A strain of Propionibacterium acnes and its application

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a strain of Propionibacterium acnes and its application. Specifically, the present invention isolates a strain of Propionibacterium acnes (Propionibacterium acnes) with good anti-inflammatory and antioxidant properties from healthy scalp. Propionibacterium acnes ) CCSMS0630, its fermentation supernatant has a good effect on promoting the growth of Malassezia globosa, and can inhibit the growth of Staphylococcus capitis and Malassezia restricta. It regulates the balance between bacteria and fungi and the function of scalp flora, thereby improving dandruff and benefiting scalp health.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a strain of Propionibacterium acnes and application thereof. Background Art

[0002] The scalp is a special skin with a unique ecosystem. The scalp flora plays an important role in maintaining the balance of the scalp microecology. The bacterial genera that reside on the scalp of healthy adults are Propionibacterium, Staphylococcus and Corynebacterium. The most important fungi on the scalp are Malassezia, which are less in number than bacteria, mainly Malassezia restricta and Malassezia globosa. Studies have confirmed that scalp skin diseases such as seborrheic dermatitis, dandruff and alopecia areata all have problems with scalp microecological imbalance. Maintaining the balance of the scalp microecology is a very important part of protecting the health of the scalp.

[0003] Propionibacterium acnes is the main resident bacterium on the scalp. As an important component of the scalp flora, changes in its colonization ratio may cause an imbalance in the colonization of other flora, leading to the occurrence of scalp problems. Dandruff is a common scalp problem. Clinically, the main symptoms of dandruff include scalp itching, scaling, greasy hair, etc. In severe cases, it can also lead to inflammation and hair loss. The pathogenesis of dandruff is complex, including abnormal sebum secretion, fungal infection, scalp microecological disorders, stratum corneum metabolic disorders and other factors.

[0004] At present, most studies have shown that compared with healthy people, the relative abundance of Propionibacterium acnes and Malassezia globosa in the dandruff area of ​​people with dandruff decreased, while the relative abundance of Staphylococcus capitis and Malassezia restricta increased. Research on the mechanism of dandruff and prevention and treatment methods is currently mainly focused on Malassezia, and antifungal drugs are often used for treatment, but the treatment effect is not particularly good. Therefore, antifungal treatment of dandruff alone may not be the only effective countermeasure. Comprehensive treatment is needed to restore the homeostasis between scalp microorganisms and protect the health of the scalp from the root. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention aims to provide a strain of Propionibacterium acnes and its application. Specifically, the present invention isolates a strain of Propionibacterium acnes with good anti-inflammatory and antioxidant properties from a healthy scalp, and its fermentation supernatant has a good effect of promoting the growth of Malassezia globosa, while inhibiting the growth of Staphylococcus capitis and Malassezia restricta, and by regulating the balance between bacteria and fungi, regulating the function of the scalp flora, thereby improving dandruff and being beneficial to scalp health. Based on the above research results, the present invention is completed.

[0006] In order to achieve the above technical objectives, the technical solution provided by the present invention is as follows:

[0007] In a first aspect of the present invention, a strain of Propionibacterium acnes (Propionibacterium acnes ) CCSMS0630, the Propionibacterium acnes ( Propionibacterium acnes ) The CCSMS0630 strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration (address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China) on January 18, 2024, with the deposit number CGMCC No.29674.

[0008] The second aspect of the present invention provides a microbial agent, wherein the microbial agent contains the Propionibacterium acnes ( Propionibacterium acnes )CCSMS0630 or its fermentation products or metabolites.

[0009] The metabolites involved in the present invention include extracellular metabolites and / or intracellular metabolites.

[0010] The third aspect of the present invention provides the above-mentioned Propionibacterium acnes ( Propionibacterium acnes ) Use of CCSMS0630 or the above-mentioned microbial agents in the preparation of products.

[0011] The product has any one or more of the following effects:

[0012] (a1) Antioxidant;

[0013] (a2) anti-inflammatory;

[0014] (a3) Promote the growth and reproduction of beneficial bacteria, inhibit the growth and reproduction of harmful bacteria, and regulate the microecological balance of the scalp;

[0015] (a4) Relieve dandruff;

[0016] (a5) Improve scalp health.

[0017] The product described is a pharmaceutical product.

[0018] A fourth aspect of the present invention provides a scalp care product, which contains a culture of Propionibacterium acnes CCSMS0630; the culture comprises the supernatant, bacterial cell fragment or cell-free extract of the fermentation broth of Propionibacterium acnes CCSMS0630.

[0019] Beneficial technical effects of one or more of the above technical solutions:

[0020] The above technical scheme has been proved by experiments that the Propionibacterium acnes CCSMS0630 is rich in active ingredients such as short-chain fatty acids and has good anti-inflammatory effects. The inhibition rate of the fermentation supernatant of Propionibacterium acnes on hyaluronidase is 96.55%, the total superoxide dismutase and glutathione peroxidase activities in the fermentation supernatant are 24.01 and 98.37 U / mL, respectively, and the IC values ​​for scavenging ABTS free radicals and DPPH free radicals are 2.01 and 98.37 U / mL, respectively. 50 The concentrations were 1.49 and 27.53%, showing good anti-inflammatory and antioxidant effects. Antibacterial tests showed that 25% concentration of Propionibacterium acnes CCSMS0630 fermentation supernatant promoted the growth of Malassezia globosa CCSMS1050, significantly inhibited the growth of Staphylococcus capitis CCSMS0805 and Malassezia restricta CCSMS1060, and could regulate the microecological balance of the scalp, reduce the growth and reproduction of harmful bacteria, and help improve the health of the dandruff scalp.

