A method for improving the specificity of CRISPR / Cas12a SNV detection system and its application in detecting new coronavirus

Abstract

The present invention discloses a method for improving the specificity of CRISPR / Cas12a SNV detection system, in which crRNA is modified by truncating the Spacer sequence portion in crRNA and introducing a wobble base mismatch at a specific position in the Spacer sequence after truncation. The present invention transforms crRNA, firstly truncating Spacer, and after truncation, the specificity can be improved without affecting the sensitivity, but the effect of this specificity improvement on different targets and different positions is inconsistent. Therefore, in order to further improve the specificity and universality, a wobble base mismatch is introduced at a specific position in the Spacer after truncation, which will form a 'double mismatch versus single mismatch strategy', so that the single base mismatch tolerance of the target is reduced, and the detection signal of the single base mutation of the target will be further reduced, resulting in the specificity of each position on the target being further improved.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection technology, and specifically relates to a method for improving the specificity of a CRISPR / Cas12a SNV detection system and its application in detecting the new coronavirus. Background Art

[0002] In recent years, the CRISPR / Cas system derived from the adaptive immune mechanism of prokaryotes has brought revolutionary breakthroughs in in vivo gene editing technology and shined in the field of in vitro diagnosis with its strong development, simplicity and high efficiency. The CRISPR-related proteins Cas9 and Cas12a are the two most influential and widely used members. They can bind to the protospacer-adjacent motif (PAM) in the genome to cause the local opening of the double-stranded DNA (dsDNA) target, so that the guide RNA (guide RNA) forms Watson-Crick base pairing with the template strand of the dsDNA target, and finally forms an R-loop structure, which triggers the structural rearrangement of the Cas nuclease domain, activates its cis-cutting activity, and causes double-stranded DNA breaks to achieve the purpose of gene editing.

[0003] Unlike Cas9, Cas12a only requires a single CRISPR RNA (crRNA) as a gRNA target; and it can identify and cut single-stranded DNA (ssDNA) targets that do not require a PAM motif. In addition, the CRISPR / Cas12a system can activate its trans cleavage activity after loading the target, non-specifically cutting nearby single-stranded DNA (ssDNA) molecules. Based on this characteristic, ssDNA with fluorescent reporter groups and quencher groups is introduced as a reporter probe molecule. When the target DNA and crRNA form an R-loop structure to activate Cas12a, the reporter probe molecule is cut and the fluorescent signal is released, so that it can be applied to nucleic acid detection and biosensing. In order to achieve highly sensitive molecular detection, it is usually necessary to combine target nucleic acid pre-amplification technology with CRISPR detection technology. Combining CRISPR / Cas12a detection with RPA isothermal amplification technology can achieve amplification and detection of nucleic acids at a constant temperature of 37°C. This feature is of great value for the development of simple nucleic acid detection methods and instruments. Several CRISPR / Cas12a-based diagnostic technologies have been developed, such as DETECTR, HOLMES, and others.

[0004] As we all know, the detection of single-nucleotide variation (SNV) is of great significance for the diagnosis of genetic diseases, cancer and pathogen variants. However, the specificity of Cas12a has been controversial, although it has been reported that the cis-cleavage activity specificity of Cas12a in vivo and in vitro is higher than that of Cas9, especially in the PAM-proximal region. But there is still a lot of evidence that the cis-cleavage activity of Cas12a not only has a high tolerance for single mismatches, but can even tolerate multiple mismatches. The trans-cleavage activity specificity of Cas12a is also poor, and single-base mutations cannot be distinguished. In general, the specificity of Cas12a is not satisfactory, and the signal-to-noise ratio between the wild type and the single-base mutant is very low or even non-existent, which cannot meet the requirements of SNV diagnosis and is a bottleneck for its promotion and application.

[0005] The way to improve the specificity of the CRISPR / Cas12a system is mainly through the modification of the Cas12a enzyme or crRNA sequence. Compared with the cumbersome modification and screening of the Cas enzyme, modifying its crRNA sequence is a simpler strategy. At present, the modification is mainly carried out in the following ways: ① Chemical modification of part of the crRNA sequence; ② Truncation of the length of crRNA; ③ Changing the secondary structure of crRNA; ④ Replacing part of the crRNA sequence with DNA bases; ⑤ Introducing additional mismatched bases into crRNA; ⑥ Inserting or deleting bases in the crRNA and target pairing region to form a DNA-RNA vacuolar structure.

[0006] Although there are several ways to improve specificity by modifying crRNA, there are still some shortcomings. ① The improvement in specificity is not significant, and the signal-to-noise ratio of some target mutants to wild types is less than 5 times. ② There is a trade-off between sensitivity and specificity. For example, although chemically modified gRNA improves specificity, its cis-cutting activity for some targets is attenuated to a certain extent. ③ The universality is limited. The positions of crRNA that need chemical modification for different targets are different; the positions where additional mismatched bases are most suitable for different targets are different. Therefore, CRISPR / Cas12a SNV detection technology urgently needs to significantly improve its specificity while maintaining its sensitivity and expanding its versatility. Summary of the invention

[0007] A method for improving the specificity of the CRISPR / Cas12a SNV detection system, using the following technical solution:

[0008] A method for improving the specificity of a CRISPR / Cas12a SNV detection system, wherein crRNA is modified by truncating a Spacer sequence portion in the crRNA and introducing a wobble base mismatch at a specific position in the truncated Spacer sequence.

[0009] In order to improve the specificity of cas12a trans-cutting and effectively maintain its sensitivity, the present invention transforms crRNA, firstly truncating the spacer, which can improve the specificity without affecting the sensitivity, but the effect of this specificity improvement is inconsistent for different targets and different positions. Therefore, in order to further improve the specificity and universality, the introduction of the wobble base mismatch at a specific position in the truncated spacer will form a 'double mismatch versus single mismatch strategy', which reduces the single base mismatch tolerance of the target, and the detection signal of the single base mutation of the target will be further reduced, resulting in further improvement of the specificity of each position on the target.

[0010] Preferably, the Spacer sequence is partially truncated by 2 to 4 bp at the 3' end of the Spacer sequence; and a wobble base mismatch is introduced at the 14th position in the Spacer sequence after truncation.

[0011] More preferably, the truncation of the Spacer sequence portion is 3 bp at the 3' end of the Spacer sequence.

[0012] Preferably, the crRNA is modified in the following specific steps: find the A or C base at the closest distance to the mutation position of the target non-template chain, within +2bp or -2bp of the mutation position, defined as the 14th position relative to PAM, shorten the length of the crRNAspacer to 17bp, and then change the 14th base on the spacer to U or G, and introduce a wobble base mismatch at the 14th position in the spacer-TS DNA heteroduplex.

[0013] Preferably, a method for improving the specificity of the CRISPR / Cas12a SNV detection system, in which the PAM sequence TTTV, V=A / C / G of Cas12a is introduced into the RPA upstream primer.

