A multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA, its application, and a kit using the combination

Abstract

The present invention provides a multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA, its application, and a kit using the combination. The present invention provides a primer and probe combination for detecting the above 9 types of HPV, namely HPV16, HPV 18, HPV 58, HPV 52, HPV 6, HPV 45, HPV 11, HPV 33 and HPV 31, targeted by HPV vaccines, and provides a corresponding nucleic acid detection kit on this basis. The kit of the present invention is based on the POCT detection method, and one sample is subjected to three reactions to detect 9 types of HPV. The reagent has the advantages of being able to be transported, stored and operated at room temperature, being convenient and fast, having low cost, having good detection specificity and high sensitivity. At the same time, the kit can be used to monitor the dynamic changes of infection after HPV vaccination, and long-term follow-up after vaccination can provide more accurate guidance for vaccination strategies, provide a scientific basis for the formulation and adjustment of vaccination plans and vaccine research and development, and facilitate the clinical timely adoption of accurate and effective detection and treatment methods. In addition, the present invention uses endogenous internal references, that is, by using internal reference β-globin, to effectively control sample collection, nucleic acid extraction and sample extraction-free direct amplification.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen gene detection, and in particular to a multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA, an application thereof, and a kit using the combination. Background Art

[0002] Human papillomavirus (HPV) infection is the most common sexually transmitted disease. Depending on the type of HPV, it can cause skin warts, genital warts or certain cancers including cervical cancer. HPV vaccine preparations are currently available, which are prepared from HPV major capsid (L1) protein using recombinant DNA technology and can prevent multiple HPV strains that may cause genital warts and cancer. The current HPV vaccines are mainly divided into three types, namely bivalent, quadrivalent and nine-valent vaccines. Among them, the bivalent vaccine only targets HPV types 16 and 18. These two high-risk HPV types are the most common causes of cervical cancer, accounting for about 70% of all cervical cancer cases; in addition to HPV types 16 and 18 in the bivalent vaccine, the quadrivalent vaccine also targets HPV types 6 and 11. These two low-risk HPV types are mainly related to genital warts; the nine-valent vaccine adds HPV types 31, 33, 45, 52 and 58 to the quadrivalent vaccine. These high-risk HPV types are also related to cervical cancer, vulvar cancer, vaginal cancer, anal cancer, etc. The nine-valent vaccine can prevent more than 90% of cervical cancer and other HPV-related cancers and diseases.

[0003] Although the HPV vaccine has shown short-term protective efficacy against HPV-related diseases in clinical trials, the long-term protective efficacy needs to be verified through long-term tracking to evaluate the protective effect and safety of the vaccine, determine the duration of protection provided by the vaccine, and whether additional doses are needed to maintain the immune effect. Long-term follow-up after HPV vaccination and regular monitoring and analysis of infection after vaccination can provide more precise guidance for vaccination strategies, provide a scientific basis for the formulation and adjustment of vaccination plans and vaccine research and development, and are of great significance for ensuring the long-term effectiveness, safety and public health value of the vaccine.

[0004] There are many products for HPV testing in the current market. The first category is full typing products, such as genetic testing products covering 23 types and 17 types. These testing kits improve the comprehensiveness of testing while reducing the convenience, timeliness and economy of testing to a certain extent. The second category is partial typing products, which mainly distinguish between the detection of types 16, 18 and 12 high-risk HPV types, which can help provide auxiliary evidence for clinical pre-colposcopy triage, but cannot meet the requirements for high-risk type typing and low-risk type (HPV 6 / HPV 11) detection. At present, there is no fast, convenient and economical full typing genetic testing kit for the types covered by the nine-valent vaccine. In view of the current situation that existing detection methods lack convenience, timeliness, economy or cannot meet the requirements for infection monitoring after the nine-valent HPV vaccine, there is an urgent need for a fast, accurate, convenient, economical and comprehensive detection method that can be used for grassroots testing and even home testing. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the above-mentioned existing technologies and provide a multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA and its application and a kit using the combination.

[0006] The first object of the present invention is to provide a multiplex PCR primer and probe combination for detecting nine types of human papillomavirus DNA.

[0007] The second object of the present invention is to provide the use of the primer and probe combination in the preparation of a product for detecting and monitoring infection of the nine types of HPV targeted by HPV vaccines.

[0008] The third object of the present invention is to provide a kit that can be used to detect the nine types of HPV targeted by HPV vaccines.

[0009] The fourth object of the present invention is to provide a reagent freeze-dried process for the kit, which can be applied to a POCT detection platform and can be applied to infection monitoring after HPV vaccination.

[0010] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0011] A multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA, comprising the following components:

[0012] Component 1: Primers and probes for detecting HPV 16;

[0013] Component 2: Primers and probes for detecting HPV 18;

[0014] Component 3, primers and probes for detecting HPV 58;

[0015] Component 4, primers and probes for detecting HPV 52;

[0016] Component 5, primers and probes for detecting HPV 6;

[0017] Component 6, primers and probes for detecting HPV 45;

[0018] Component 7, primers and probes for detecting HPV 11;

[0019] Component 8, primers and probes for detecting HPV 33;

[0020] Component 9, primers and probes for detecting HPV 31;

[0021] Component 10, primers and probe for detecting internal standard β-globin.

