A kind of infectious monkeypox virus detection kit and detection method thereof

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to an infectious monkeypox virus detection kit and a detection method thereof; the infectious monkeypox virus detection kit comprises a reaction solution and a primer probe set used for RT-qPCR amplification; wherein the reaction solution comprises a propidium azide bromide solution, and the working concentration of the propidium azide bromide solution is 50 μM to 75 μM; the primer probe set is a specific primer probe set for the L5L gene of the MPXV genome. The infectious monkeypox virus detection kit can accurately and quantitatively detect the DNA of the infectious monkeypox virus, thereby effectively avoiding false positive results in clinical sample testing, realizing rapid and highly sensitive identification of infectious monkeypox virus, and has the application potential of high efficiency, accuracy, stability and repeatability in monkeypox virus detection.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to an infectious monkeypox virus detection kit and a detection method thereof. Background Art

[0002] Monkeypox (Mpox) is a zoonosis caused by infection with the Monkeypox virus (MPXV). The Monkeypox virus is a double-stranded DNA virus that belongs to the same genus as smallpox virus, cowpox virus, and vaccinia virus, all of which belong to the genus Orthopoxvirus (OPXV) of the Poxviridae family. The incubation period of Monkeypox is 7 to 10 days, and most patients present with systemic illness, including fever, muscle pain, and a characteristic rash that is papular and primarily appears in the genital, anal, or oral areas. Most patients present with self-limited illness, with 1% to 13% requiring hospitalization (treatment or isolation), while up to 40% of patients develop complications such as rectal pain, dysphagia, penile edema, and skin and anal abscesses after treatment.

[0003] In 2022, the disease has experienced an unprecedented global spread outside of previously endemic countries in Africa, and the World Health Organization has declared monkeypox an international public health emergency. On June 2, 2023, my country reported its first local case of monkeypox, and as of November 30, 2023, a total of 1,610 cases had been found. The spread of monkeypox poses a huge threat to global public health security. At present, infectious monkeypox virus is mainly transmitted among people through direct contact, rather than respiratory droplets as in the past. Viral dynamics studies have found that MPXV DNA can be detected in a variety of body fluids of patients, but the infectivity of these body fluids and their impact on the spread of the epidemic are still unclear. In order to prevent the spread and prevalence of monkeypox in my country, timely, rapid and accurate assessment of the risk of infectious MPXV transmission in patients diagnosed with monkeypox, as well as the treatment and admission and discharge management of hospitalized patients, is an important prerequisite for the effective prevention and control of monkeypox epidemics.

[0004] At present, the detection methods of MPXV include serological testing, virus isolation and culture, and molecular biological detection technology. The current standard method for clinical diagnosis of monkeypox is real-time quantitative polymerase chain reaction (RT-qPCR). However, since the viral genome can still be detected by the RT-qPCR method within a short period of time after the virus loses its ability to infect, this means that RT-qPCR cannot distinguish between infectious and non-infectious viruses, which may lead to false positive results when clinical samples are tested. Although traditional cell culture-based methods, such as plaque assays or tissue culture infectious dose 50 determinations, are the gold standard for assessing viral infectivity, these methods usually take several days to produce results and rely on advanced biosafety laboratories at level 3 and above. Therefore, there is an urgent need to develop a new technology that is both fast and accurate, simple and effective in detecting infectious MPXV for the prevention and control of monkeypox. Summary of the invention

[0005] The object of the present invention is to provide a detection kit for infectious monkeypox virus, which can quantitatively detect DNA of infectious monkeypox virus, thereby realizing rapid and highly sensitive identification of infectious monkeypox virus.

[0006] The above-mentioned purpose is achieved by the following technical solutions.

[0007] The first aspect of the present invention provides an infectious monkeypox virus detection kit, the infectious monkeypox virus detection kit comprising a reaction solution and a primer probe set used for RT-qPCR amplification;

[0008] Wherein, the reaction solution includes propidium azide bromide solution, and the working concentration of the propidium azide bromide solution is 50 μM to 75 μM;

[0009] The primer probe set is a specific primer probe set for the L5L gene of the MPXV genome.