[0014] Since Cas12a is PAM-dependent in recognizing double-stranded target sequences, and the introduction of wobble base pairing in the crRNA modification method limits the distance to PAM, which easily leads to a narrowing of the detectable sequence range, the PAM sequence TTTV of Cas12a is introduced into the RPA upstream primer in the present invention, which can get rid of the limitation on the distance to PAM and ensure the detectable sequence range.

[0015] Further preferably, the PAM sequence TTTV of Cas12a is introduced at positions 4-14 of the 3' end of the RPA upstream primer.

[0016] Preferably, a method for improving the specificity of the CRISPR / Cas12a SNV detection system is provided, in which glycerol is added to the detection system.

[0017] Adding glycerol to the detection system of the present invention can slow down the fusion of RPA and CRISPR systems and avoid aerosol contamination, thereby achieving one-tube detection.

[0018] The application of the method for improving the specificity of the CRISPR / Cas12a SNV detection system in the detection of new coronavirus.

[0019] A method for improving the specificity of a CRISPR / Cas12a SNV detection system is used in the detection of BA5.2 novel coronavirus T1050N as a target, comprising the following steps:

[0020] S1: According to the viral T1050N target sequence, crRNA was designed. The crRNA is shown in SEQ ID NO.1 in the sequence table, specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaugaaa-3', where the lowercase letter part is the Spacer sequence;

[0021] S2: The 3' end of the Spacer sequence in the crRNA in step S1 is truncated by 3 bp, and the truncated crRNA is shown in the sequence SEQ ID NO.2 in the sequence list, specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaug-3'; then the 14th A in the truncated Spacer sequence is changed to G to obtain the modified crRNA (SNV crRNA), and the modified crRNA is shown in the sequence SEQ ID NO.3 in the sequence list, specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguGaug-3';

[0022] S3: According to the target site of T1050N, the RPA upstream primer and downstream primer are respectively shown in the sequence SEQ ID NO.4 and the sequence SEQ ID NO.5, which are as follows: 5'-tgctggtgattacattttagctaacacctg-3'; R: 5'-ccaacttcccatgaaagatgtaattctctg-3'; insert the base at the 13th position of the 3' end of the RPA upstream primer to introduce the PAM sequence TTTC, and obtain the modified RPA upstream primer; the sequence of the modified RPA upstream primer is shown in the sequence SEQ ID NO.6 in the sequence table, which is as follows F: 5'-tgctggtgattacatTTTCagctaacacctg-3';

[0023] S4: Add the modified crRNA, RPA upstream primer, RPA downstream primer and glycerol to the CRISPR / Cas12a system to obtain a highly specific CRISPR / Cas12a SNV detection system with T1050N as the target.

[0024] A method for improving the specificity of a CRISPR / Cas12a SNV detection system is used in the detection of XBB novel coronavirus Q183E as a target, comprising the following steps:

[0025] S1: According to the viral Q183E target sequence, crRNA was designed. The crRNA is shown in SEQ ID NO.7 in the sequence list, specifically as follows: 5'-UAAUUUCUAAGUGUAGAUgaccuugaaggaaaagaggg-3', where the lowercase letter part is the Spacer sequence;

[0026] S2: The 3' end of the Spacer sequence in the crRNA in step S1 is truncated by 3 bp, and the truncated crRNA is shown in the sequence SEQ ID NO.8 in the sequence list, specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaaga-3'; then the 14th A in the truncated Spacer sequence is changed to G to obtain the modified crRNA (SNV crRNA), and the modified crRNA is shown in the sequence SEQ ID NO.9 in the sequence list, specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaGaga-3';

[0027] S3: According to the target site of Q183E, the RPA upstream primer and downstream primer are respectively shown in SEQ ID NO.10 and SEQ ID NO.11, which are as follows: F: 5'-atgtctctcagccttttcttatggaccttg-3'; R: 5'-gtgatgttaatacctattggcaaatctacc-3'; a base is inserted into the 13th position of the 3' end of the RPA upstream primer to introduce the PAM sequence TTTG, so as to obtain the modified RPA upstream primer; the sequence of the modified RPA upstream primer is shown in SEQ ID NO.12 in the sequence table, which is as follows: F: 5'-atgtctctcagccttttcttaTTTGgaccttg-3';

[0028] S4: Add the modified crRNA, RPA upstream primer, RPA downstream primer and glycerol to the CRISPR / Cas12a system to obtain a highly specific CRISPR / Cas12a SNV detection system with Q183E as the target.

[0029] Beneficial effects of the present invention:

[0030] 1. In the present invention, by modifying the Spacer sequence of crRNA, the specificity of detection can be greatly improved without substantially reducing the sensitivity, and the detection has universal applicability.

[0031] In the present invention, the PAM sequence is introduced into the RPA primer to break through the limitation of PAM and avoid the position requirement of the wobble base; and the glycerol additive is used to make it one-tube, avoiding aerosol pollution and cumbersome operation, so that its promotion and application are not limited. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the secondary structure of crRNA.

[0033] Figure 2 Cas12a trans-cleavage activity effect diagram of modified and unmodified crRNA in Example 1.

[0034] Figure 3 It is a graph showing the analytical sensitivity test results of the 7 modified crRNAs and unmodified crRNAs selected in Example 1, wherein a: M37; b: M39; c: M42+M43; d: M45; e: M48; f: M63; g: M65; h: unmodified crRNA (control). Figure 4It is the non-template chain sequence used to evaluate the mismatch tolerance of the modified crRNA to the CPSIT_0429 target in Example 1, wherein mut1-20 contains a single target site mismatch (single mutation target sequence), and mut21-29 contains two adjacent target site mismatches (adjacent double mutation target sequences).

[0035] Figure 5 This is a result diagram for evaluating the mismatch tolerance of the modified crRNA to the CPSIT_0429 activator in Example 1; the result is the fluorescence value increased within 1 hour of the mutated target sequence divided by the fluorescence value increased within 1 hour of the unmutated target sequence.

[0036] Figure 6 This is a result graph of the multiple increase in the corresponding site specificity of the modified crRNA after the double mismatch versus single mismatch strategy is implemented in Example 1; the result is the fluorescence value increased within 1 hour of the single-base mutation target sequence divided by the fluorescence value increased within 1 hour of the adjacent double mutation target sequence.

[0037] Figure 7 It is the non-template chain sequence used to evaluate the tolerance of the modified crRNA to the D614G and R346T target site mismatches in Example 2; wherein mut1-20 contains a single target site mismatch (single mutation target sequence), and mut21-29 contains two adjacent target site mismatches (adjacent double mutation target sequences).

[0038] Figure 8 It is the trans-cleavage activity of the three target crRNA spacers in Example 2 after being truncated to different lengths. The result is the fluorescence value increased within 1 hour after the spacers are truncated to different lengths divided by the fluorescence value increased within 1 hour after the 20 bp spacer is truncated to different lengths.