[0022] By adopting the above technical scheme, the present invention designs primer and probe combinations that can simultaneously detect the 9 types of HPV corresponding to the HPV vaccine, namely, HPV 16, HPV18, HPV 58, HPV 52, HPV 6HPV45, HPV 11, HPV 33 and HPV 31 DNA in 3 reaction systems, including detection primers and probes for the internal reference β-globin, so as to effectively control the quality of sample collection, nucleic acid extraction and detection.

[0023] The present invention is further configured as follows: Component 1 comprises:

[0024] Upstream primer HPV16-F sequence: 5′AATGTTTCAGGACCCACAGG3′;

[0025] Downstream primer HPV16 R sequence: 5′GTTGCTTGCAGTACACACATTC3′;

[0026] The probe HPV16-P sequence is labeled with a FAM fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0027] The HPV16-P sequence is: FAM-5'ACCACAGTTATGCACAGAGCTGCA3'-MGB. The present invention is further configured as follows: Component 2 comprises:

[0028] Upstream primer HPV18-F sequence: 5′ACCCTACAAGCTACCTGATCT3′;

[0029] Downstream primer HPV18 R sequence: 5′ACCTCTGTAAGTTCCAATACTGTC3′;

[0030] The probe HPV18-P sequence is labeled with a VIC fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0031] The HPV18-P sequence: VIC-5'ACGGAACTGAACACTTCACTGCAAGA3'-MGB.

[0032] The present invention is further configured as follows: Component 3 comprises:

[0033] Upstream primer HPV58-F sequence: 5′CACCACGGTTCGTTTGTGTA3′;

[0034] Downstream primer HPV58 R sequence: 5′CACAGCTAGGGCACACAATG3′;

[0035] The probe HPV58-P sequence is labeled with a CY5 fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0036] The HPV58-P sequence: CY5-5'ACCGACGTACGAACCCTACAGCAGC3'-MGB.

[0037] The present invention is further configured as follows: Component 4 comprises:

[0038] Upstream primer HPV52-F sequence: 5′GGTGACAGCTCAGATGAGGA3′;

[0039] Downstream primer HPV52 R sequence: 5′TGCATAGCCGTAGTGTGCTA3′;

[0040] The probe HPV52-P sequence is labeled with a FAM fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0041] The HPV52-P sequence: FAM-5'CCATCTGGCCGGTCCACACCA3'-MGB.

[0042] The present invention is further configured as follows: Component 5 comprises:

[0043] Upstream primer HPV6-F sequence: 5′AGACCAGTTGTGCAAGACGT3′;

[0044] Downstream primer HPV6 R sequence: 5′ATGGATAGCCGCCTCGAAAC3′;

[0045] The probe HPV6-P sequence is labeled with a VIC fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0046] The HPV6-P sequence: VIC-5'AGAATGCACTGACCACAGCAGAGA3'-MGB.

[0047] The present invention is further configured as follows: Component 6 comprises:

[0048] Upstream primer HPV45-F sequence: 5′TGTGACGGCAGAATTGAGCT3′;

[0049] Downstream primer HPV45 R sequence: 5′TTAGTTGCACACCACGGACA3′;

[0050] The probe HPV45-P sequence is labeled with a CY5 fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0051] The HPV45-P sequence: CY5-5'AGAGAGCTCGGCAGAGGACCT3'-MGB.

[0052] The present invention is further configured as follows: Component 7 comprises:

[0053] Upstream primer HPV11-F sequence: 5′GACCAGTTGTGCAAGACGTTA3′;

[0054] Downstream primer HPV11 R sequence: 5′GGTCAGTGCATTCCTGCAAA3′;

[0055] The probe HPV11-P sequence is labeled with a FAM fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0056] The HPV11-P sequence: FAM-5'TGCACACTCTGCAAATTCAGTGCGT3'-MGB.

[0057] The present invention is further configured as follows: Component 8 comprises:

[0058] Upstream primer HPV33-F sequence: 5′AGACACTGAGGAAAAACCACGA3′;

[0059] Downstream primer HPV33 R sequence: 5′ACCTCAGATCGTTGCAAAGGT3′;

[0060] The probe HPV33-P sequence is labeled with a VIC fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0061] The HPV33-P sequence: VIC-5'ACACAACATTGAACTACAGTGCGTGG3'-MGB.

[0062] The present invention is further configured as follows: Component 9 comprises:

[0063] Upstream primer HPV31-F sequence: 5′GACCGTTGTGTCCAGAAGAA3′;

[0064] Downstream primer HPV31 R sequence: 5′ACGCATGTTTACACTTGGGT3′;

[0065] The probe HPV31-P sequence is labeled with a CY5 fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0066] The HPV31-P sequence: CY5-5'AGGAGGAAGGTGGACAGGACGTTGCA3'-MGB.