[0010] In some embodiments, the primer probe set is a specific primer probe set for a gene whose nucleotide sequence is shown in SEQ ID NO:1.

[0011] In some embodiments, the primer probe set includes an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO: 4.

[0012] In some embodiments, the working concentration of the propidium azide bromide solution is 50 μM to 55 μM; preferably, the working concentration of the propidium azide bromide solution is 50 μM to 52 μM; more preferably, the working concentration of the propidium azide bromide solution is 50 μM.

[0013] In some embodiments, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; preferably, the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

[0014] A second aspect of the present invention provides a method for extracting monkeypox sample DNA, the extraction method comprising the following steps:

[0015] Treating the sample to be tested with a reaction solution, wherein the reaction solution includes a propidium azide bromide solution, and the working concentration of the propidium azide bromide solution is 50 μM to 75 μM;

[0016] Extract the DNA from the sample to be tested after processing.

[0017] In some embodiments, in the step of treating the sample to be detected with a reaction solution, the treatment includes light shielding treatment and blue light excitation treatment; the time of the light shielding treatment is 10 minutes to 30 minutes, and the time of the blue light excitation treatment is 10 minutes to 30 minutes.

[0018] In some embodiments, the processing specifically includes the following steps:

[0019] The reaction solution and the sample to be detected are shaken and mixed for 10s to 15s to obtain a mixed solution;

[0020] The mixed solution was protected from light for 10 to 30 minutes, and the sample was taken out and vortexed for 10 to 15 seconds every 5 minutes during the light-shielding process;

[0021] The mixed solution after the light-shielding treatment was placed under a blue light excitation instrument for 10 min to 30 min, and during the treatment with the blue light excitation instrument, the sample was taken out and vortexed for 10 s to 15 s every 5 min.

[0022] The third aspect of the present invention provides a method for detecting infectious monkeypox virus for non-diagnostic purposes, the detection method comprising the following steps:

[0023] Treating the sample to be tested with a reaction solution, wherein the reaction solution is a propidium azide bromide solution, and the working concentration of the propidium azide bromide solution is 50 μM to 75 μM;

[0024] Extracting DNA from the processed sample to be tested;

[0025] The extracted DNA was used as a template and RT-qPCR amplification was performed to obtain an amplification product, wherein the primer probe set used for RT-qPCR amplification was a specific primer probe set for the L5L gene of the monkeypox virus genome.

[0026] In some embodiments, the primer probe set is a specific primer probe set for a gene whose nucleotide sequence is shown in SEQ ID NO: 1; preferably, the primer probe set includes an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO: 4.

[0027] In the present invention, the inventors have found that the mass concentration of Propidium Monoazide (PMA) in the monkeypox virus detection system is a very important factor affecting the test results; by using a specific concentration of Propidium Monoazide solution to treat the monkeypox virus, a suitable concentration of Propidium Monoazide (working concentration is 50μM to 75μM) can specifically bind to the DNA of the monkeypox virus that is completely exposed or has lost its infectivity due to envelope damage, and the formed PMA-DNA conjugate can block PCR amplification, effectively reduce the interference of non-infectious viral DNA, and realize rapid quantitative detection of infectious MPXV. Based on the RT-qPCR method, a specific primer probe set was designed for the completely conserved L5L gene of the monkeypox virus IIb branch and its derived lineages that are prevalent in the global spread process. It was found that the specific primer probe set amplified the DNA of the monkeypox virus after PMA treatment, and the DNA of the infectious monkeypox virus could be accurately and quantitatively detected. The designed probe and primer can also conservatively identify the L5L gene of the Tiantan strain of the replication-deficient vaccinia virus (VACV). It can effectively avoid false positive results in clinical sample testing, realize rapid and highly sensitive identification of infectious monkeypox virus, and has the potential for application in high efficiency, accuracy, stability and repeatability in monkeypox virus detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a summary of the functional annotations of the MPXV-encoded proteins in Example 1.

[0029] Figure 2 The standard curves for RT-qPCR detection of the M1R, L5L and A17L genes of MPXV in Example 1 were drawn.