[0039] Fig. 9 This is a graph showing the effect of different crRNA spacer truncation lengths on the mismatch tolerance of the CPSIT_0429 activator in Example 2; the result is the fluorescence value increased within 1 hour of the mutated target sequence divided by the fluorescence value increased within 1 hour of the unmutated target sequence.

[0040] The result graph of the fold increase in the corresponding site specificity after the double mismatch versus single mismatch strategy was implemented on the CPSIT_0429 activator after crRNA spacer was truncated to different lengths in Example 2; the fluorescence value increased within 1 hour of the single-base mutation target sequence was divided by the fluorescence value increased within 1 hour of the adjacent double mutation target sequence.

[0041] Fig.10This is a graph showing the mismatch tolerance of the D614G activator to different lengths of crRNA spacer truncation in Example 2; the result is the fluorescence value increased within 1 hour of the mutated target sequence divided by the fluorescence value increased within 1 hour of the unmutated target sequence.

[0042] Fig.11 This is a graph showing the effect of crRNA spacer truncation of different lengths on R346T activator mismatch tolerance in Example 2; the result is the fluorescence value increased within 1 hour of the mutated target sequence divided by the fluorescence value increased within 1 hour of the unmutated target sequence.

[0043] Fig.12 The sensitivity analysis results of Example 2 when different target activators are present, with a spacer of 20 bp and a truncation of 17 bp; wherein (a) CPSIT_0429 17 bp; (b) D614G 20 bp; (c) D614G 17 bp; d) R346T 20 bp; (e) R346T 17 bp; and NTC is blank.

[0044] Fig.13 This is a graph showing the increase in fluorescence values ​​within 1 hour for matching and mismatching target sequences when crRNAspacer is truncated to different lengths in Example 2.

[0045] Fig.14 It is the non-template sequence (NTS-DNA sequence) of the three targets in Example 3, mainly the single mutation T14C or T14A at position 14 of the non-template sequence; and the double mutation sequence: CPSIT_0429 (T14C&C1A~T14C&C17A; T14A&C1A~T14A&C17A); D614G (T14C&T1C~T14C&A17G; T14A&T1C~T14A&A17G); R346T (T14C&A1G~T14C&A17G; T14A&A1G~T14A&A17G).

[0046] Fig.15 The sensitivity results of introducing wobble base mismatches (rU-dG) at different positions of crRNA with three targets truncated to 17 bp in Example 3; (a) CPSIT_0429 14th position T14C; (b) CPSIT_0429 11th position T11C; (c) D614G 14th position T14C; (d) D614G 9th position T9C; e) R346T 14th position T14C; (f) R346T 12th position T12C; NTC is blank.

[0047] Fig.16This is a graph showing the mismatch tolerance results of crRNAs of different lengths (20 bp to 15 bp) for three targets in Example 3, with different mutant bases (T14C, T14A, T14G) introduced at position 14 of the non-template strand of the target.

[0048] Fig.17 The trans-cleavage activity diagram of 16 RNA-DNA base pairing combinations introduced at the 14th position of the spacer and TS DNA hybrid double strand in the case of 3 target sites and spacer 17bp in Example 3.

[0049] Fig.18 The sensitivity results of introducing wobble base mismatches (rG-dT) at different positions of crRNA with three targets truncated to 17 bp in Example 3; (a) CPSIT_0429 14th position T14A; (b) CPSIT_0429 9th position G9A; (c) D614G 14th position T14A; (d) D614G 15th position G15A; e) R346T 14th position T14A; (f) R346T 10th position G10A; NTC is blank.

[0050] Fig.19 This is a graph showing the specificity evaluation results of crRNA (SNV crRNA) after the double mutation non-template sequence is modified for three targets in Example 3.

[0051] Fig. 20 This is a result diagram showing the effect of the distance between another mutation in the double mutation non-template sequence and position 14 on specificity in Example 3.

[0052] Fig.21 The optimal iterative design flow chart of the modified crRNA obtained in Example 3.

[0053] Fig. 22 Schematic diagram of the process of RPA upstream primer modification in Example 4.

[0054] Fig.23 This is a comparison result of the sequencing sequence and the expected sequence after the PAM sequence was introduced into the upstream primers of the three target RPAs in Example 4.

[0055] Fig.24 This is a diagram showing the amplification results of introducing the PAM sequence into the RPA upstream primer of the CPSIT_0429 target in Example 4.

[0056] Fig.25 This is a diagram showing the amplification results of introducing the PAM sequence into the RPA upstream primer of the D614G target in Example 4.

[0057] Fig.26 This is a diagram showing the amplification results of introducing the PAM sequence into the RPA upstream primer of the R346T target in Example 4.

[0058] Fig. 27 For Example 4 Fig.24 Sensitivity results of the RPA upstream primers marked in the figure.

[0059] Fig.28 This is a graph showing the evaluation results of the effects of different concentrations of glycerol on the one-tube RPA-CRISPR / Cas12a detection system for the CPSIT_0429 target in Example 4.

[0060] Fig.29 This is a graph showing the sensitivity results of the RPA-CRISPR / Cas12a detection system containing 20% ​​glycerol and one tube also containing glycerol for the three targets in Example 4.

[0061] Fig.30 Schematic diagram of the iterative modification of crRNA for the T1050N and Q183E targets in Example 5.

[0062] Fig.31 The results of the trans-cleavage activity and sensitivity of SNV crRNA (modified crRNA) and WT crRNA (unmodified crRNA) for the synthetic simulated template in Example 5 are shown in Figure (a): trans-cleavage activity of SNV crRNA (modified crRNA) and WT crRNA (unmodified crRNA) for the synthetic simulated template (including mutant templates and non-mutated templates); (b) one-tube detection sensitivity result diagram of SNV crRNA of the corresponding target for the simulated template; (c) one-tube detection sensitivity result diagram of WT crRNA of the corresponding target for the simulated template.

[0063] Fig.32 Schematic diagram of the detection process of a tube-based detection system in Example 5.

[0064] Fig.33 The figures are result graphs showing the evaluation of 60 clinical SARS-COV-2 samples (30 strains of BA.5.2 and XBB variants verified by NGS) using the corresponding SNV crRNA and WT crRNA one-tube detection system in Example 5; and graphs showing the consistency of the detection results and the NGS verification results in Example 5; (a) graph of evaluation results; (b) graph of consistency results.