[0067] The present invention is further configured as follows: component 10 comprises:

[0068] Upstream primer β-globin-F sequence: 5′GACTCTCTCTGCCTATTGGTCTATT3′;

[0069] Downstream primer β-globin R sequence: 5′CCCATAACAGCATCAGGAGTG3′;

[0070] The probe β-globin-P sequence is labeled with a ROX fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end;

[0071] The β-globin-P sequence is: ROX-5'CAGATCCCCAAAGGACTCAAAGAACC3'-MGB.

[0072] The present invention is further configured as: an application of a multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA, which is used to monitor the dynamic changes of infection after HPV vaccination. The 9 types of human papillomavirus DNA monitored specifically include: HPV 16, HPV 18, HPV 58, HPV 52, HPV 6HPV 45, HPV 11, HPV 33 and HPV 31.

[0073] The present invention is further configured as follows: the dynamic change detection method specifically performs a test once within the first 3 months after vaccination, and then performs a test once every 1-2 years, for at least 12 years, tracking changes in values ​​and conducting long-term monitoring of post-vaccination infection conditions.

[0074] The present invention is further provided as: a kit for detecting a multiplex PCR primer and probe combination of 9 types of human papillomavirus DNA, the kit containing the above primer and probe combination, and the 9 types of human papillomavirus DNA detected by the kit specifically include: HPV 16, HPV 18, HPV 58, HPV 52, HPV 6HPV 45, HPV 11, HPV 33 and HPV31.

[0075] The present invention is further configured as follows: the kit also includes reagents required for qPCR reaction, specifically including: reaction premix, enzyme and enzyme-free water.

[0076] The present invention is further configured as follows: the liquid reagent in the kit is freeze-dried in situ to form a freeze-dried powder through a freeze-drying procedure, and the freeze-drying procedure includes the following:

[0077] S1: pre-freeze;

[0078] S1.1: Temperature: 4℃; Duration: 30min; State: Hold; Pressure: 1atm;

[0079] S1.2: Temperature: -50℃; Duration: 1℃ / min; State: Cooling; Pressure: 1atm;

[0080] S1.3: Temperature: -50℃; Duration: 180min; State: Hold; Pressure: 1atm;

[0081] S2: one sublimation;

[0082] S2.1: Temperature: -40℃; Duration: 1℃ / min; State: Heating; Pressure: Extreme vacuum;

[0083] S2.2: Temperature: -40℃; Duration: 720min; State: Hold; Pressure: Extreme vacuum;

[0084] S3: secondary sublimation;

[0085] S3.1: Temperature: 25℃; Duration: 1℃ / min; State: Heating; Pressure: Ultimate vacuum;

[0086] S3.2: Temperature: 25°C; Duration: 300 min; State: Hold; Pressure: Extreme vacuum.

[0087] The present invention is further configured as follows: the kit also contains 9 types of HPV and internal standard gDNA positive control substances and a blank control substance.

[0088] Specifically, the HPV and internal standard gDNA positive control substances are divided into 3 tubes, tube 1 contains: HPV 16, HPV18, HPV58 and internal standard gDNA positive control substances; tube 2 contains: HPV 52, HPV6, HPV45 and internal standard gDNA positive control substances; tube 3 contains: HPV 11, HPV33, HPV31 and internal standard gDNA positive control substances; blank control substance 1 tube is enzyme-free water.

[0089] Specifically, HPV and internal standard gDNA positive controls were

[0090] Specifically, the three tubes of positive control substances are freeze-dried according to the above freeze-drying procedure to obtain the corresponding quality control substance positive control powder.

[0091] Specifically, the present invention also provides a method for using the kit, comprising the following steps:

[0092] S1. Sample collection, through cervical swab sampling;

[0093] S2. Sample processing: fully mix the cervical swab and sample processing solution in tube A;

[0094] S3. Control substance detection: Use 25μl enzyme-free water to dissolve 3 tubes of positive control substances respectively, and then transfer the above 3 tubes of solution to the corresponding 3 test tubes B1, B2, B3 to dissolve the lyophilized reagent and transfer to the corresponding reaction tube for amplification; use 25μl blank control substance solution to directly dissolve the lyophilized reagent and transfer to the corresponding reaction tube for amplification for quality control.

[0095] S4. Sample detection: Using the sample obtained in step S2 as a template, 25 μl of the sample is directly put into the freeze-dried reagent of the B1, B2 and B3 detection tubes of the present invention for dissolution, and the above 3 tubes of solution are transferred to the corresponding 3 tubes of reaction tubes for amplification, and the results are judged by the Ct value;

[0096] Result judgment:

[0097] The sample quality control is qualified if the three internal standards (ROX) in the sample show a typical S-shaped amplification curve and the Ct value is ≤37. Otherwise, resampling or amplification is required. The judgment of the target channel is based on the following Ct value results (Table 1).