[0030] Figure 3 This is a determination of the potential of PMA in Example 2 to block PCR amplification of non-infectious VACV Tiantan strain DNA.

[0031] Figure 4 The effect of different mass concentrations of PMA in Example 2 on blocking the PCR process of non-infectious VACV Tiantan strain DNA was determined.

[0032] Figure 5 This is the determination of the optimal working mass concentration of PMA in Example 2.

[0033] Figure 6 This is to explore the effects of different light-avoidance treatment times and blue light excitation times on the determination of the infectious VACV Tiantan strain in Example 2.

[0034] Figure 7 These are the results of measuring the gradient diluted VACV Tiantan strain virus solution by RT-qPCR without PMA treatment and PMA-qPCR after PMA treatment in Example 3.

[0035] Figure 8 These are the results of measuring the gradient diluted virus solution of Guangdong Province MPXV isolates by RT-qPCR without PMA treatment and PMA-qPCR after PMA treatment in Example 3.

[0036] Fig. 9 The standard curves of the virus liquid of MPXV isolates in Guangdong Province and VACV Tiantan strain were drawn by RT-qPCR without PMA treatment and PMA-qPCR with PMA treatment in Example 3, respectively.

[0037] Fig.10 This is a diagram of the detection process of the method for detecting infectious monkeypox virus in Example 2. DETAILED DESCRIPTION

[0038] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0039] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0040] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0041] Propidium Monoazide (PMA) is a photosensitizing dye with a high affinity for nucleic acids. It is characterized in that it cannot penetrate intact cell walls, cell membranes or viral envelopes, and therefore can only bind to naked DNA or RNA. By utilizing the characteristics of PMA, the amplification of dead viral DNA in the sample can be selectively blocked, effectively avoiding false positives. However, the inventors have found that the mass concentration of PMA in the monkeypox detection system of the present invention is a very important factor affecting the test results. If the mass concentration is too low, the interference of dead bacterial DNA in the reagent cannot be completely removed, resulting in a "false positive" result.

[0042] The present invention treats monkeypox virus by using a specific concentration of propidium azidobromide solution, and propidium azidobromide of suitable concentration (working concentration is 50 μM to 75 μM) can specifically bind to the DNA of monkeypox virus that is completely exposed or loses its infectivity due to envelope damage, based on the RT-qPCR method, by designing a specific primer probe set for the completely conservative L5L gene of the monkeypox virus IIb branch and its derived lineage that are prevalent in the global spread process. And in order to explore the action conditions of PMA in a safe environment, the designed probes and primers can also conservatively identify the L5L gene of the replication-deficient vaccinia virus Tiantan strain (hereinafter referred to as the VACV Tiantan strain) of vaccinia virus (Vaccinia virus, VACV). It is found that the DNA of monkeypox virus treated with PMA can be amplified by the specific primer probe set, and the DNA of infectious monkeypox virus can be accurately and quantitatively detected, thereby effectively avoiding false positive results in clinical sample detection, and realizing rapid and highly sensitive identification of infectious monkeypox virus, and having high efficiency, accuracy, stability and repeatability in monkeypox virus detection.

[0043] The present invention is described below with reference to specific embodiments.

[0044] Example 1: Determination of infectious MPXV detection targets and probe and primer design

[0045] Infectious MPXV particles include two types: extracellular virus particles (EV) and mature virus particles (MV). The two types of virus particles bind to target cells through different viral surface membrane proteins to achieve viral infection. In order to quickly identify such membrane proteins, the functional annotations of the coding genes of MPXV (GenBank: NC 063383.1), VACV (GenBank: M35027.1 and NC006998.1) and CPXV (GenBank: NC_003663.2) on GenBank were summarized in this example, and the genes were located in MPXV (CNCB: C_AA038924.1) reported in Guangdong Province. At the same time, the global MPXV genetic diversity sequence data set was further used to perform conservation analysis on the surface membrane proteins identified by functional annotations. The results are as follows Figure 1 As shown, among the 192 protein-encoding MPXV genes, 40 were observed to be associated with EV or MV infection, of which 19 proteins had not undergone any mutations during the global spread of the MPXVIIb branch and its derived lineages, suggesting their potential as targets for infectious MPXV detection.