[0065] Fig.34 The results of ROC test analysis using the corresponding SNV crRNA and WT crRNA integrated detection system for T1050N and Q183E targets in Example 5 are shown; (a) Q183E; (b) T1050N. DETAILED DESCRIPTION

[0066] The detection preparation process of the CRISPR / Cas12a SNV detection system in the present invention is as follows:

[0067] In the one-pot reaction system, components A and B were prepared in advance. Component A is the RPA system, and 29.5 μL of Primer Free Rehydration buffer, 11.2 μL of nuclease-free water, and 2.4 μL of each RPA upstream and downstream primer (10 μM) were added to the Eppendorf tube. The mixture was then added to a reaction tube containing freeze-dried RPA enzyme, followed by 2 μL of template DNA. The tube was rotated and centrifuged. Component B consisted of 1 μL of LbCas12a (5 μM), 1 μL of crRNA (5 μM), 2 μL of ssDNA-FQ reporter (5 μM), 5 μL of NEBuffer 2.1 (10×), an appropriate amount of 50% glycerol (v / v), and nuclease-free water, with a total volume of 50 μL. After the mixture was rotated and centrifuged, 10 μL of component B was added to the bottom of the reaction tube, and 9 μL of component A and 1 μL of magnesium acetate (280 nM) were added to the side of the reaction tube. The reaction tubes were capped and placed in a centrifuge for slow and brief centrifugation, and then placed on the ABIQ5 instrument at 37°C for 1 hour. Fluorescence values ​​were collected and recorded every minute.

[0068] Example 1: Experimental study on the modification of crRNA sequence

[0069] CrRNA is an RNA molecule with a secondary structure. The 5' end contains the scaffold sequence necessary for cas12a binding, including Scaffold, Stem and Loop sequences, and the 3' end contains a spacer sequence that is complementary to the 20bp target gene base pairing. The specific structure can be seen Figure 1 In the present invention, the Scaffold sequence is UAAUU...U (where the ellipsis part is the Stem and Loop sequence); Figure 1 It can be seen that the Stem sequence is a double-stranded structure, and the sequence is The loop sequence is UAAGU.

[0070] In this example, the CPSIT_0429 gene (a specific target for detecting Chlamydia psittaci) was selected as the target, and the crRNA sequence was designed. The specific sequence is shown in Table 1.

[0071] The uppercase letters in M35 (unmodified crRNA) (UAAUU...U is the Scaffold sequence, UAAGU is the Loop sequence, the lowercase letters (cauagagaguucuuuacuac) is the Spacer sequence, and Stem is the chain structure. The specific sequence can be seen Figure 1). M36, M37, and M38 are respectively deleted 1bp, 2bp, and 3bp at the 5' end of the scaffold part of the M35 sequence; M39 is deleted 1bp at the 3' end of the scaffold part of the M35 sequence; M40 is added a hairpin structure at the 3' end of the scaffold part of the M35 sequence.

[0072] M41+M42 are two RNA molecules formed after the 5' and 3' ends of the loop part of the M35 sequence are broken; M42+M43 are two RNA molecules formed after the 3' end of the loop part of the M35 sequence is broken. M44 is a 1bp deletion (UAGU) in the middle of the basic loop sequence of M35; M45 is a 3bp deletion (UU) in the middle of the basic loop sequence of M35; M46 is a complete deletion of the loop sequence based on M35.

[0073] M47 is a mismatch of the bottom base pair of the Stem part of the M35 sequence; M48 is a mismatch of the top base pair of the Stem part of the M35 sequence; M49 is a deletion of the bottom base pair of the Stem part of the M35 sequence; M50 is a deletion of the top base pair of the Stem part of the M35 sequence; M51 is an extension of the Stem part of the M35 sequence by 2 base pairs; M52 is an extension of the Stem part of the M35 sequence by 4 base pairs; M53 is a replacement of the AU base pair of the Stem part of the M35 sequence with GC; M54 is a replacement of the GC base pair of the Stem part of the M35 sequence with AU.

[0074] M55 adds a hairpin structure to the 5' end based on M35; M56 adds a 5bp back-blocking to the 5' end based on M35; M57 adds a 3bp back-blocking to the 5' end based on M35; M58 adds a 2bp back-blocking to the 5' end based on M35; M59 adds a 7bp back-blocking to the 5' end based on M35; M60 adds a hairpin structure to the 3' end based on M35; M61 adds a 5bp back-blocking to the 3' end based on M35; M62 adds a 10bp back-blocking to the 3' end based on M35; M63 adds a 15bp back-blocking to the 3' end based on M35; M64 adds a 20bp back-blocking to the 3' end based on M35.

[0075] M65 is based on M35, the 3' end of the Spacer sequence is shortened by 2bp; M66 is based on M35, the 3' end of the Spacer sequence is shortened by 4bp; M67 is based on M35, the 3' end of the Spacer sequence is shortened by 6bp; M68 is based on M35, the 3' end of the Spacer sequence is increased by 2bp; M69 is based on M35, the 3' end of the Spacer sequence is increased by 4bp; M70 is based on M35, the 3' end of the Spacer sequence is increased by 6bp. The specific sequence information of M35-70 can be seen in Table 1.

[0076] Table 1

[0077]

[0078]

[0079] The effect of designed crRNA (sequences M35 to M70) on the trans-cleavage activity of Cas12a was preliminarily determined (the fluorescence increase within 1 h of modified and unmodified crRNA in the presence of CPSIT_0429 activator). Figure 2 , reducing the reaction activity of Cas12a will increase the specificity, but too low a reaction activity cannot be used for detection. Therefore, seven crRNA mutants with less effect on trans-cleavage activity in sequences M35 to M70 were selected for the next experiment, specifically M37, M39, M42+43, M45, M48, M63 and M65.

[0080] The non-template strand sequence of the CPSIT_0429 activator target used to evaluate the modified crRNA is available Figure 4 (The left end TTTG is the PAM sequence) is used to detect the sensitivity and specificity of the modified crRNA. Figure 4 The sensitivity test of the modified crRNA screened above was performed using the non-mutated non-template chain sequence (WT). The results show that Figure 3 Except for the detection limit of M65 transformation which is consistent with that of the wild type, other transformations have a certain degree of influence on the detection limit.

[0081] use Figure 4 The non-template strand sequence (mut1-39) of the single-base mutation and adjacent double-base mutation target was used to detect the specificity of the modified crRNA. Figure 5; From the results, it can be seen that the specificity improvement of crRNA modification is position-dependent and insignificant. The signal-to-noise ratio between the wild type and mutant in the PAM proximal region and PAM distal region is small, which is more obvious at positions 12 and 13 relative to PAM. Among them, the signal-to-noise ratio between the wild type and mutant at position 12 relative to PAM of M65 modification is the best, but it is only 10 times.

[0082] Compared with single-base mutation targets, the mismatch tolerance of the modified crRNA for adjacent double-base mutation targets drops sharply, especially for double-base mutation targets such as mut 27, mut 31, mut 32, mut 35, mut 36, and mut37. This may be because adjacent mismatches greatly affect the formation of r-loops, which reduces their mismatch tolerance. This also gives us an idea that we can introduce the 'double mismatch versus single mismatch strategy' to further improve its detection specificity: that is, pre-introduce a single-base mutation in the adjacent position of the spacer sequence that matches the single-base mutation site in the target sequence. When it combines with the target sequence and encounters a single-base mutation in the target sequence, an adjacent double-base mutation is formed, thereby further reducing the mismatch tolerance and improving the detection specificity. Figure 6 It can be seen from the data that the signal-to-noise ratio between the wild type and mutant types of various crRNA modifications with improved specificity has been significantly improved, and many sites have exceeded 10 times. Among them, the improvement of M65 modification is the most obvious, but there are still many positions where the specificity improvement is insufficient.