[0098] Table 1 Results

[0099]

[0100]

[0101] Specifically, the reaction reagents used for amplification in step S4 are composed as follows (Table 2-4):

[0102] Reagent B1 tube composition (Table 2)

[0103] Components Volume (μL) Final concentration (μM) HPV16-F 1 0.2 HPV16-R 1 0.2 HPV18-F 1 0.2 HPV18-R 1 0.2 HPV58-F 1 0.2 HPV58-R 1 0.2 β-globin-F 1 0.2 β-globin-R 1 0.2 HPV16-P / HPV18-P / HPV58-P / β-globin-P 1 0.1 2×FastAmpli Premix-UNGⅣ(Probe qPCR)(DG) 12.5 Enzyme-free water 3.5

[0104] Reagent B2 tube composition (Table 3)

[0105]

[0106]

[0107] Reagent B3 tube composition (Table 4)

[0108] Components Volume (μL) Final concentration (μM) HPV11-F 1 0.2 HPV11-R 1 0.2 HPV33-F 1 0.2 HPV33-R 1 0.2 HPV31-F 1 0.2 HPV31-R 1 0.2 β-globin-F 1 0.2 β-globin-R 1 0.2 HPV11-P / HPV33-P / HPV31-P / β-globin-P 1 0.1 2×FastAmpli Premix-UNGⅣ(Probe qPCR)(DG) 12.5 Enzyme-free water 3.5

[0109] Specifically, the reaction conditions used for amplification in step S4 are shown in Table 5:

[0110] Table 5 Reaction procedure

[0111]

[0112] The present invention has the following beneficial effects:

[0113] The present invention provides primers and probe combinations for detecting the above 9 types of HPV for HPV vaccines, namely high-risk HPV16, HPV18, HPV31, HPV33, HPV 45, HPV 52, HPV58 and low-risk HPV6, HPV11, and on this basis, provides a kit that can be used for POCT detection platforms to quickly and conveniently detect the 9 types of HPV. The kit of the present invention is based on multiple fluorescent PCR methods and molecular POCT, and the reagents are freeze-dried in situ by a freeze-drying process. It also has good stability when stored at room temperature, has high ease of operation and convenience, and is not only conducive to the transportation and preservation of detection reagents, but also improves the detection sensitivity by increasing the input ratio of detection samples. The kit of the present invention can directly perform rapid detection on swab samples, eliminating the complicated nucleic acid extraction process, significantly improving the detection efficiency, and shortening the detection flow time to 30 minutes. In addition, the present invention uses endogenous internal references, that is, by using internal reference β-globin, to effectively control sample collection and sample extraction-free direct amplification. Therefore, the kit described in the present invention has the advantages of being able to be transported and stored at room temperature, quick detection, low cost, good specificity, high sensitivity, etc. It can be used to monitor the dynamic changes of infection after HPV vaccination and long-term follow-up after vaccination. It can provide more precise guidance for vaccination strategies, provide a scientific basis for the formulation and adjustment of vaccination plans and vaccine research and development, and also facilitate clinical timely adoption of accurate and effective detection and treatment methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0114] Figure 1 The operating procedure of the kit of the present invention;

[0115] Figure 2 It is the amplification curve of the HPV45 / 33 / 31 gDNA quality control product by tube B1 in the kit of the present invention;

[0116] Figure 3 It is the amplification curve of the B2 tube in the kit of the present invention for the HPV45 / 33 / 31 gDNA quality control product;

[0117] Figure 4 It is the amplification curve of the B3 tube in the kit of the present invention for the HPV45 / 33 / 31 gDNA quality control product;

[0118] Figure 5 It is the amplification curve of the B1 tube in the kit of the present invention for the HPV16 / 18 / 58 / 52 / 6 / 11 gDNA quality control product;

[0119] Figure 6 It is the amplification curve of the B2 tube in the kit of the present invention for the HPV16 / 18 / 58 / 52 / 6 / 11 gDNA quality control product;

[0120] Figure 7 It is the amplification curve of the B3 tube in the kit of the present invention for the HPV16 / 18 / 58 / 52 / 6 / 11 gDNA quality control product;

[0121] Figure 8 is the amplification curve of the HPV35 positive clinical sample by tube B1 in the kit of the present invention;

[0122] Fig. 9 is the amplification curve of HPV35 positive clinical samples by tube B2 in the kit of the present invention; Fig.10 is the amplification curve of HPV35 positive clinical samples by tube B3 in the kit of the present invention;

[0123] Fig.11 is the amplification curve of HPV39 positive clinical samples by tube B1 in the kit of the present invention;

[0124] Fig.12 is the amplification curve of HPV39 positive clinical samples by tube B2 in the kit of the present invention;

[0125] Fig.13 is the amplification curve of HPV39 positive clinical samples by tube B3 in the kit of the present invention;

[0126] Fig.14 is the amplification curve of HPV42 positive clinical samples by tube B1 in the kit of the present invention;

[0127] Fig.15is the amplification curve of HPV42 positive clinical samples by tube B2 in the kit of the present invention;

[0128] Fig.16 is the amplification curve of HPV42 positive clinical samples by tube B3 in the kit of the present invention;

[0129] Fig.17 It is the amplification curve of the B1 tube in the kit of the present invention for HPV6 / 52 / 33 / 31 positive clinical samples;

[0130] Fig.18 It is the amplification curve of the B2 tube in the kit of the present invention for HPV6 / 52 / 33 / 31 positive clinical samples;

[0131] Fig.19 It is the amplification curve of the B3 tube in the kit of the present invention for HPV6 / 52 / 33 / 31 positive clinical samples;