[0021] In summary, the above technical solution fills the gap in the screening of Propionibacterium acnes' anti-inflammatory, antioxidant and scalp microecological regulation effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The colony morphology and bacterial image of Propionibacterium acnes CCSMS0630 of the present invention are shown in Figure 1, wherein A is a plate colony morphology image, and B is a bacterial image under a microscope.

[0023] Figure 2 This is the growth curve of Propionibacterium acnes CCSMS0630 of the present invention.

[0024] Figure 3 This is a diagram showing the inhibitory effect of the fermentation supernatant of Propionibacterium acnes CCSMS0630 on hyaluronidase of the present invention.

[0025] Figure 4 This is a diagram showing the scavenging effect of the fermentation supernatant of Propionibacterium acnes CCSMS0630 on ABTS free radicals.

[0026] Figure 5 This is a diagram showing the scavenging effect of the fermentation supernatant of Propionibacterium acnes CCSMS0630 of the present invention on DPPH free radicals.

[0027] Figure 6 This is the effect of the fermentation supernatant of Propionibacterium acnes CCSMS0630 on the growth of Staphylococcus capitis CCSMS0805.

[0028] Figure 7 This is the effect of the fermentation supernatant of Propionibacterium acnes CCSMS0630 on the growth of Malassezia globosa CCSMS1050.

[0029] Figure 8This is the effect of the fermentation supernatant of Propionibacterium acnes CCSMS0630 of the present invention on the growth of Malassezia restricta CCSMS10600. DETAILED DESCRIPTION

[0030] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0031] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0032] In a typical embodiment of the present invention, a strain of Propionibacterium acnes isolated from a healthy scalp is provided. Propionibacterium acnes ) CCSMS0630, the Propionibacterium acnes ( Propionibacterium acnes ) The CCSMS0630 strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration (address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China) on January 18, 2024, with the deposit number CGMCC No.29674.

[0033] The above-mentioned Propionibacterium acnes ( Propionibacterium acnes ) CCSMS0630 has the following microbiological characteristics:

[0034] (1) Colony characteristics: The strain grew well after streaking on a TSA plate and incubated anaerobically at 37°C for 72 h. The colonies were mainly white in color and mostly regular needle-shaped circles. The colony diameter was approximately 0.2-0.5 mm, with neat edges and a smooth, moist and opaque surface. They could be drawn into threads without hemolysis zones.

[0035] (2) Bacterial characteristics: The bacteria appear as thin rods under a microscope and are arranged in an X, Y or V shape. They have no flagella, cannot move, do not produce spores, and are Gram-positive.

[0036] (3) Cultivation characteristics

[0037] The growth temperature was between 32 and 37 °C, and the pH value was between 4.2 and 7.9. The growth rate was fastest at 37 °C and in a near-neutral environment. The delay period of strain CCSMS0630 was relatively short, entering the logarithmic growth phase at 28 h and reaching the stable phase at 72 h.

[0038] The present invention also discloses the short-chain fatty acid content of the above-mentioned Propionibacterium acnes fermentation supernatant, wherein the fermentation supernatant contains 73.03 μg / mL of acetic acid, 183.12 μg / mL of propionic acid, 9.46 μg / mL of isobutyric acid, 9.63 μg / mL of butyric acid, 6.89 μg / mL of isovaleric acid, and 20.28 μg / mL of valeric acid.

[0039] The invention also discloses the application of the fermentation supernatant of Propionibacterium acnes in anti-inflammatory and anti-oxidative scalp care products.

[0040] The present invention also discloses that the fermentation supernatant of Propionibacterium acnes has a high ability to inhibit hyaluronidase, and the inhibition rate of the fermentation supernatant on hyaluronidase reaches 96.55%, showing good anti-inflammatory effect.

[0041] The present invention also discloses that the Propionibacterium acnes CCSMS0630 has good antioxidant capacity, the total superoxide dismutase and glutathione peroxidase activities in the fermentation supernatant are 24.01 and 98.37 U / mL, and the IC values ​​of the scavenging effects on ABTS free radicals and DPPH free radicals are 24.01 and 98.37 U / mL, respectively. 50 The concentrations were 1.49 and 27.53%, showing good antioxidant effects.

[0042] In another specific embodiment of the present invention, a microbial agent is provided, wherein the microbial agent contains the Propionibacterium acnes ( Propionibacterium acnes )CCSMS0630 or its fermentation products or metabolites.

[0043] The metabolites involved in the present invention include extracellular metabolites and / or intracellular metabolites.

[0044] In the present invention, "fermented product" means a fermented product. The corresponding fermented product can be obtained by fermenting Propionibacterium acnes ( Propionibacterium acnes ) The liquid obtained by the process of CCSMS0630 can therefore also be called a fermentation liquid; the liquid may contain Propionibacterium acnes (bacteria), but does not necessarily need to contain Propionibacterium acnes. The liquid preferably contains the Propionibacterium acnes ( Propionibacterium acnes ) Metabolites produced by CCSMS0630.

[0045] The metabolites include but are not limited to short-chain fatty acids (such as acetate, propionate, isobutyrate, butyrate, isovaleric acid and valeric acid), total superoxide dismutase and glutathione peroxidase, etc.