[0083] From the results in Example 1, it can be concluded that spacer truncation is a method that can significantly improve detection specificity without reducing sensitivity. On the basis of truncation, introducing a single base mutation at a specific position may further improve specificity.

[0084] Example 2 Analysis of the effect of crRNA spacer truncation length on specificity and its universality on different targets

[0085] In order to more precisely analyze the effect of truncated crRNA spacer on specificity and its universality on different targets, two additional targets D614G and R346T (new crown point mutation targets) were added in this example. Together with the CPSIT_0429 target, the spacer length was shortened from 20bp to 15bp, 1bp each time; the sequence information can be seen in Table 2.

[0086] Table 2

[0087]

[0088]

[0089] use Figure 4 The specificity of the target non-template strand sequence of single-base mutation and adjacent double-base mutation in the CPSIT_0429 gene was tested. Figure 7 The target non-template chain sequences of single-base mutations and adjacent double-base mutations were tested for specificity of detecting D614G and R346T; the corresponding non-mutated non-template chain sequence WT was tested for sensitivity.

[0090] from Figure 8 The results show that when the spacer is truncated to 16bp, the detection signals of different targets are quite different. The D614G and R346T targets still have strong signals, while the signal of the CPSIT_0429 target drops sharply. This may be because the stability of the spacer-TSDNA hybrid duplex is affected by the GC content. Compared with the 35% GC content of the CPSIT_0429 target, the GC content of the D614G and R346T targets is 50%, which makes the spacer-TS DNA hybrid duplex more stable and easy to form an R-loop structure, thereby triggering structural changes in the cas12a enzyme. There was no obvious detection signal for the three targets when the spacer was truncated to 15bp. Fig.12 The results showed that when the spacer was shortened to 17 bp, the detection signals of the three targets did not decrease significantly, and the detection limit was the same as that at 20 bp.

[0091] Specific results are visible Figures 9 to 13 ,from Figures 9 to 13It can be seen that the single-base mutation results of the three targets (CPSIT_0429, D614G and R346T) show that the specificity improvement of spacer truncation is dependent on the number of truncations; as the number of spacer truncations increases, the tolerance for base mismatches will also decrease; the 17bp spacer is the balance point that ensures that the R-loop does not collapse (sensitivity does not decrease) and can maximize the specificity improvement; the specificity improvement of truncating the spacer to 17bp is position-dependent and insignificant. The signal-to-noise ratio between the wild type and the mutant in the proximal and distal regions of the PAM is small, while the difference in the middle region of the PAM is more obvious. Only the R346T target has a signal-to-noise ratio higher than 10 times between the wild type and the mutant at positions 10 and 15 relative to the PAM. It is worth noting that it also has target specificity. For example, at position 12 relative to PAM, the signal-to-noise ratio of the 0429 target site was significantly improved, reaching about 10 times; while the improvement of the D614G target site was moderate, only about 2 times; and the signal-to-noise ratio of the R346T target site was close to 1, with almost no improvement. In summary, this shows that the specificity improvement of truncating the spacer to 17bp has inconsistent effects on different targets and different positions. Therefore, its universality and single-base discrimination ability are still worth improving.

[0092] Compared with the single-base recognition ability, the recognition ability of adjacent double-base mismatches is particularly improved with the shortening of the spacer. After the introduction of the double mismatch versus single mismatch strategy, the specificity of the three targets is only significantly improved when the spacer is shortened to 18bp and 17bp. Similarly, this specificity improvement is position-dependent and target-specific, but in mut 14 / 34, the signal-to-noise ratio of the three targets has been uniformly and significantly improved.

[0093] Example 3 Introducing wobble base mismatches in truncated spacer sequences

[0094] The introduction of a single mismatch base in crRNA spacer to form a double mismatch versus single mismatch strategy is a simple and effective strategy for the Crispr system to improve specificity. However, to form the optimal SNV detection signal-to-noise ratio, two prerequisites need to be met after the introduction of a single mismatch base in the spacer: first, the detection signal of the non-mutated target should be similar to the signal of the WT crRNA detection; second, the detection signal of the mutant target should drop sharply after the formation of a double base mismatch, similar to the signal of the NTC detection.

[0095] The 14th position of the non-template strand of the three targets selected in this example (CPSIT_0429, D614G and R346T) is a TC mutation (sequence information can be found in Fig.14 T14C in a, c, and e), which would result in a spacer-TS DNA hybrid duplex ( Figure 1 When the spacer length is 17 bp, the analytical sensitivity of the target site after the TC mutation at position 14 of the non-template strand is not significantly different from that of the wild type. The test results show that Fig.15 (a, c, e); This shows that the free energy change (ΔG) of R-loop formation is almost unaffected. According to the effect of base mismatch on Cas12a binding energy, it was also found that the single base mutation of the non-template chain T14C had the smallest increase in dissociation rate relative to other mismatch positions. In addition, rU-dG mismatch is also the type of mismatch with the most off-target effects in the CRISPR system in vivo. It can be speculated that this is because rU-dG mismatch belongs to wobblepairing, and its thermodynamic stability is similar to Watson-Crick pairing. However, previous reports have shown that there is no significant difference in the effect of different base pair mismatches at most positions on their specificity, indicating that the specificity difference of this mutant base type at position 14 may be spacer length-dependent.

[0096] In order to further verify that the specific difference of the 14th mutation base type may be spacer length-dependent, in this example, the 14th T of the non-template chain sequence of the three targets (CPSIT_0429, D614G and R346T) was mutated to C, G, A (the sequence of the TA mutation can be seen Fig.14 The T14A in b, d, and f; TG mutation sequences can be seen in Table 3), and the crRNA spacer length can be 20 bp to 15 bp. The test results can be seen Fig.16 ,from Fig.16 It can be seen that there is a significant difference only when it is shortened to 17bp, while the difference is not obvious at 20, 19 and 18bp, indicating that the energetic difference of this base complementary pairing can only be reflected at the R-loop energy collapse point, which also verifies that the 20bp R-loop energy is in excess.