[0132] Fig. 20 is the amplification curve of HPV16 / 18 / 33 positive clinical samples by tube B1 in the kit of the present invention;

[0133] Fig.21 It is the amplification curve of the B2 tube in the kit of the present invention for HPV16 / 18 / 33 positive clinical samples;

[0134] Fig. 22 This is the amplification curve of the B3 tube in the kit of the present invention for HPV16 / 18 / 33 positive clinical samples. DETAILED DESCRIPTION

[0135] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0136] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0137] Example 1: Acquisition of primer and probe combinations

[0138] The present invention designs multiple sets of qPCR primers and probes for the DNA of 9 types of HPV corresponding to the HPV vaccine, namely HPV 16, HPV 18, HPV 58, HPV 52, HPV 6, HPV45, HPV 11, HPV 33 and HPV 31. At the same time, in order to evaluate factors such as sample collection and direct amplification without sample extraction, the present invention selects β-globin, RNase P and RPGD8 as candidate internal references, and designs corresponding primers and probes. On the basis of the primers and probes obtained by design, the sequences and combinations of primers and probes are adjusted in combination with the test results. After continuous adjustment, detection, readjustment and re-detection and adjustment, a primer and probe combination that can detect HPV 16, HPV 18, HPV 58, HPV 52, HPV 6, HPV 45, HPV 11, HPV33 and HPV 31 types is obtained through a 3-tube reaction, which also contains primers and probes for detecting β-globin.

[0139] The primer and probe combinations for the 9 types of HPV corresponding to the HPV vaccine and the internal standard obtained in the present invention are shown in Table 6 below. To avoid redundancy, only the final determined primer and probe combinations are listed in the specification.

[0140] Table 6 Primer probe sequences

[0141]

[0142] Example 2: Detection kit for 9 types of HPV corresponding to HPV vaccine that can be applied to POCT detection platform

[0143] Based on the primer and probe combination described in Example 1, the present invention establishes a method for detecting the 9 types of HPV using the primer and probe combination, and also establishes a kit for detecting the 9 types of HPV corresponding to the HPV vaccine.

[0144] 1. Preparation of primer and probe combinations

[0145] The present invention commissioned Beijing Qingke Biotechnology Co., Ltd. to synthesize the primers and probes shown in Table 1. At the same time, the 5' end of the probe for detecting HPV16, HPV52, and HPV11 was labeled with a fluorescent gene FAM, and the 3' end was labeled with a quenching fluorescent group MGB; the 5' end of the probe for HPV18, HPV6, and HPV33 was labeled with a fluorescent gene VIC, and the 3' end was labeled with a quenching fluorescent group MGB; the 5' end of the probe for HPV58, HPV45, and HPV31 was labeled with a fluorescent gene CY5, and the 3' end was labeled with a quenching fluorescent group MGB; the 5' end of the probe for detecting the internal standard β-globin was labeled with a fluorescent gene ROX, and the 3' end was labeled with a quenching fluorescent group MGB.

[0146] 2. Obtaining HPV reference materials

[0147] The 9 positive control substances and 1 blank control reagent of the present invention were purchased from Jingliang Technology (Shenzhen) Co., Ltd. and Invitrogen, respectively. Specifically, the 9 positive control substances are: human papillomavirus (HPV16) gDNA quality control product (GW-IPF001), human papillomavirus (HPV18) gDNA quality control product (GW-IPF002), human papillomavirus (HPV58) gDNA quality control product (GW-IPF011), human papillomavirus (HPV52) gDNA quality control product (GW-IPF010), human papillomavirus (HPV6) gDNA quality control product (GW-IPF011), human papillomavirus (HPV52) gDNA quality control product (GW-IPF012), human papillomavirus (HPV6) gDNA quality control product (GW-IPF013), human papillomavirus (HPV6) gDNA quality control product (GW-IPF014), human papillomavirus (HPV6) gDNA quality control product (GW-IPF015), human papillomavirus (HPV6) gDNA quality control product (GW-IPF016), human papillomavirus (HPV6) gDNA quality control product (GW-IPF017), human papillomavirus (HPV6) gDNA quality control product (GW-IPF018), human papillomavirus (HPV16) gDNA quality control product (GW-IPF0019), human papillomavirus (HPV18) gDNA quality control product (GW-IPF002 Quality control product (GW-IPF020), human papillomavirus (HPV45) gDNA quality control product (GW-IPF009), human papillomavirus (HPV11) gDNA quality control product (GW-IPF017), human papillomavirus (HPV33) gDNA quality control product (GW-IPF005), human papillomavirus (HPV31) gDNA quality control product (GW-IPF004); the blank control is: μltraPure TM DNase / RNase-free distilled water (10977015). Specifically, the 9 types of HPV positive controls, i.e. gDNA, are based on human cell lines, and the full-length sequences of each type are randomly integrated into the human genome, which is verified by sanger sequencing. Through sanger segmented sequencing, each segment has an overlap, ensuring that the full-length 8K sequence of HPV is fully integrated into the human genome. Cell culture can be stably passaged, and the product in the form of HPV gDNA can be obtained after cell extraction, and the number of viral copies is quantified by ddPCR.