[0046] In an embodiment of the present invention, the fermentation liquid containing the bacteria is centrifuged, filtered, sedimented or other means known in the art to separate the bacterial cells grown in the fermentation liquid or culture liquid from the liquid, and the liquid remaining after removing the bacterial cells is recorded as the supernatant. The supernatant contains at least the extracellular metabolites of Propionibacterium acnes CCSMS0630.

[0047] And, in an embodiment of the present invention, the fermentation liquid containing the bacteria is centrifuged, filtered, sedimented or other means known in the art to separate the bacterial cells grown in the fermentation liquid or culture liquid from the liquid to obtain the bacteria, and the bacteria can be crushed to obtain the bacterial crushed material, and the crushing method can be ultrasound or other means known in the art, or, further, the bacterial crushed material is centrifuged to collect the supernatant, and the supernatant can be recorded as a cell-free extract. In the present invention, the bacterial crushed material or the cell-free extract contains the extracellular metabolites and intracellular metabolites of Propionibacterium acnes CCSMS0630. In an embodiment of the present invention, the microbial agent can also include the bacterial crushed material or the cell-free extract.

[0048] In another specific embodiment of the present invention, the above-mentioned Propionibacterium acnes ( Propionibacterium acnes ) Use of CCSMS0630 or the above-mentioned microbial agents in the preparation of products.

[0049] The product has any one or more of the following effects:

[0050] (a1) Antioxidant;

[0051] (a2) anti-inflammatory;

[0052] (a3) Promote the growth and reproduction of beneficial bacteria, inhibit the growth and reproduction of harmful bacteria, and regulate the microecological balance of the scalp;

[0053] (a4) Relieve dandruff;

[0054] (a5) Improve scalp health.

[0055] Among them, in said (a1), the antioxidant is specifically manifested as being rich in active ingredients such as total superoxide dismutase and glutathione peroxidase, and having good scavenging ability for DPPH free radicals and ABTS free radicals;

[0056] In (a2), the anti-inflammatory effect is specifically manifested as a good inhibitory effect on hyaluronidase;

[0057] In the above (a3), the beneficial bacteria include Malassezia globosa, and the harmful bacteria include Staphylococcus capitis and Malassezia restricta.

[0058] The product may be any one or more of daily chemical products, cosmetics or medicines; more specifically, it may be a scalp care product, such as shampoo, conditioner, scalp essence, scalp massage cream, etc., which is not specifically limited here.

[0059] It should be noted that when the above-mentioned Propionibacterium acnes CCSMS0630 or the above-mentioned microbial agent is used as a cosmetic ingredient, the cosmetic does not contain live Propionibacterium acnes CCSMS0630. In fact, the present invention has verified through experiments that after the Propionibacterium acnes CCSMS0630 is fermented and cultured, its fermentation supernatant has the effects of anti-inflammatory, anti-oxidation and regulating scalp microecology.

[0060] In another specific embodiment of the present invention, a scalp care product is provided, the scalp care product at least contains a culture of Propionibacterium acnes CCSMS0630; the culture comprises the supernatant, bacterial cell fragments or cell-free extract of the fermentation liquid of Propionibacterium acnes CCSMS0630. The scalp care product at least has the effects of anti-inflammatory and antioxidant, regulating scalp microecology, and improving the health of dandruff scalp.

[0061] In another specific embodiment of the present invention, the scalp care product may further include any other raw material ingredients permitted to be added in the field of daily chemical products, cosmetics or medicines, and different scalp care product dosage forms may be prepared therefrom, which is not specifically limited herein.

[0062] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are selected according to conventional methods and conditions, or according to the product specifications. It should be understood that the specific embodiments described herein are only used to explain the present invention and do not constitute a limitation of the present invention.

[0063] Experimental strains: Staphylococcus capitis CCSMS0805, Malassezia globosa CCSMS1050, and Malassezia restricta CCSMS1060 were isolated from healthy human scalp skin in the laboratory.

[0064] Culture medium: TSA: 15 g / L trypticase, 5 g / L soybean papain hydrolysate, 5 g / L sodium chloride, 15 g / L agar, autoclave at 121°C for 15 min, add 5% sterile defibrinated sheep blood when cooled to about 50°C, mix well, and pour onto plates.

[0065] Tryptic soy casein broth (TSB): tryptic casein 15 g / L, soybean papain hydrolysate 5 g / L, sodium chloride, autoclave at 121℃ for 15 min, set aside.

[0066] Malassezia culture medium: ATCC culture medium: 2693 modified mDixon: malt extract powder 36 g / L, ox bile powder 20 g / L, peptone 6 g / L, glycerol 2 g / L, oleic acid 2 g / L, high pressure sterilization at 121℃ for 15 min, set aside.

[0067] Preservation medium: 120 g skim milk powder, 880 mL distilled water, autoclave at 121°C for 15 min, set aside.

[0068] Example 1 Propionibacterium acnes ( Propionibacterium acnes ) Isolation, screening and purification of CCSMS0630

[0069] (1) Recruiting volunteers with healthy scalp

[0070] No topical antifungal drugs or corticosteroid preparations have been used on the scalp within two weeks; no oral antifungal drugs have been taken within two months; no atopic dermatitis, psoriasis or other scalp skin diseases; age 18 to 30 years old, regardless of gender.

