to be tested for the primer pair M124V-R2 / M124V-F are: resistant strains GDHZ-6-10, FJZZ-1-11, FJZZ-1-17, FJZZ-1-24, FJFZ-34-4, GDHZ-6-7 and GDHZ-6-8, among which GDHZ-6-7 and GDHZ-6-8 are resistant strains carrying the M124I point mutation; sensitive strains GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1.

[0141] The strains to be tested for the primer pair M124I-R3 / M124I-F are: resistant strains GDHZ-6-7, GDHZ-6-8, GDHZ-6-9, FJFZ-34-2, FJFZ-34-3 and FJZZ-1-11, FJZZ-1-17, among which FJZZ-1-11 and FJZZ-1-17 are resistant strains carrying the M124V point mutation; sensitive strains GDHZ-5, GDHZ-6, FJZZ-1, FJFZ-34 and HN10-1.

[0142] The results showed that the primer pair M124V-R2 / M124V-F could only amplify a 372 bp fragment from the resistant strain at an annealing temperature of 65°C, but could not amplify a band from the sensitive strain ( Figure 7 ). The primer pair M124I-R3 / M124I-F can only amplify a 505 bp fragment from the resistant strain at an annealing temperature of 63°C, but cannot amplify a band from the sensitive strain ( Figure 8 ).

[0143] Therefore, the primer pairs M124V-R2 / M124V-F and M124I-R3 / M124I-F can be used to effectively detect the resistant strains of litchi downy mildew to oxadiazon at 65°C and 63°C, respectively.

Claims

1. A protein related to resistance of litchi downy mildew to oxadiazine, which is a protein consisting of the amino acid residue sequence of SEQ ID NO: 13 in the sequence table; wherein, The 124th amino acid from the N-terminus of SEQ ID NO: 13 is valine or isoleucine.

2. The gene encoding the protein related to the resistance of litchi downy mildew to famoxadone as claimed in claim 1.

3. The coding gene according to claim 2, characterized in that: The cDNA nucleotide sequence of the encoding gene is shown in SEQ ID NO: 14 in the sequence listing; wherein, SEQ ID NO: 14 has r=g at the 370th nucleotide from the 5' end, and r=g at the 372nd nucleotide from the 5' end, or SEQ ID NO: 14 has r=a at the 370th nucleotide from the 5' end, and r=a at the 372nd nucleotide from the 5' end.

4. An expression cassette, a recombinant expression vector or a transgenic recombinant bacterium containing the coding gene according to claim 2 or 3.

5. Application of cytochrome b protein of litchi downy mildew or its encoding gene in identifying drug resistance of litchi downy mildew; by detecting whether the 124th amino acid from the N-terminus of cytochrome b protein of litchi downy mildew changes from methionine to valine or whether the 124th amino acid from the N-terminus changes from methionine to isoleucine, the above changes will increase the resistance of litchi downy mildew to oxadiazine; wherein, The mutated cytochrome b protein of litchi downy mildew pathogen is the protein according to claim 1; By detecting that the nucleotide at position 370 from the 5' end of the coding gene of the cytochrome b protein of the litchi downy mildew pathogen is G or the nucleotide at position 372 from the 5' end is A, if position 370 mutates to G or position 372 mutates to A, its resistance to oxadiazine is improved; the mutated coding gene of the cytochrome b protein of the litchi downy mildew pathogen is the coding gene shown in claim 3.

6. A primer set for detecting or assisting in detecting whether there is a mutation site in the cytochrome b gene in litchi downy mildew pathogen, consisting of a DNA molecule shown in SEQ ID NO: 4 and a DNA molecule shown in SEQ ID NO: 7 in the sequence listing, or a DNA molecule shown in SEQ ID NO: 10 and a DNA molecule shown in SEQ ID NO: 12 in the sequence listing.

7. Use of the primer set of claim 6 in identifying drug resistance of litchi downy mildew; the drug resistance is the drug resistance of litchi downy mildew to oxadiazine; by detecting whether the 124th amino acid from the N-terminus of the cytochrome b protein of litchi downy mildew changes from methionine to valine or whether the 124th amino acid from the N-terminus changes from methionine to isoleucine, the above changes will increase the resistance of litchi downy mildew to oxadiazine; wherein, The mutated cytochrome b protein of litchi downy mildew pathogen is the protein according to claim 1.

8. A method for detecting or assisting in detecting whether there is a mutation site in the cytochrome b gene in litchi downy mildew fungus, comprising the following steps: Using the genomic DNA of the litchi downy mildew pathogen to be tested as a template, PCR amplification is performed using a primer pair consisting of the fragment shown in SEQ ID NO: 4 and the fragment shown in SEQ ID NO: 7, or a primer pair consisting of the fragment shown in SEQ ID NO: 10 and the fragment shown in SEQ ID NO:

12. If the primer pair consisting of the fragment shown in SEQ ID NO: 4 and the fragment shown in SEQ ID NO: 7 can amplify a 372 bp band, or the primer pair consisting of the fragment shown in SEQ ID NO: 10 and the fragment shown in SEQ ID NO: 12 can amplify a 505 bp band, then the cytochrome b gene in the litchi downy mildew pathogen to be tested has a mutation site or a candidate has a mutation site; The mutation site refers to the mutation of the 370th nucleotide from the 5' end to G or the mutation of the 372nd nucleotide from the 5' end to A in the cytochrome b gene of the litchi downy mildew pathogen, thereby causing the 124th amino acid from the N-terminus of the cytochrome b protein of the litchi downy mildew pathogen to change from methionine to valine or from methionine to isoleucine; The mutated litchi downy mildew pathogen cytochrome b protein is shown in SEQ ID NO: 13, wherein: The 124th amino acid from the N-terminus of SEQ ID NO: 13 is valine or isoleucine; the cytochrome b gene in the litchi downy mildew pathogen after the mutation is as shown in SEQ ID NO: 14, wherein the 370th nucleotide from the 5' end of SEQ ID NO: 14 is r=g, and the 372nd nucleotide from the 5' end is r=g, or the 370th nucleotide from the 5' end of SEQ ID NO: 14 is r=a, and the 372nd nucleotide from the 5' end is r=a.

9. The method according to claim 8, characterized in that In the PCR amplification, the annealing temperature of SEQ ID NO: 4 and SEQ ID NO: 7 is 65°C, and the annealing temperature of SEQ ID NO: 10 and SEQ ID NO: 12 is 63°C.

10. Use of the method of claim 8 or 9 in identifying the drug resistance of litchi downy mildew; the drug resistance is the resistance of litchi downy mildew to oxadiazine.

Images