[0046] Combined with the analysis of gene length and nucleotide composition, we designed primers and probes for RT-qPCR for OPG95, OPG104, and OPG143 genes encoding M1R, L5L, and A17L, respectively (see Table 1 for the relevant primer and probe sequences). Primers, probes, and target fragment standards for the three genes were obtained by gene synthesis. Standards of known concentrations (1 copy / μL to 10 copies / μL) were diluted in 10-fold gradients. 9 copies / μL) were used as test samples for RT-qPCR to determine the amplification cycle number (cycle threshold, CT). Figure 2 As shown in the figure, the standard curve plotting shows that targeting L5L gene for MPXV detection has stronger stability (R 2 =0.9961) and higher sensitivity (1 copy of the standard can still be detected as positive if it conforms to the Poisson distribution). Therefore, the L5L gene was determined as our detection target.

[0047] The primer and probe sequences are shown below.

[0048] Table 1 Primer probe sequences

[0049]

[0050] The above primers (SEQ ID NO.2-SEQ ID NO.3) designed in this embodiment are based on the L5L gene of MPXV. The fragment amplification length of the primers is 109 bp, and the gene sequence is as follows.

[0051] RT-qPCR amplified fragment (SEQ ID NO: 1):

[0052] CATCGCTTCGTTTACATGGCTCGTACCAACAATAATAGGGTAATCTTG TATCTATTCCTATCCGTACTATACTTTTATCAGGATAAATACATTTACATCGT ATATCGTC.

[0053] Example 2: Exploration of PMA action conditions

[0054] Since the probe and primers designed for targeting the MPXV L5L gene of the present invention can also conservatively recognize the L5L gene of the VACV Tiantan strain, this example is to explore the PMA action conditions based on the cultured virus fluid obtained after the VACV Tiantan strain infected BHK-21 cells.

[0055] The titer of live virus was 4.5×10 6 The VACV virus solution with a PFU / mL was completely thawed at 4°C, and the thawed virus solution was divided into an experimental group and a control group using an EP tube, 200μl per tube. The experimental group was a virus solution in which PMA with a final concentration of 50μM was directly added, and the control group was a virus solution inactivated at 56°C for 30min and then PMA with a final concentration of 50μM was added. After thorough mixing, it was protected from light for 10min, and oscillated and mixed once every 5min, and then placed under a blue light excitation instrument for 10min, and oscillated and mixed once every 5min. After completing the sample pretreatment, the viral DNA was extracted using the viral DNA extraction kit NucleoSpin Virus from Macherey-Nagel.

[0056] After fully mixing 2X Pro Taq HS Probe Premix, 10 μM upstream primer, 10 μM downstream primer, 10 μM probe, Template cDNA, and enzyme-free water, add DNA of the sample to be tested or blank control sample to prepare the RT-qPCR reaction system, and place the RT-qPCR reaction tube in the QuantStudio 6 instrument for fluorescence detection.

[0057] The testing process of the experimental group is as follows Fig.10 shown.

[0058] The RT-qPCR amplification reaction system is as follows:

[0059]

[0060]

[0061] The RT-qPCR amplification program was: 95°C, 30s; 95°C, 5s; 60°C, 30s. A total of 40 cycles were performed. After the reaction, the data were acquired using the built-in software.

[0062] The experimental results are shown in Figure 3 The results showed that the cycle threshold (CT) of the active and heat-inactivated virus fluids measured by RT-qPCR were significantly increased, and the heat-inactivated virus fluid showed a larger ΔCt (CT(+PMA)-CT(-PMA)), indicating that PMA significantly reduced the interference of non-infectious VACV DNA and has a strong potential for detecting infectious VACV.

[0063] In order to further clarify the effects of PMA concentration, light-proof treatment time and blue light excitation time on the detection of infectious viruses. The titer of live virus was determined by plaque assay.