[0071] (2) Sample collection

[0072] Volunteers were asked not to wash their hair the night before sampling, and samples were generally taken at noon or in the afternoon of the next day. A sterile cotton swab made of polymer fiber material was moistened in a moistening solution (0.9% sodium chloride and 0.1% Tween-20), and rubbed back and forth 50 times on the selected area of ​​the scalp (the cotton swab should be wiped with a certain amount of force), and the sterile cotton swab was placed in the sampling tube with sterile tweezers and sealed with a sealing film. The collected samples were placed in an ice box for refrigeration, brought back to the laboratory and placed in a 4°C refrigerator, and the strains were isolated as soon as possible.

[0073] (3) Sample pretreatment

[0074] In an ultra-clean workbench, use sterile scissors to cut off the sterile cotton swab head with the sample, place it in a 5 mL centrifuge tube (EP tube), draw 5 mL of sterile water into the centrifuge tube, and mix thoroughly.

[0075] (4) Plate screening

[0076] Take 0.5 mL of the above sample solution and add 4.5 mL of sterile water for gradient dilution. Select the appropriate dilution and apply 0.1 mL of the dilution on TSA solid blood agar plates. Apply 2 plates for each dilution and place them in a 37°C incubator for anaerobically cultured for 72 h.

[0077] (5) Streaking, purification and preservation

[0078] According to the colony characteristics of Propionibacterium acnes strains on blood agar plates, such as the absence of hemolytic zone, colony size, color, moisture, and gloss, single colonies were picked and streaked on TSA blood agar plates, which were placed in a 37°C constant temperature incubator and cultured for 72 h. After multiple streaking and purification, skim milk powder was used as a protective agent and stored in a preservation tube. After freeze-drying, the agar plates were stored in a -80°C deep freezer.

[0079] The strain CCSMS0630 was screened and obtained by the above screening method.

[0080] Example 2 Propionibacterium acnes ( Propionibacterium acnes ) Microbiological identification of CCSMS0630

[0081] (1) Colony characteristics:

[0082] The strain was streaked on TSA blood agar plates and cultured at 37°C for 72 h. The colony morphology of the strain on the plate was observed. Figure 1 As shown in A, the colonies of Propionibacterium acnes on the TSA blood agar plate are white needle-shaped with neat edges and a colony diameter of approximately 0.2~0.5 mm. The surface is smooth, moist, and opaque. It can be drawn into threads when picked up, and there is no hemolysis zone.

[0083] (2) Bacterial characteristics:

[0084] A small amount of Propionibacterium acnes obtained in step (1) was selected and smeared on a glass slide, subjected to Gram staining, and the morphological characteristics of the bacteria were observed under a microscope. Figure 1 As shown in B, the bacteria are Gram-positive, thin rods arranged in X, Y or V shapes under a microscope. They have no flagella, cannot move, and do not produce spores.

[0085] (3) Cultivation characteristics:

[0086] The strain CCSMS0630 was inoculated into TSB liquid culture medium and cultured at different temperatures. Studies have shown that the minimum growth temperature of CCSMS0630 is 15°C, the maximum growth temperature is 45°C, and the optimal growth temperature is 32-37°C. When inoculated into TSB liquid culture medium with different pH values ​​and cultured at a constant temperature of 37°C, the highest growth pH of the CCSMS0630 strain was 8.0, the lowest growth pH was 4.0, and the optimal growth pH was 6.0.

[0087] (4) Genetic characteristics:

[0088] 16S rDNA sequence analysis of strain CCSMS0630

[0089] Method for extracting genomic DNA of CCSMS0630: The single colony was picked and purified and inoculated into TSB liquid medium. After anaerobic culture at 37℃ for 72h, the bacterial suspension was centrifuged (10000 r / min, 10 min) to collect the bacteria for extraction. DNA was extracted using a genomic DNA extraction kit. Two synthetic universal primers were used for PCR amplification. The upstream primer was 16s-27F: GAGAGTTTGATCCTGGCTCAG (SEQ ID NO.1); the downstream primer was 16s-1473R: CGGCTACCTTGTTACGACTT (SEQ ID NO.2). The PCR product was recovered using a column PCR product purification kit (Shanghai Biotechnology Co., Ltd.), and after purification, it was sent to Meiji Biotechnology Co., Ltd. for sequencing. The obtained 16S rDNA nucleotide sequence of CCSMS0630 is shown in SEQ ID NO.3, and the sequence length is: 1402 bp.

[0090] The strains were sent to GenBank for Blast analysis. The strain with the highest homology to strain CCSMS0630 was NR151943.1, with a homology of 99.71%.

[0091] According to Goodfellow and O'Donnell, species with a DNA G+C (mol%) ≤ 10% to 12% and a 16S rDNA sequence homology ≥ 95% can be classified as a genus, and Embley and Stackebrangdt believed that species with a 16S rDNA sequence homology ≥ 97% can be considered a species. Propionibacterium acnes Belong to the same species. Therefore, strain CCSMS0630 was identified as Propionibacterium acnes ( Propionibacterium acnes ).

[0092] Based on the above-mentioned microbiological characteristics such as colony, bacterial morphology, culture, physiological and biochemical identification, and its genetic characteristics 16s rDNA, CCSMS0630 was identified as Propionibacterium acnes ( Propionibacterium acnes ), the strain was deposited in the China General Microbiological Culture Collection Center on January 18, 2024, and its deposit number is CGMCC No.29674.