[0097] Table 3

[0098] CPSIT_0429 non-template strand T14G TTTGCATAGAGAGTTCTGTACTAC D614G Non-template strand T14G TTTATCAGGATGTTAACGGCACAG R346T non-template strand T14G TTTAACGCCACCAGATTGGCATCT

[0099] With a spacer length of 17 bp, we constructed 16 DNA-RNA pairing combinations at the 14th position of the spacer-TS DNA hybrid double-strand of the three targets (where rA-dA in the figure indicates that the 14th position of the spacer of CrRNA mutated to A, and the corresponding 14th position of TS DNA also mutated to A; similarly: rG-dA indicates that the 14th position of the spacer of CrRNA mutated to G, and the corresponding 14th position of TS DNA mutated to A; the rest indicate the same by analogy). It can be found that only rU-dG (indicates that the 14th position of the spacer of CrRNA is U, and the corresponding 14th position of TSDNA mutated to G), rG-dT (indicates that the 14th position of the spacer of CrRNA mutated to G, and the corresponding 14th position of TS DNA also mutated to T) and rC-dT (indicates that the 14th position of the spacer of CrRNA mutated to C, and the corresponding 14th position of TS DNA also mutated to T) have a small difference in detection signal from Watson-Crick pairing ( Fig.17 ). Both rU-dG and rG-dT pairing belong to wobble base pairing, which are also common ways of off-target mismatching in vivo, which is consistent with our previous speculation that rC-dT may accommodate base mismatches by rearranging the double-stranded backbone. At the same time, there are many other positions on the non-template strands of the three targets that are also TC mutations. In the case of spacer 17bp, wobble base pairing at most positions will still affect the ΔG of the R-loop, resulting in a significant decrease in the detection signal. Therefore, it can be inferred that the effect of wobble base pairing on R-loop ΔG is position-dependent.

[0100] For comparison in this example, the non-template strand TC mutations were at positions 11, 9, and 12 of the CPSIT_0429, D614G, and R346T targets (specific sequence information Table 4); these three templates were subjected to an analytical sensitivity test with the 17 bp spacer crRNA target. Fig.15 (b, d, f), the detection signal of the T9C single mutation at the D614G target site had no significant difference from that of the wild type, and the analytical sensitivity at the other two positions was significantly reduced.

[0101] Table 4

[0102] CPSIT_0429 non-template strand T11C TTTGCATAGAGAGTCCTTTACTAC D614G Non-template strand T9C TTTATCAGGATGCTAACTGCACAG R346T non-template strand T12C TTTAACGCCACCAGACTTGCATCT

[0103] In this example, a non-template strand GA mutation (specific sequence can be seen in Table 5) and a TA mutation at position 14 (sequence information can be seen in Table 5) were also constructed. Fig.14 The sensitivity of the three target spacer-TS hybrid duplexes at position 14 to form rG-dT wobble base pairing did not decrease significantly, while other positions showed a significant decrease (the results can be seen Fig.18).

[0104] Table 5

[0105] CPSIT_0429 non-template strand G9A TTTGCATAGAGAATTCTTTACTAC D614G Non-template strand G15A TTTATCAGGATGTTAACTACACAG R346T non-template strand T12C TTTAACGCCACCAAATTTGCATCT

[0106] The results of the above two groups of experiments show that the wobble base pairing has almost no effect on the △G of the R-loop at position 14 of the spacer-TS hybrid duplex, which also shows that the R-loop space skeleton will also affect the formation of wobble base pairing. The high signal of the T9C single mutation of the D614G target indicates that in addition to position 14 of the spacer-TS hybrid duplex, there may be some specific positions of the target site where the GU wobble base pairing has little effect on the change of the △G of the R-loop.

[0107] When the crRNA spacer is truncated to 17 bp, the spacer introduces mismatched bases and TS DNA (sequence can be seen Fig.14 ) After the formation of rU-dG and rG-dT wobble base pairing at position 14, double mismatches versus single mismatch strategy were formed. The single base mismatch tolerance of the three targets was significantly reduced, and the specificity improvement was position-dependent, especially at the position near position 14, where the signal-to-noise ratio was almost more than 20 times ( Figures 19-20 Compared with the case where the crRNA spacer is truncated to 17 bp, the detection signals of the single-base mutations at the three target sites are further reduced, resulting in a further increase in the specificity of each position on the target site. This increase in specificity has a clear distance dependence ( Fig. 20 ), the highest specificity improvement was found at positions within +2 or -2 of position 14. In general, in vitro cleavage experiments and in vivo phage competition experiments also showed that adjacent mismatches were more harmful than two distant mismatches. In general, our results indicate that the specificity of Cas12a depends on the number, type, position, and distance of mismatches in the spacer-TS DNA heteroduplex.

[0108] Based on the experimental results of this embodiment: a crRNA iterative design principle for detecting SNV sites to meet the optimal SNV detection signal-to-noise ratio ( Fig.21 ): The closest distance to the target non-template strand mutation site is to find an A or C base, preferably within +2 or -2, defined as position 14 relative to PAM. The crRNA spacer length is shortened to 17 bp, and position 14 on the spacer is changed to U or G, and a wobble base mismatch is introduced at position 14 in the spacer-TS DNA heteroduplex.

[0109] Example 4 PAM sequence modification

[0110] Since Cas12a is PAM-dependent in recognizing double-stranded target sequences, and the iterative crRNA design method has a limit on the distance between the wobble base pairing and the PAM, which reduces the detectable sequence range, getting rid of the PAM restriction is extremely important for realizing the application and promotion of the technology. Introducing the PAM motif into the pre-amplification product provides an opportunity to remove sequence restrictions.

[0111] In this embodiment, the PAM sequence (TTTV) of Cas12a is introduced into the RPA upstream primer to achieve the introduction of the PAM sequence into the selected three target amplification products. Specifically, from the 3' end to the 5' end of the RPA upstream primer, 0-3bp bases are inserted every other base pair, so as to introduce the PAM sequence between the 1st and 2nd bases, between the 2nd and 3rd bases, and so on, to construct upstream primers with PAM sites in different positions, and then perform RPA amplification reactions with downstream primers, resulting in the first base after the upstream primer sequence being -1 to 14 positions away from the PAM site, respectively, in order to obtain amplification products containing PAM sites at different distances ( Fig. 22 ), the specific sequence information of the RPA primer sequence and the RPA primer sequence with PAM sequence inserted can be found in Table 6.

[0112] Table 6

[0113]

[0114]

[0115]

[0116] In order to verify whether the PAM sequence is correctly inserted, the amplified product is sequenced in this example, and it is found that the insertion of the PAM sequence near the 3′ end of the primer will affect the correctness of the flanking sequence (see Figures 23-26 ). Products containing -1 and 1-3 distances from the PAM site could not be amplified correctly, while products at other distances from the PAM site could be introduced correctly without mutation or deletion of flanking bases. This indicates that the 3′ end of the RPA primer is not tolerant to insertions.

[0117] In order to verify whether the insertion of PAM sequence will affect the analytical sensitivity of RPA-CRISPR reaction. Fig.23The upstream primer sequences of the three targets (F for CPSIT_0429 (9), F for D614G (3) and F for R346T (4)) were used for RPA reaction to construct PAM sequences with different distances, 9th position for CPSIT_0429 target, 3rd position for D614G target and 4th position for R346T target from the PAM site. Then, through the two-step analytical sensitivity experiment, it was found that the sensitivity of CPSIT_0429 target and R346T target was not affected, while the detection limit of D614G target was significantly reduced ( Fig. 27 ), indicating that the correctly inserted PAM sequence does not affect the analytical sensitivity of the RPA-CRISPR reaction, while the incorrectly inserted PAM sequence will lead to a decrease in its sensitivity.