[0148] 3. Establishment of the method for detecting the nine types of HPV

[0149] The method for detecting the nine types of HPV established by the present invention comprises the following steps:

[0150] S1. Sample collection, through cervical swab sampling;

[0151] S2. Sample processing: fully mix the cervical swab and sample processing solution in tube A;

[0152] S3. Control substance detection: Use 25μl enzyme-free water to dissolve 3 tubes of positive control substances respectively, and then transfer the above 3 tubes of solution to the corresponding 3 test tubes B1, B2, B3 to dissolve the lyophilized reagent and transfer to the corresponding reaction tube for amplification; use 25μl blank control substance solution to directly dissolve the lyophilized reagent and transfer to the corresponding reaction tube for amplification for quality control.

[0153] S4. Sample detection: Using the sample obtained in step S2 as a template, 25 μl of the sample is directly put into the freeze-dried reagent of the B1, B2 and B3 detection tubes of the present invention for dissolution, and the above 3 tubes of solution are transferred to the corresponding 3 tubes of reaction tubes for amplification, and the results are judged by the Ct value;

[0154] Result judgment:

[0155] If any of the amplification curves of the internal standard β-globin (ROX) in the three tubes of samples does not show a typical S-shaped amplification curve or the Ct value is greater than 37, it means that the sample extraction is unqualified and resampling is required;

[0156] If the internal standard β-globin (ROX) in the three tubes of samples simultaneously presents a typical S-shaped amplification curve and the Ct value is ≤37, it means that the sample extraction is qualified.

[0157] The target channel is determined based on the Ct value in Table 1.

[0158] The present invention finds that the amplification reagent and the positive control substance are freeze-dried powders obtained by freeze-drying the liquid amplification reagent and the positive control substance using a freeze-drying procedure. Specifically, the freeze-drying procedure includes the following:

[0159] S1: pre-freeze;

[0160] S1.1: Temperature: 4℃; Duration: 30min; State: Hold; Pressure: 1atm;

[0161] S1.2: Temperature: -50℃; Duration: 1℃ / min; State: Cooling; Pressure: 1atm;

[0162] S1.3: Temperature: -50℃; Duration: 180min; State: Hold; Pressure: 1atm;

[0163] S2: one sublimation;

[0164] S2.1: Temperature: -40℃; Duration: 1℃ / min; State: Heating; Pressure: Extreme vacuum;

[0165] S2.2: Temperature: -40℃; Duration: 720min; State: Hold; Pressure: Extreme vacuum;

[0166] S3: secondary sublimation;

[0167] S3.1: Temperature: 25℃; Duration: 1℃ / min; State: Heating; Pressure: Ultimate vacuum;

[0168] S3.2: Temperature: 25°C; Duration: 300 min; State: Hold; Pressure: Extreme vacuum.

[0169] The freeze-drying procedure is shown in Table 7;

[0170] Table 7 Freeze-drying procedure

[0171]

[0172] The liquid amplification reagent includes: reaction premix, Taq enzyme, 1 μL each of the upstream and downstream primers (final concentration 0.2 μM) and the probe (final concentration 0.1 μM), and enzyme-free water is added to make up the volume to 25 μL.

[0173] The positive control is shown in Table 8;

[0174] Table 8 Positive quality control group composition

[0175] Reference substance name Part Number Target concentration Human papillomavirus (HPV16) gDNA quality control GW-IPF002 <![CDATA[10 5 copies / ml]]> Human papillomavirus (HPV18) gDNA quality control GW-IPF002 <![CDATA[10 5 copies / ml]]> Human papillomavirus (HPV52) gDNA quality control GW-IPF010 <![CDATA[10 5 copies / ml]]> Human papillomavirus (HPV58) gDNA quality control GW-IPF011 <![CDATA[10 5 copies / ml]]> Human Papillomavirus (HPV6) gDNA Quality Control GW-IPF020 <![CDATA[10 5 copies / ml]]> Human Papillomavirus (HPV45) gDNA Quality Control GW-IPF009 <![CDATA[10 5 copies / ml]]> Human papillomavirus (HPV11) gDNA quality control GW-IPF017 <![CDATA[10 5 copies / ml]]> Human papillomavirus (HPV33) gDNA quality control GW-IPF005 <![CDATA[10 5 copies / ml]]> Human papillomavirus (HPV31) gDNA quality control GW-IPF004 <![CDATA[10 5 copies / ml]]>

[0176] The reaction procedures used in steps S3 and S4 are shown in Table 5.

[0177] 4. Detection kits for 9 types of HPV corresponding to HPV vaccines that can be applied to POCT detection platforms

[0178] Based on the preparation of the primer and probe combination, the reference substance and the detection method described in this embodiment, the present invention also constructs a detection kit for 9 types of HPV corresponding to the HPV vaccine that can be applied to the POCT detection platform, and the kit contains the primer and probe combination (as shown in Table 6) and the lyophilized reagents required for the qPCR reaction (as shown in Tables 2-4). The reagents required for the qPCR reaction are obtained by lyophilizing the liquid reagents according to the lyophilization procedure in Table 7.