[0093] The activated Propionibacterium acnes ( Propionibacterium acnes )CCSMS0630 was inoculated into TSB liquid medium at a 2% (v / v) inoculation rate and cultured at 37°C with constant temperature shaking for 72 h. The OD value of the culture solution was measured at 600 nm every 4 h. 600 Plotting the values ​​against time yielded Propionibacterium acnes ( Propionibacterium acnes) The growth curve of CCSMS0630 in TSB broth liquid culture medium, the results are as follows Figure 2 As shown, Propionibacterium acnes ( Propionibacterium acnes ) CCSMS0630 grew rapidly in TSB broth liquid culture medium, entered the logarithmic growth phase in 28 h, and reached the stable phase in 72 h.

[0094] Example 3 Propionibacterium acnes ( Propionibacterium acnes ) Preparation of CCSMS0630 fermentation supernatant

[0095] Will C.acnes The CCSMS0630 strain was streaked onto a TSA plate, cultured at 37°C for 60-72 h, and activated twice. C.acnes CCSMS0630 was inoculated into TSB liquid medium and cultured at 37°C for 60-72 h. The OD of the bacteria was adjusted. 600 In the range of 0.3-0.4, it is used as seed liquid. The seed liquid is inoculated into a 250 mL triangular flask at an inoculation amount of 1% to 3% (v / v), and placed in a 37°C constant temperature incubator for anaerobic culture for 60-72 h to obtain the fermentation liquid of Propionibacterium acnes; the fermentation liquid is centrifuged at 9000r / min for 10 min, and the obtained centrifuged supernatant is the fermentation supernatant of Propionibacterium acnes.

[0096] Example 4 Propionibacterium acnes ( Propionibacterium acnes )Determination of short-chain fatty acids in the fermentation supernatant of CCSMS0630

[0097] (1) Sample pretreatment

[0098] Add 2 mL of supernatant, 0.4 mL of 50% H2SO4 and 2 mL of ether to a 10 mL centrifuge tube, mix well, shake on a shaker at 250 r / min for 45 min, then centrifuge at 4°C and 10,000 r / min for 5 min, take the upper organic phase, filter it through a 0.22 μm organic filter membrane before GC injection, and keep the supernatant at -20°C for later use.

[0099] (2) Gas chromatography conditions

[0100] GC was used to determine the short-chain fatty acids in the fermentation supernatant. The instrument model was GC-2010plus; the chromatographic column was Agilent DB-WAX UI (60 m×0.25 μm×0.25 mm); the injection port and detector temperature were set to 250°C; high-purity nitrogen was used as the carrier gas (flow rate 1.2 mL / min), and the splitless detection mode was adopted; the heating conditions were: the sample volume was 1 μL, and the temperature was increased from 75°C to 180°C at 10°C / min and maintained for 1 min, and then increased to 220°C at 10°C / min and maintained for 1 min.

[0101] (3) Preparation of standard curve

[0102] Water-soluble fatty acid mixed standard solution (Northern Weiye Metrology Institute): glacial acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, a total of 6 components, the standard value of each is 1000 μg / mL. Ultrapure water diluted mixed standard, respectively diluted to 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, 100 μg / mL, 200 μg / mL, 500 μg / mL, 800 μg / mL, 1000 μg / mL 9 concentration gradients, stored at -20℃ for use.

[0103] (4) Sample content determination

[0104] It was determined that the fermentation supernatant of CCSMS0630 contained 7 short-chain fatty acids, and the specific contents are shown in Table 1 below.

[0105] Table 1 Results of short-chain fatty acid content in the supernatant of CCSMS0630 fermentation

[0106]

[0107] Example 5 Propionibacterium acnes ( Propionibacterium acnes ) Determination of hyaluronidase inhibition rate of CCSMS0630 fermentation supernatant

[0108] (1) Reagents: CaCl2 solution: 2.5mmol / L; NaOH solution: 0.4mol / L; Buffer: Solution A (0.2mol / L acetic acid, 1.155mL glacial acetic acid dissolved in 100mL distilled water) 4.8mL; Solution B (0.2mol / L sodium acetate, 1.64g CH3COONa dissolved in 100mL distilled water) 45.2mL, mixed and diluted to 100mL to prepare acetate buffer with pH=5.6; Hyaluronidase solution: 500U / mL; Sodium hyaluronate solution: 0.5mg / mL; Acetylacetone solution: 1.4mL; P-DAB color developer - Ehrlihc reagent.

[0109] (2) Experimental procedures

[0110] 1. Add 100 µL of 2.5 mmol / LCaCl2 solution and 500 µL of 600 U / mL hyaluronidase solution to the test tube and treat at 37°C for 20 min.

[0111] 2. Add 500 µL of sample solution and incubate at 37°C for 20 min.

[0112] 3. Add 500 µL of 0.5 mg / mL sodium hyaluronate solution, treat at 37°C for 30 min, and let stand at room temperature for 5 min.

[0113] 4. Add 500 µL of acetylacetone solution and 100 µL of NaOH solution, boil in water bath for 15 min, and ice bath for 5 min.

[0114] 5. Add 1 mL of P-DAB reagent, color develop at room temperature for 20 minutes, take 200 µL from each centrifuge tube and place it on the ELISA plate, and measure its absorbance at a wavelength of 530 nm.

[0115] The experiment was set up with 3 replicate wells and the average value was taken.

[0116] (3) Calculate the hyaluronidase inhibition rate: inhibition rate / % = ((CD)-(AB)) / (CD)×100.