[0118] The above results indicate that a method can be established to introduce TTT by inserting bases at positions 4-15 from the 3' end of the upstream primer of RPA, thereby overcoming the PAM limitation of the CRISPR detection reaction and avoiding the positional requirements during iterative crRNA design.

[0119] The one-tube reaction of RPA and CRISPR can not only save the entire detection time and reduce the number of operation steps, but also bring the additional advantage of removing aerosol pollution, which is also extremely important for the promotion and application of technology. A recent report found that glycerol additives can slow down the fusion of RPA and CRISPR systems, thereby achieving one-tube detection. We also adopted this method. First, we screened glycerol additives with different volume ratios and found that the one-tube detection reaction signal of 20% concentration was the best ( Fig.28 Therefore, we selected 20% glycerol for the next experiment. Through the analysis of sensitivity experiments, we found that compared with the one-tube test without glycerol ( Fig.29 ), adding 20% ​​glycerol can improve the detection limit of the one-tube method for three targets, thus achieving one-tube detection ( Fig.29 ). Therefore, we established a one-tube RPA-CRISPR assay without PAM restriction.

[0120] Example 5

[0121] In this example, a CRISPR / Cas12a SNV detection system was constructed for two mutant strains of the new coronavirus, BA5.2 and XBB.

[0122] BA5.2 has one unique mutation T1050N and one unique mutation XBB Q183E. Based on the non-template chain sequence of the point mutation site, the crRNA for detecting the corresponding SNV site was designed through crRNA iterative design. The crRNA can be seen in Table 7. The lowercase letter part is spacer.

[0123] Table 7

[0124] sequence name Sequence 5'-3' Q183E WT crRNA (20bp Spacer) UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaagaggg T1050N WT crRNA (20bp Spacer) UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaugaaa

[0125] The design of crRNA transformation process can be seen Fig.30 , the specific steps are as follows:

[0126] 1) The crRNA in Table 5 was spacer-truncated to 17 bp, and the sequence of the truncated crRNA can be seen in Table 8.

[0127] Table 8

[0128] sequence name Sequence 5'-3' Q183E WT crRNA (17bp Spacer) UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaaga T1050N WT crRNA (17bp Spacer) UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaug

[0129] 2) A wobble base mismatch was introduced into the Spacer 14 of the truncated crRNA sequence in Table 2 to obtain a modified crRNA, also referred to as SNV crRNA, and the sequence information can be found in Table 9.

[0130] Table 9

[0131] sequence name Sequence 5'-3' Q183E SNV crRNA (17bp Spacer) UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaGaga T1050N SNV crRNA (17bp Spacer) UAAUUUCUACUAAGUGUAGAUagcuaacaccuguGaug

[0132] The specificity of the modified crRNA was evaluated using the in vitro synthesized Q183E and T1050N target sequences (the specific sequence information of the non-template sequence can be found in Table 10). The results can be seen in Fig.31 ;from Fig.31 It can be seen that when facing the non-mutated template, the detection signal of the modified crRNA drops sharply, and there is no significant difference with the detection signal of NTC. When facing the mutant template, SNV crRNA can have a significant detection signal, and its analytical sensitivity is consistent with that of WT crRNA for detecting the non-mutated template, both of which are 10 2 copies per reaction; This indicates that the SNV crRNA of the corresponding target in this example can significantly distinguish whether the simulated samples (Q183E and T1050N targets synthesized in vitro) have a single base mutation, and there is a significant difference between the two (p<0.0001)

[0133] Table 10

[0134]

[0135]

[0136] 3) Design RPA primer sequences for BA5.2 and XBB. The primer sequences are shown in Table 11.

[0137] Table 11

[0138] RPA primer sequences Sequence 5'-3' F for Q183E atgtctctcagccttttctttatggaccttg R for Q183E gtgatgttaatacctattggcaaatctacc F for T1050N tgctggtgattacattttagctaacacctg R for T1050N ccaacttcccatgaaagatgtaattctctg

[0139] A PAM sequence was introduced at the 8th position of the 3' end of the RPA upstream primer for the XBB target, and a PAM sequence was introduced at the 13th position of the 3' end of the RPA upstream primer for the BA5.2 target; the primer sequences on the modified RPA can be seen in Table 12.

[0140] Table 12

[0141] Modification of RPA primer sequences Sequence 5'-3' F for Q183E atgtctctcagccttttcttaTTTGgaccttg F for T1050N tgctggtgattacatTTTCagctaacacctg

[0142] 4) Add the modified crRNA corresponding to the Q183E target, the modified RPA primer sequence and 20% glycerol to the CRISPR / Cas12a system (prepared according to the "CRISPR / Cas12a SNV detection system detection preparation process" in the first paragraph of the specific implementation method) to obtain a tube-based detection system.

[0143] 60 pharyngeal swabs of COVID-19 positive real samples verified by qPCR (including 30 strains of BA5.2 and XBB verified by next-generation sequencing) and 30 COVID-19 negative clinical samples were collected. The one-tube detection system established in this example was used for detection, and the flow chart can be seen Fig.32 . In order to ensure the reliability of the detection, each sample was tested three times. The SNV crRNA designed for the position of the single-base mutation of the Q183E target in this embodiment can significantly distinguish between the BA5.2 and XBB mutant strains, and there is a significant difference between the two (p<0.0001). When facing the mutant strain XBB, the Q183E target SNV crRNA has an obvious detection signal, while when facing the mutant strain BA.5.2, the Q183E target SNV crRNA detection signal drops sharply, and there is no significant difference with the detection signal of NTC. However, Q183EWT crRNA cannot distinguish between the BA5.2 and XBB mutant strains, and there is no significant difference between the two. The results can be seen Fig.33 (a). On the contrary, the SNV crRNA designed by the position of the single base mutation of the T050N target site can significantly distinguish the BA5.2 and XBB mutant strains, and there is a significant difference between the two (p<0.0001). When facing the mutant strain BA.5.2, the T1050N target SNV crRNA has an obvious detection signal, while when facing the mutant strain XBB, the T1050N target SNV crRNA detection signal drops sharply, and there is no significant difference with the detection signal of NTC. The same T1050N WT crRNA cannot distinguish the BA5.2 and XBB mutant strains, and there is no significant difference between the two.