[0064] 4.5×10 6 PFU / mL, 9.5×10 6 PFU / mL and 1.8×10 6 PFU / mL of three batches of VACV Tiantan strain virus liquid, the virus samples of the active experimental group and the heat-inactivated control group were pretreated with PMA at final concentrations of 0μM, 10μM, 25μM, 50μM, 75μM, and 100μM to determine the optimal mass concentration, and the gradient of 10min, 20min, and 30min was used to determine the optimal light-proof treatment time and blue light excitation time. Experimental results Figure 4 The results showed that as the final concentration of PMA increased, the ΔCt of the heat-inactivated virus solution and the non-inactivated virus solution amplified by PMA-qPCR gradually increased. When the final concentration of PMA was 50 μM, the ΔCt reached a maximum value of 7, and it no longer increased significantly as the concentration continued to increase. Figure 5 Statistical analysis showed that there was no significant difference between the final concentrations of PMA at 50 μM and 75 μM. Figure 6 It shows that the light-avoidance treatment time and blue light excitation time in the range of 10-30 minutes have no effect on the effect of PMA.

[0065] This example illustrates that when the sample pretreatment procedure of PMA final concentration of 50 μM, light protection for 10 min and blue light excitation for 10 min is implemented, the binding ability of PMA to the virus reaches saturation, and the signal of non-infectious virus (virus particles with damaged envelope structure or free viral nucleic acid) can be suppressed to the greatest extent.

[0066] Example 3: Standard curve drawing of infectious monkeypox virus and VACV Tiantan strain and accuracy verification of quantitative determination

[0067] This example adopts the sample pretreatment procedure of PMA final concentration of 50 μM, light protection for 10 min, and blue light excitation for 10 min as specified in Example 2, and uses the same RT-qPCR amplification primers and probes and PMA-qPCR detection specific steps. In this example, the titer of live virus determined by plaque assay is 9.5×10 6 PFU / mL of VACV Tiantan strain virus liquid and 1.5×10 6 After the virus solution of Guangdong MPXV isolate 340 with a concentration of PFU / mL was diluted 10 times, PMA working solution was added (the final concentration of PMA working solution was 50 μM) and no PMA was added, and then the standard curve was drawn based on the results of RT-qPCR amplification. The experimental results are shown in Figure 7 , Figure 8 and Fig. 9 .

[0068] Fig. 9 The results showed that when targeting the L5L gene for RT-qPCR detection, there was a good linear relationship between the live virus concentration and CT value of monkeypox virus and VACV Tiantan strain, whether PMA was added or not. The standard curve with PMA was significantly shifted upward compared to that without PMA, and maintained a relatively good parallel relationship. In addition, when PMA was not added, 1-10PFU / ml of virus solution could be detected as positive, while the minimum detection limit after adding PMA was 10-100PFU / ml, indicating that PMA-qPCR was less interfered by non-infectious viral DNA and could effectively distinguish infectious viral DNA. This ability to distinguish infectious viruses from non-infectious viruses has important application value in clinical diagnosis, vaccine validation and virus monitoring.

[0069] This example further uses virus liquid of 4 Guangdong MPXV isolates and 8 batches of VACV Tiantan strain virus liquid, and simultaneously detects by plaque assay, RT-qPCR without PMA treatment, and PMA-qPCR with 50 μM PMA treatment to verify the accuracy of PMA-qPCR quantitative determination of infectious viruses. The experimental results are shown in Table 2, and the results show that due to the interference of non-infectious viral DNA, the virus concentration measured without PMA was significantly higher than the actual live virus concentration measured by the plaque assay, and the infectious virus concentration measured by the PMA-qPCR method was not significantly different from that measured by the plaque assay, with good consistency. This means that although the minimum detection limit of MPXV in the PMA-treated sample is 10-100 PFU / ml, PMA-qPCR can correctly reflect the situation of infectious MPXV in the sample, which is helpful to assess the transmission risk of monkeypox patients in public emergencies and clinical management.