[0117] Where: A: OD of hyaluronidase solution + sample 530 ;

[0118] B: OD of acetate buffer + sample 530 ;

[0119] C: OD of hyaluronidase solution + sample solvent 530 ;

[0120] D: OD of acetate buffer + sample solvent 530 .

[0121] The test results are as follows Figure 3 As shown, Propionibacterium acnes ( Propionibacterium acnes ) The hyaluronidase inhibition rate of CCSMS0630 fermentation supernatant was 96.55±5.88%, showing a good anti-inflammatory effect.

[0122] Example 6 Propionibacterium acnes ( Propionibacterium acnes )Determination of total superoxide dismutase and glutathione peroxidase in the fermentation supernatant of CCSMS0630

[0123] (i) Prepare the required working solution according to the instructions of the glutathione peroxidase (GSH-PX) test kit (Nanjing Jiancheng Bioengineering Institute) and conduct the following experiment.

[0124] (1) Enzymatic reaction: the specific operation is shown in Table 2 below.

[0125] Table 2 Specific operation of enzymatic reaction

[0126]

[0127] (2) Color development reaction. The specific operation is shown in Table 3 below.

[0128] Table 3 Specific operation of color reaction

[0129]

[0130] Mix well, let stand at room temperature for 15 min, and then measure the OD value of each tube at 412 nm, 1 cm optical path, and zero with distilled water.

[0131] Calculation formula: GSH-PX activity = (OD value of non-enzyme tube - OD value of enzyme tube) / (OD value of standard tube - OD value of blank tube) × standard concentration (20 μmol / L) × dilution factor (6×).

[0132] 100 μL of the fermentation supernatant of Propionibacterium acnes CCSMS0630 was taken and the GSH-PX activity was calculated to be 98.37±1.55U / mL.

[0133] (ii) Prepare the required working solution according to the instructions of the Total Superoxide Dismutase (T-SOD) Assay Kit (Nanjing Jiancheng Bioengineering Institute), and perform the following experiment according to Table 4:

[0134] Table 4 Specific operation of T-SOD detection

[0135]

[0136] Mix well, let stand at room temperature for 10 min, and perform colorimetry at a wavelength of 550 nm, using a 1 cm optical path cuvette and adjusting to zero with distilled water.

[0137] Calculation formula: Total SOD activity (U / ml) = (control OD value - measured OD value) / (control OD value) ÷ 50% × dilution multiple of the reaction system × dilution multiple of the sample before testing.

[0138] 100 μL of the fermentation supernatant of Propionibacterium acnes CCSMS0630 was taken and the T-SOD activity was calculated to be 24.01±2.05U / mL.

[0139] Example 7 Propionibacterium acnes ( Propionibacterium acnes ) ABTS free radical scavenging assay of CCSMS0630 fermentation supernatant

[0140] Mix equal volumes of 7 mmol / L ABTS and 2.6 mmol / L potassium persulfate solution and keep in the dark at room temperature for 12-16 hours to obtain ABTS + The stock solution was diluted with anhydrous ethanol before use to make its absorbance at 734 nm wavelength 0.70 ± 0.02, and ABTS was obtained. + Working solution. Control solution: Take a 10 mL test tube and add ABTS +1.0 mL of working solution and 3.0 mL of anhydrous ethanol were added to a test tube to a final volume of 4.0 mL, and the solution was allowed to stand for 30 min. The absorbance was measured at a wavelength of 734 nm and recorded as a0. Sample solution: CCSMS0630 fermentation supernatant was diluted 20, 40, 60, 80, and 100 times, anhydrous ethanol was added to 2.0 mL, and ABTS was added. + The working solution was adjusted to a final volume of 4.0 mL, and the reaction was allowed to stand in the dark for 30 min. The absorbance was measured at a wavelength of 734 nm and recorded as a. C As a positive control, each sample was repeated 3 times, and the ABTS free radical scavenging rate (%) = (a0-a) / a0×100%.

[0141] The test results are as follows Figure 4 As shown in the figure, the ABTS free radical scavenging ability of the fermentation supernatant of Propionibacterium acnes CCSMS0630 increased with the increase of the fermentation supernatant concentration. 50 The concentration was 1.49%. The results showed that the fermentation supernatant of Propionibacterium acnes CCSMS0630 had good antioxidant and free radical scavenging ability.

[0142] Example 8 Propionibacterium acnes ( Propionibacterium acnes ) DPPH free radical scavenging test of CCSMS0630 fermentation supernatant

[0143] Control group: 1 mL of 2×10 -4 mol / L DPPH solution, add water to make the final volume 4 mL, keep it away from light at room temperature for 30 minutes, and measure the absorbance at 517 nm, which is recorded as a0; sample solution: take 1 mL of DPPH solution and 1 mL of fermentation supernatant with concentrations of 5%, 2.5%, and 1.67%, respectively, and add water to make the final volume 4 mL, keep it away from light at room temperature for 30 minutes, and measure the absorbance of fermentation supernatant with different concentrations, which is recorded as a. C As a positive control, each sample was repeated 3 times, and the DPPH free radical scavenging rate (%) = (a0-a) / a0×100%.

[0144] The test results are as follows Figure 5 As shown in Figure 2, the scavenging ability of the fermentation supernatant of Propionibacterium acnes CCSMS0630 on DPPH free radicals increased with the increase of concentration, and the IC 50 The concentration was 27.53%. The results showed that the fermentation supernatant of Propionibacterium acnes CCSMS0630 had good antioxidant and free radical scavenging ability.