[0179] The freeze-dried reagents required for the qPCR reaction include the primer and probe combination, a reaction premix and Taq enzyme, and the reaction premix contains a PCR reaction buffer and dNTPs.

[0180] The positive control substances were 9 kinds of HPV gDNA quality control substances (shown in Table 8), and the negative control substance was sterile water.

[0181] Example 3: Analysis of kit detection performance

[0182] The present invention tested the detection specificity and sensitivity of the detection kit for 9 types of HPV corresponding to the HPV vaccine, which can be applied to the POCT detection platform described in Example 2.

[0183] 1. Sensitivity detection

[0184] The present invention uses the 9 types of HPV in Example 2, namely HPV6, 11, 16, 18, 31, 33, 45, 52 and 58 gDNA quality control products to perform sensitivity testing of the kit. Specifically, the present invention divides the 9 types of HPV gDNA quality control products in Example 2 into 2 groups, wherein Group 1 contains gDNA quality control products of HPV45, 31 and 33; Group 2 contains gDNA quality control products of HPV6, 11, 16, 18, 52 and 58. The above two groups of quality control products were diluted to obtain a minimum concentration of 1000 copies / ml for each type of HPV gDNA quality control product; referring to the detection method described in Example 2, 25 μl of the corresponding quality control product dissolved in the sample treatment solution was taken to dissolve the freeze-dried reagent, and the above reaction solution was transferred to the reaction tube for amplification. The amplification curves of the gDNA quality control products in Group 1 described in the present invention are as follows. Figures 2 to 4 ; The amplification curves of gDNA quality control products in group 2 are as follows Figures 5 to 7 As can be seen from the figure, the detection sensitivity of the kit of the present invention for 9 types of HPV can reach 1000 copies / ml.

[0185] 2. Specificity detection

[0186] (1) HPV types outside the test kit detection range

[0187] The present invention selected one column of positive samples of HPV35, HPV39, and HPV42, and tested the samples using the method described in Example 2. The results are as follows: Figure 8-16 As shown by Figure 8-16 It can be seen that the detection results of the present invention for positive samples outside the detection range of the kit are all negative, indicating that its detection specificity is good.

[0188] (2) HPV types within the test kit detection range

[0189] The present invention selected one positive sample infected with HPV6, HPV52, HPV33, and HPV31, and one positive sample infected with HPV16, HPV18, and HPV33. After sample processing, qPCR detection was performed using the method described in Example 2, and the detection results of each channel were observed.

[0190] The HPV6, HPV52, HPV33, and HPV31 positive samples were tested by qPCR using the method described in Example 2. Figures 17 to 19 .Depend on Figures 17 to 19As shown in the test results, tube B1 only generates ROX (internal standard) channel signals; tube B2 generates FAM, VIC and ROX (internal standard) channel signals, FAM signal indicates HPV52 detection, VIC signal indicates HPV6 detection; tube B3 generates VIC, CY5 and ROX (internal standard) channel signals, VIC signal indicates HPV33 detection, CY5 signal indicates HPV31 detection. The HPV16, HPV18 and HPV33 positive samples were tested by qPCR using the method described in Example 2. Figures 20-22 .Depend on Figures 20-22 The test results show that tube B1 generates FAM, VIC and ROX (internal standard) channel signals, FAM signal indicates HPV16 detection, VIC signal indicates HPV18 detection; tube B2 only generates ROX (internal standard) channel signal; tube B3 generates VIC and ROX (internal standard) channel signals, VIC signal indicates HPV33 detection. This indicates that the kit of the present invention has good specificity.