[0070] Table 2 Results of quantitative determination of VACV Tiantan strain and MPXV virus liquid by plaque assay, RT-qPCR and PMA-qPCR respectively

[0071]

[0072]

[0073] Example 4: PMA-qPCR quantitative determination of infectious MPXV load in clinical body fluid samples of monkeypox patients

[0074] In order to evaluate the potential value of the PMA-qPCR method in revealing the distribution characteristics of infectious viruses carried by body fluids of monkeypox patients through different transmission routes, 23 different clinical body fluid samples from 15 monkeypox patients were collected, including 9 pharyngeal swabs, 5 anal swabs and 9 herpes collection fluids from skin lesions. The total viral DNA and infectious viral DNA of clinical samples were quantitatively determined by RT-qPCR and PMA-qPCR, respectively, and the experimental results are shown in Table 3.

[0075] The results in Table 3 show that the infectious MPXV DNA measured by PMA-qPCR in herpes collection fluids of throat swabs, anal swabs, and skin lesions is significantly lower than that of RT-qPCR without PMA, especially in some herpes collection fluids, where the infectious DNA only accounts for 1% of the total DNA, suggesting that the current study of viral dynamics using conventional RT-qPCR has limitations. For all samples, the titer of infectious MPXV in herpes collection fluid was the highest, followed by anal swabs, and the lowest was throat swabs. It is worth noting that the infectious MPXV concentration may vary between multiple body fluids of the same patient, such as the herpes collection fluid of patient 7's genital lesions higher than that of the fingers, and the anal swab of patient 10 higher than that of the herpes collection fluid. The throat swab was the lowest among the multiple body fluids of each patient, and even two patients could not detect infectious MPXV, even though DNA could be detected in RT-qPCR without PMA.

[0076] Table 3 Quantitative detection results of clinical body fluid samples of monkeypox patients

[0077]

[0078]

[0079] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0080] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A kit for detecting infectious monkeypox virus, characterized in that: The infectious monkeypox virus detection kit includes a reaction solution and a primer probe set used for RT-qPCR amplification; Wherein, the reaction solution includes propidium azide bromide solution, and the working concentration of the propidium azide bromide solution is 50 μM to 75 μM; The primer probe set is a specific primer probe set for a gene whose nucleotide sequence is shown in SEQ ID NO: 1; the primer probe set includes an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO:

4.

2. The infectious monkeypox virus detection kit according to claim 1, characterized in that The working concentration of the propidium bromide azide solution is 50 μM to 55 μM.

3. The infectious monkeypox virus detection kit according to claim 1, characterized in that The working concentration of the propidium bromide azide solution is 50 μM to 52 μM.

4. The infectious monkeypox virus detection kit according to any one of claims 1 to 3, characterized in that The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

5. The infectious monkeypox virus detection kit according to claim 4, characterized in that The fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

6. A method for detecting infectious monkeypox virus for non-diagnostic purposes, characterized in that: The detection method comprises the following steps: Treating the sample to be tested with a reaction solution, wherein the reaction solution is a propidium azide bromide solution, and the working concentration of the propidium azide bromide solution is 50 μM to 75 μM; Extracting DNA from the processed sample to be tested; The extracted DNA was used as a template and RT-qPCR amplification was performed to obtain an amplification product, wherein the primer probe set used for RT-qPCR amplification included an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer was shown in SEQ ID NO: 2, the nucleotide sequence of the downstream primer was shown in SEQ ID NO: 3; the nucleotide sequence of the probe was shown in SEQ ID NO:

4.

7. The detection method according to claim 6, characterized in that In the step of treating the sample to be detected with the reaction solution, the treatment includes light shielding treatment and blue light excitation treatment; the time of the light shielding treatment is 10min~30min, and the time of the blue light excitation treatment is 10min~30min.

8. The detection method according to claim 7, characterized in that The process specifically comprises the following steps: The reaction solution and the sample to be detected are shaken and mixed for 10s to 15s to obtain a mixed solution; The mixed solution was shielded from light for 10 min to 30 min, and the sample was taken out and vortexed for 10 s to 15 s every 5 min during the shielding process; The mixed solution after shading treatment was placed under a blue light excitation instrument for 10 min to 30 min. During the treatment with the blue light excitation instrument, the sample was taken out and vortexed for 10 s to 15 s every 5 min.

Images