[0145] Example 9 Propionibacterium acnes ( Propionibacterium acnes)Intervention of CCSMS0630 fermentation supernatant on Staphylococcus capitis CCSMS0805

[0146] (1) Fermentation supernatant concentration selection: fermentation supernatant and sterile TSB liquid culture medium were mixed in a 1:1 ratio using the half-dilution method to obtain fermentation supernatant with concentrations of 25, 12.5, 6.25, 3.125, and 1.562%.

[0147] (2) Preparation of bacterial suspension of Staphylococcus capitis CCSMS0805: Take out the freeze-dried tube of Staphylococcus capitis strain milk powder stored at -80℃, streak TSA solid plate, and place it in a 37℃ constant temperature incubator for aerobic culture for 24 h; after activation twice, pick a single colony of Staphylococcus capitis that has been activated for two generations and inoculate it into a test tube containing 5 mL of TSB liquid culture medium, place it in a 37℃ incubator, and culture it aerobically for 18-24 h. Adjust the bacterial OD 600 Around 0.55-0.56, keep in reserve.

[0148] (3) In the experimental group, 50 μL of bacterial solution, 50 μL of sample and 100 μL of TSB were added to each well of the 96-well plate. In the blank group, 100 μL of TSB and 100 μL of sample were added. In the sterility control well, 200 μL of TSB was added. In the growth control well, 150 μL of TSB and 50 μL of bacterial solution were added. Four replicate wells were made for each group.

[0149] (4) Incubate the 96-well plate at 37°C for 24 h and measure the OD using an ELISA reader. 600 The inhibition rate was calculated as 1-(OD value of the experimental group-OD value of the experimental blank group) / (OD value of the growth control well-OD value of the sterile control well) × 100%.

[0150] The test results are as follows Figure 6 As shown, the fermentation supernatant of Propionibacterium acnes CCSMS0630 promoted the growth of Staphylococcus capitis CCSMS0805 at low concentrations and inhibited its growth at high concentrations. At a concentration of 25%, the growth inhibition rate of Staphylococcus capitis CCSMS0805 was 21.47±4.39%, indicating that it significantly inhibited the growth of Staphylococcus capitis of normal scalp flora, regulated the scalp microecology, and helped to improve scalp health.

[0151] Example 10 Intervention test of fermentation supernatant of Propionibacterium acnes CCSMS0630 on Malassezia globosa CCSMS1050

[0152] (1) Selection of fermentation supernatant concentration: The fermentation supernatant was mixed with sterile Dixon medium in a ratio of 1:1 using the half-dilution method to obtain fermentation supernatants with concentrations of 25, 12.5, 6.25, 3.13, and 1.56%.

[0153] (2) Preparation of Malassezia suspension: Take out the -80℃ preserved spherical Malassezia CCSMS1050 strain milk powder freeze-dried tube, streak the Dixon agar plate, streak it using the three-zone streak method, place it in a 32℃ constant temperature incubator and culture it for 72 h to make the first generation activation plate, pick a single colony from the colonies grown on the first generation plate, streak it on the second generation plate, place it in a 32℃ constant temperature incubator and culture it aerobically for 72 h, and set it aside. Pick a single colony from the two generations of Malassezia activated and inoculate it into a conical flask containing 100 mL of Dixon liquid culture medium, place it in a 32℃ shaker, and shake and culture it at a speed of 150 r / min for 72 h, and adjust the bacterial OD 600 In the range of 0.7-0.8, for standby use.

[0154] (3) In the experimental group, 50 μL of bacterial solution, 50 μL of sample and 100 μL of Dixon were added to each well of the 96-well plate. In the blank group, 100 μL of Dixon and 100 μL of sample were added. In the sterility control well, 200 μL of Dixon was added. In the growth control well, 150 μL of Dixon and 50 μL of bacterial solution were added. Four replicate wells were made for each group.

[0155] (4) Incubate the 96-well plate at 32°C for 72 h and measure the OD using an ELISA reader. 600 The inhibition rate was calculated as 1-(OD value of the experimental group-OD value of the experimental blank group) / (OD value of the growth control well-OD value of the sterile control well) × 100%.

[0156] The test results are as follows Figure 7 As shown in the figure, the fermentation supernatant of Propionibacterium acnes CCSMS0630 inhibited the growth of Malassezia sphaeroides CCSMS1050 at low concentrations, promoted its growth at high concentrations, and the proliferation rate increased with the increase of concentration. At a concentration of 25%, the growth proliferation rate of Malassezia sphaeroides CCSMS1050 was 20.78±3.08%, indicating that the fermentation supernatant of Propionibacterium acnes CCSMS0630 can significantly promote the growth of Malassezia sphaeroides at low concentrations, regulate the scalp microecology, and help relieve dandruff.

[0157] Example 11 Intervention test of fermentation supernatant of Propionibacterium acnes CCSMS0630 on restrictive Malassezia CCSM1060

[0158] (1) Selection of fermentation supernatant concentration: The fermentation supernatant was mixed with sterile Dixon medium in a ratio of 1:1 using the half-dilution method to obtain fermentation supernatants with concentrations of 25, 12.5, 6.25, 3.13, and 1.56%.