[0191] The above embodiments are only preferred specific implementation modes of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacement, modification, combination, simplification or change according to the technical solution and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A multiplex PCR primer and probe combination for detecting 9 types of human papillomavirus DNA, characterized in that: The components include: Component 1: Primers and probes for detecting HPV 16, component 1 includes the upstream primer HPV16-F sequence: 5'AATGTTTCAGGACCCACAGG3'; Downstream primer HPV16 R sequence: 5′GTTGCTTGCAGTACACACATTC3′; The probe HPV16-P sequence is labeled with a FAM fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV16-P sequence: FAM-5 'ACCACAGTTATGCACAGAGCTGCA3 '-MG; Component 2: Primers and probes for detecting HPV 18, component 2 includes the upstream primer HPV18-F sequence: 5'ACCCTACAAGCTACCTGATCT3'; Downstream primer HPV18 R sequence: 5'ACCTCTGTAAGTTCCAATACTGTC3'; The probe HPV18-P sequence was labeled with a VIC fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV18-P sequence: VIC-5 'ACGGAACTGAACACTTCACTGCAAGA3 '-MGB; Component 3: Primers and probes for detecting HPV 58, component 3 includes the upstream primer HPV58-F sequence: 5'CACCACGGTTCGTTTGTGTA3'; Downstream primer HPV58 R sequence: 5′CACAGCTAGGGCACACAATG3′; The probe HPV58-P sequence was labeled with a CY5 fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV58-P sequence: CY5-5'ACCGACGTACGAACCCTACAGCAGC3'-MGB; Component 4: Primers and probes for detecting HPV 52, component 4 includes: upstream primer HPV52-F sequence: 5'GGTGACAGCTCAGATGAGGA3'; Downstream primer HPV52 R sequence: 5 'TGCATAGCCGTAGTGTGCTA3 '; The probe HPV52-P sequence is labeled with a FAM fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV52-P sequence: FAM-5 'CCATCTGGCCGGTCCACACCA3 '-MGB; Component 5: Primers and probes for detecting HPV 6, component 5 includes the upstream primer HPV6-F sequence: 5'AGACCAGTTGTGCAAGACGT3'; Downstream primer HPV6 R sequence: 5′ATGGATAGCCGCCTCGAAAC3′; The probe HPV6-P sequence is labeled with a VIC fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV6-P sequence: VIC-5 'AGAATGCACTGACCACAGCAGAGA3 '-MGB; Component 6: Primers and probes for detecting HPV 45, component 6 includes the upstream primer HPV45-F sequence: 5'TGTGACGGCAGAATTGAGCT3'; Downstream primer HPV45 R sequence: 5 'TTAGTTGCACACCACGGACA3 '; The probe HPV45-P sequence is labeled with a CY5 fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV45-P sequence: CY5-5'AGAGAGCTCGGCAGAGGACCT3'-MGB; Component 7: Primers and probes for detecting HPV 11; Component 7 includes: upstream primer HPV11-F sequence: 5'GACCAGTTGTGCAAGACGTTA3'; Downstream primer HPV11 R sequence: 5′GGTCAGTGCATTCCTGCAAA3′; The probe HPV11-P sequence is labeled with a FAM fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV11-P sequence: FAM-5 'TGCACACTCTGCAAATTCAGTGCGT3 '-MGB; Component 8: Primers and probes for detecting HPV 33, component 8 includes the upstream primer HPV33-F sequence: 5'AGACACTGAGGAAAAACCACGA3'; Downstream primer HPV33 R sequence: 5 'ACCTCAGATCGTTGCAAAGGT3 '; The probe HPV33-P sequence is labeled with a VIC fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV33-P sequence: VIC-5'ACACAACATTGAACTACAGTGCGTGG3'-MGB; Component 9: primers and probes for detecting HPV 31, component 9 includes the upstream primer HPV31-F sequence: 5'GACCGTTGTGTCCAGAAGAA3'; Downstream primer HPV31 R sequence: 5′ACGCATGTTTACACTTGGGT3′; The probe HPV31-P sequence was labeled with a CY5 fluorescent group at the 5' end and a MGB quenching fluorescent group at the 3' end; The HPV31-P sequence: CY5-5 'AGGAGGAAGGTGGACAGGACGTTGCA3 '-MGB; Component 10: primers and probes for detecting internal standard β-globin, component 10 includes the upstream primer β-globin-F sequence: 5'GACTCTCTCTGCCTATTGGTCTATT3'; Downstream primer β-globin R sequence: 5 'CCCATAACAGCATCAGGAGTG3 '; The probe β-globin-P sequence is labeled with a ROX fluorescent group at the 5′ end and a MGB quenching fluorescent group at the 3′ end; The β-globin-P sequence: ROX-5'CAGATCCCCAAAGGACTCAAAGAACC3'-MGB.

2. A kit for detecting nine types of human papillomavirus DNA using a combination of multiplex PCR primers and probes, characterized in that: The kit contains the primer and probe combination of claim 1, and the 9 types of human papillomavirus DNA detected by the kit specifically include: HPV 16, HPV 18, HPV 58, HPV 52, HPV 6, HPV 45, HPV 11, HPV 33 and HPV31. The kit also includes reagents required for qPCR reaction, specifically including: reaction premix, enzyme and enzyme-free water. The liquid reagents in the kit are freeze-dried in situ through a freeze-drying procedure to form freeze-dried powder; The freeze-drying process includes the following steps: S1: pre-freeze; S1.1: Temperature: 4℃; Duration: 30min; State: Hold; Pressure: 1atm; S1.2: Temperature: -50℃; Duration: 1℃ / min; State: Cooling; Pressure: 1atm; S1.3: Temperature: -50℃; Duration: 180min; State: Hold; Pressure: 1atm; S2: one sublimation; S2.1: Temperature: -40℃; Duration: 1℃ / min; State: Heating; Pressure: Extreme vacuum; S2.2: Temperature: -40℃; Duration: 720min; State: Hold; Pressure: Extreme vacuum; S3: secondary sublimation; S3.1: Temperature: 25℃; Duration: 1℃ / min; State: Heating; Pressure: Ultimate vacuum; S3.2: Temperature: 25℃; Duration: 300min; State: Hold; Pressure: Ultimate vacuum; The kit is applied to a POCT detection platform, and the amplification reaction procedure of the POCT detection platform is as follows: set the reaction temperature to 95°C, the reaction time to 2.5 minutes, and cycle once; set the reaction temperature to 95 degrees, the reaction time to 3 seconds, set the reaction temperature to 60 degrees, the reaction time to 15 seconds, and cycle 45 times alternately.

Images