[0144] The receiver operating characteristic (ROC) curve analysis of the fluorescence results of the new crown samples 1 hour after Q183E SNV crRNA and T1050N SNV crRNA showed that the areas under the curve for the corresponding variants were 1.0 and 0.97, respectively, indicating that the discrimination between positive and negative samples was high. The receiver operating characteristic (ROC) curve analysis of the fluorescence results of the new crown samples using Q183E WT crRNA and T1050N WT crRNA showed that the areas under the curve were 0.71 and 0.72, respectively (the results can be seen in Figure 2). Fig.34 ). The above results show that the iteratively designed SNV crRNA is much better than WT crRNA in distinguishing single-base mutation sites. At the same time, we judge the positive and negative of the detection results based on the ROC criterion value, and find that it is very consistent with the sequencing results (Fig.6d,e). It is worth noting that the Ct values ​​of samples that were not detected by T1050N SNV crRNA are basically less than 30.

[0145] The positive agreement rate (Positive Percent Agreement) of the XBB mutant strain detected by Q183E SNV crRNA was 100%, and the negative agreement rate (Negative Percent Agreement) was 100%. The positive agreement rate using Q183EWT crRNA was 100%, but the negative agreement rate dropped sharply to only 10% (the results can be seen Fig.33 (b)). The positive agreement rate (Positive Percent Agreement) of the BA.5.2 mutant strain detected by T1050N SNV crRNA was 80%, and the negative agreement rate (Negative Percent Agreement) was 100%. The positive agreement rate of WT crRNA was 96.7%, and the negative agreement rate was 50% ( Fig.33 (b)). The results of the Concordance table between CRISPR and NGS show that SNV crRNA can greatly improve its negative coincidence rate compared with WT crRNA, and improve the discrimination of single-base mutations. The detection method of this embodiment can detect SNV variant sites efficiently, accurately and quickly.

[0146] In the present invention, through the transformation of different regions of the crRNA secondary structure, it was found that there are 4 transformation methods that can significantly improve the trans-cutting specificity of the cas12a enzyme. Among them, M39: 3′truncation 1bp (Scaffold engineering) and M42+M43: 3′split (Loop engineering) may be due to reducing the affinity of crRNA and Cas12a, thereby affecting the stability of the formation of R-loop and increasing specificity, and M63: 3′foldback blocking 15bp (Extension engineering) may be through the formation of a hairpin secondary structure on the spacer to affect the formation of R-loop and increase specificity. The two transformation methods of M42+M43 and M63 have successfully verified the effect of improving specificity in the CRISPR gene editing function. However, the specificity improvement degree of these three improved methods is insufficient, and the sensitivity is partially lost.

[0147] Truncated spacer is a preferred solution. The present invention is the first to conduct a detailed study on the effect of crRNAspacer regional truncation in the CRISPR / Cas12a system on the specificity of in vitro trans-cleavage activity. Although the single and double base specificity increases with the increase of the spacer truncation length, the maximum truncation length of different targets is not the same. The 17bp spacer is the shortest length that generally maintains the activity of cas12a. However, it is not perfect to rely solely on truncated crRNA spacer to improve specificity. For targets with different GC values, the maximum truncation length is different. In addition, even if it is truncated to the longest truncation length of the target, the off-target effect cannot be completely eliminated, and it may also be at the expense of sensitivity.

[0148] The single-base mutation experiment of crRNA modification showed that the mismatch between the PAM proximal and PAM distal regions had little effect on trans-cleavage activity, while previous literature showed that the mismatch between the PAM proximal region and the PAM distal region had a greater effect on cis-cleavage. These results demonstrate that the perfect pairing of the PAM proximal region of the Cas12 protein is of great significance for its cis-cleavage activity, but it is not a necessary condition for the activation of trans-cleavage activity. The sequence in the middle region of the spacer is sensitive to mismatches because the middle double-stranded region where the spacer matches the TS DNA and the cas12 protein Helical II directly interacts and affects its conformation, which is essential for the activation of the RuvC catalytic pocket. The adjacent double-base mutation experiment showed that the penalty energy for double-base mismatches is much greater than that for single-base mismatches. However, it is not perfect to construct a single-double mismatch detection strategy based solely on the characteristic that adjacent mismatches greatly affect the formation of R-loops. This strategy also needs to consider how to avoid the impact of single mismatches on pairing sensitivity as well as the issues of target specificity and sequence specificity.

[0149] The present invention found that when the spacer is truncated to 17bp, the fourteenth position of the R-loop is a special position. The wobble base pairing at this position has almost no effect on the stability of the R-loop. This phenomenon may be due to the following reasons: 1. The thermodynamic stability of the wobble base pair is equivalent to that of the Watson-Crick base pair, and GU pairing is also common in vivo off-target, which is conducive to the formation of a double strand. 2. The steric hindrance of the backbone may also affect the formation of rU-dT base pairs, and the spatial position restriction at position 14 may be smaller. Utilizing this phenomenon, the present invention realizes a new strategy to improve specificity through simple iterative modification of crRNA, and for the first time improves k off The single mismatch penalty can achieve high specificity while maintaining sensitivity and universality. Our crRNA modification method only needs to find an A or C base within 2 bases next to the mutation site, which is very easy for genomic sequences, thus ensuring its ease of use.

[0150] In the present invention, iterative modification of crRNA has requirements for the position of introduction of the wobble base, and PAM-free and one-tube are of great value for the promotion and application of RPA-CRISPR diagnostic tools. Therefore, we solve the above problems by introducing PAM sequences in the RPA reaction and using glycerol additives.

[0151] The present invention establishes a novel coronavirus point mutation detection platform based on RPA-CRISPR / Cas12a combined technology. The detection platform has the following characteristics: single tube, high specificity without sacrificing sensitivity, high universality, and simple crRNA modification method. These characteristics facilitate commercial promotion and can quickly adjust the scheme when facing new mutant strains. However, we still need further work to improve the detection system to be suitable for the detection of low CT value samples, and collect more real samples to verify the reliability and stability of the scheme.

Claims

1. A method for improving the specificity of a CRISPR / Cas12a SNV detection system, characterized in that: In the method, crRNA is modified by: truncating the Spacer sequence portion in crRNA, and introducing a wobble base mismatch at a specific position in the truncated Spacer sequence; the Spacer sequence portion is truncated by 3 bp at the 3' end of the Spacer sequence; and a wobble base mismatch is introduced at the 14th position in the truncated Spacer sequence; The crRNA was modified in the following specific steps: finding an A or C base at the closest distance to the mutation position of the target non-template strand, within +2bp or -2bp of the mutation position, defined as the 14th position relative to PAM, shortening the length of the crRNA spacer to 17bp, and then changing the 14th base on the spacer to U or G, and introducing a wobble base mismatch at the 14th position in the spacer-TS DNA heteroduplex.

2. The method according to claim 1, characterized in that In this method, the PAM sequence TTTV of Cas12a is introduced into the RPA upstream primer, V=A / C / G.

3. The method according to claim 2, characterized in that The PAM sequence TTTV of Cas12a is introduced into the 4-14 position of the 3' end of the RPA upstream primer.

4. The method according to claims 1-3, characterized in that: In this method, glycerol is added to the detection system.

Images