[0159] (2) Preparation of Malassezia bacterial suspension: Take out the -80℃ storage restricted Malassezia CCSM1060 strain milk powder freeze-dried tube, streak the Dixon agar plate, streak it using the three-zone streak method, place it in a 32℃ constant temperature incubator and culture it for 72 h to make the first-generation activation plate, pick a single colony from the colonies grown on the first-generation plate, streak it on the second-generation plate, place it in a 32℃ constant temperature incubator and culture it aerobically for 72 h, and set it aside. Pick a single colony of the Malassezia that has been activated for two generations and inoculate it into a conical flask containing 100 mL of Dixon liquid culture medium, place it in a 32℃ shaker, and shake and culture it at a speed of 150 r / min for 72 h. Adjust the bacterial OD 600 In the range of 0.7-0.8, for standby use.

[0160] (3) In the experimental group, 50 μL of bacterial solution, 50 μL of sample and 100 μL of Dixon were added to each well of the 96-well plate. In the blank group, 100 μL of Dixon and 100 μL of sample were added. In the sterility control well, 200 μL of Dixon was added. In the growth control well, 150 μL of Dixon and 50 μL of bacterial solution were added. Four replicate wells were made for each group.

[0161] (4) Incubate the 96-well plate at 32°C for 72 h and measure the OD using an ELISA reader. 600 The inhibition rate was calculated as 1-(OD value of the experimental group-OD value of the experimental blank group) / (OD value of the growth control well-OD value of the sterile control well) × 100%.

[0162] The test results are as follows Figure 8 As shown, the fermentation supernatant of Propionibacterium acnes CCSMS0630 has a certain antifungal ability. The inhibition rate of the fermentation supernatant on Malassezia restricta CCSM1060 is about 20%. When the concentration is 25%, the growth inhibition rate of Malassezia restricta CCSM1060 is 25.48±2.87%, indicating that the fermentation supernatant of Propionibacterium acnes CCSMS0630 significantly inhibits the growth of Malassezia restricta, has potential in regulating the scalp microecology, and helps to improve scalp health.

[0163] Propionibacterium acnes CCSMS0630 contains active ingredients such as short-chain fatty acids, total superoxide dismutase and glutathione peroxidase, has good anti-inflammatory and antioxidant abilities, can significantly promote the growth of resident scalp fungi Propionibacterium acnes, and can also promote the growth of globose Malassezia, and has a certain inhibitory effect on the growth of restrictive Malassezia. The present invention lays a foundation for the excavation of functional skin bacteria.

[0164] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A strain of Propionibacterium acnes ( Propionibacterium acnes ) CCSMS0630, characterized in that, The Propionibacterium acnes ( Propionibacterium acnes ) CCSMS0630 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 18, 2024, with the deposit number CGMCC No.29674.

2. A microbial agent, characterized in that: The microbial agent contains the Propionibacterium acnes described in claim 1 ( Propionibacterium acnes )CCSMS0630 or its fermentation product.

3. A microbial agent, characterized in that: The microbial agent contains the Propionibacterium acnes described in claim 1 ( Propionibacterium acnes ) Fermentation supernatant of CCSMS0630.

4. The Propionibacterium acnes of claim 1 ( Propionibacterium acnes )The use of the microbial agent described in CCSMS0630 or any one of claims 2-3 in the preparation of a product; the product is a medicine; The product has any one or more of the following effects: (a1) Antioxidant; (a2) anti-inflammatory; (a3) Promote the growth and reproduction of beneficial bacteria, inhibit the growth and reproduction of harmful bacteria, and regulate the microecological balance of the scalp; In (a3), the beneficial bacteria are Malassezia globosa, and the harmful bacteria are Staphylococcus capitis and Malassezia restricta; In the above (a3), Propionibacterium acnes ( Propionibacterium acnes ) The fermentation supernatant concentration of CCSMS0630 was 25%, 12.5% ​​or 6.25%.

5. Use of the microbial agent according to any one of claims 2 to 3 in the preparation of a product, wherein the product is a cosmetic; and the cosmetic does not contain live Propionibacterium acnes CCSMS0630; The product has any one or more of the following effects: (a1) Antioxidant; (a2) anti-inflammatory; (a3) Promote the growth and reproduction of beneficial bacteria, inhibit the growth and reproduction of harmful bacteria, and regulate the microecological balance of the scalp; In (a3), the beneficial bacteria are Malassezia globosa, and the harmful bacteria are Staphylococcus capitis and Malassezia restricta; In the above (a3), Propionibacterium acnes ( Propionibacterium acnes ) The fermentation supernatant concentration of CCSMS0630 was 25%, 12.5% ​​or 6.25%.

6. The use according to claim 5, characterized in that The product is a scalp care product.

7. The use according to any one of claims 4 to 6, characterized in that: In the above (a1), the antioxidant is specifically manifested in that it contains total superoxide dismutase and glutathione peroxidase, and has the ability to scavenge DPPH free radicals and ABTS free radicals.

8. The use according to any one of claims 4 to 6, characterized in that: In the above (a2), the anti-inflammatory effect is specifically manifested as an inhibitory effect on hyaluronidase.

9. A scalp care product, characterized in that: The scalp care product contains the Propionibacterium acnes according to claim 1 ( Propionibacterium acnes ) CCSMS0630 culture; the culture contains the Propionibacterium acnes ( Propionibacterium acnes ) The supernatant of CCSMS0630 fermentation broth; the concentration of the supernatant is 25%, 12.5% ​​or 6.25%.

Images