A cucumber CsAPT3 gene and its DNA methylation molecular marker and application

Abstract

The present invention discloses a DNA methylation molecular marker of cucumber CsAPT3 gene and its application, wherein the nucleotide sequence of the CsAPT3 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.2. The present invention finds that the expression of CsAPT3 gene is significantly upregulated in BN32-7 compared with JY30 after inoculation of aphids in cucumber aphid-sensitive varieties JY30 and high-resistant BN32-7, and GO enrichment analysis, and on this basis, the DNA methylation molecular marker on CsAPT3 gene is determined, and the molecular marker and its amplification primer can provide theoretical basis and genetic basis for cultivating cucumber molecular breeding with aphid resistance, and at the same time, it is applied to the breeding of cucumber aphid-resistant germplasm, which can effectively improve the breeding rate of cucumber aphid-resistant excellent varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a cucumber CsAPT3 gene and a DNA methylation molecular marker and application thereof. Background Art

[0002] Cucumber (Cucumis sativus L.) is an annual climbing herbaceous plant of the Cucurbitaceae family. Cucumber is rich in nutrients such as vitamin C, vitamin K, potassium and magnesium, and has many benefits for human health. Eating cucumbers helps promote digestion, moisturize the intestines and promote bowel movements, promote diuresis and detoxification, reduce swelling and lose weight, and enhance immunity. At the same time, the cucumber enzyme in cucumbers has a significant antioxidant effect, which can delay skin aging and maintain skin elasticity. Therefore, it is widely used in beauty and skin care products, and has extremely high economic and health value.

[0003] Aphids are a general term for the superfamily Aphidoidea of ​​the order Hemiptera. Currently, there are 10 families and about 4,400 species of aphids that have been discovered, most of which belong to the family Aphididae. They are widely distributed around the world, causing a 5-20% reduction in grain crop yields each year, and are one of the top ten economic pests in the world. Aphids harm many crops, especially during the cucumber production period. They produce a large amount of honeydew on the tender parts of cucumbers, causing sooty mold disease, affecting plant photosynthesis, and thus leading to insufficient plant nutrients. At the same time, they can also spread viruses, causing plant wilt or death, which is very harmful to production. The common method of controlling aphids in cucumber production is spraying pesticides, but this will lead to the "3R" problem. Therefore, from a genetic point of view, breeding aphid-resistant varieties is the fundamental way to deal with the stress and harm of cucumber aphids, and can fundamentally solve the problem of pests in production.

[0004] In eukaryotes, a methyl group can be introduced to the carbon atom 5 of the nucleotide cytosine base under the catalysis of DNA methyltransferase, a phenomenon called DNA methylation. DNA methylation is an important epigenetic modification that plays an important role in regulating gene expression and inhibiting transposon activity. Organisms can adjust their DNA methylation levels according to environmental changes, thereby producing different phenotypes to adapt to the new environment, and these phenotypic changes can also be inherited to offspring. This makes changes in DNA methylation closely related to biological stress responses.

[0005] At present, there are few studies on cucumber epigenetics, the response mechanism of DNA methylation to aphid stress in cucumber is still unclear, and there are no molecular markers in cucumber that can be used to select aphid-resistant germplasm. Therefore, obtaining a molecular marker of DNA methylation that can be used in cucumber aphid-resistant breeding and obtain excellent genetic traits and excellent varieties has become a technical problem that needs to be solved urgently. In addition, the traditional screening and identification method of cucumber aphid resistance is labor-intensive, time-consuming and labor-intensive, and is easily interfered by external unstable factors, resulting in a decrease in accuracy. There is an urgent need for a method that can quickly and accurately identify cucumber aphid resistance. Summary of the invention

[0006] Purpose of the invention: In order to solve the above-mentioned technical problems of time-consuming, labor-intensive and low-precision screening and identification of traditional cucumber aphid resistance, the present invention aims to provide a cucumber CsAPT3 gene and its molecular marker, which can be used to effectively and quickly screen out cucumber aphid-resistant varieties, improve selection efficiency, and improve selection accuracy in the separation generation.

[0007] The invention also provides a DNA methylation molecular marker amplification primer pair of cucumber CsAPT3 gene and application thereof.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a cucumber CsAPT3 gene, the nucleotide sequence of the CsAPT3 gene is shown in SEQ ID NO.1.

[0009] The nucleotide sequence of the cucumber DNA methylation molecular marker based on the cucumber CsAPT3 gene of the present invention is shown as SEQ ID NO.2.

[0010] Among them, the primer pair used to amplify and detect the cucumber DNA methylation molecular marker of the cucumber CsAPT3 gene is:

[0011] Upstream primer: AAATTTTAGGTATATTGTTTTAGGATATTA;

[0012] Downstream primer: AAACCAAAAATTAAAAAATTTAAATAC.

[0013] The application of the cucumber CsAPT3 gene or the cucumber DNA methylation molecular marker or primer pair of the cucumber CsAPT3 gene of the present invention includes any one or more of the following:

[0014] (1) Application in detecting DNA methylation in cucumber;

[0015] (2) Application in breeding or testing cucumber varieties with resistance to aphids;

[0016] (3) Application in identification of aphid-resistant cucumber varieties;

[0017] (4) Application in the production of aphid-resistant cucumber varieties.

[0018] The cucumber CsAPT3 gene or the cucumber DNA methylation molecular marker or primer pair of the cucumber CsAPT3 gene of the present invention is used in improving the breeding rate of aphid-resistant superior cucumber varieties.

[0019] Further, breeding aphid-resistant cucumber varieties includes the following steps:

[0020] S1, extracting the cucumber genomic DNA to be tested;

[0021] S2, sulfite conversion followed by DNA purification;

[0022] S3, using the purified DNA as a template and performing PCR amplification using the primers;

[0023] S4. Sequence the amplified products and analyze the data, and select plants with low methylation levels of the CsAPT3 gene by referring to the molecular markers, which are cucumber aphid-resistant germplasm.

[0024] Furthermore, the reaction system for sulfite conversion in step S2 is: DNA 7-10 μl, CT Conversion Mix 130-150 μl, ddH2O 13-15 μl;

[0025] The amplification program was as follows: ①98℃10min; ②64℃40min; ③98℃5min; ④64℃40min; ⑤98℃5min; ⑥64℃40min; ⑦4℃Hold.

[0026] Furthermore, the PCR amplification system in step S3 is: 2-5 μl of genomic DNA modified with sulfite, 25-30 μl of 2×EpiArt HS Taq MasterMix, 2-3 μl of each of forward and reverse primers, and 19-20 μl of ddH2O;

[0027] The amplification program was as follows: ① 95℃ for 3 min; ② 95℃ for 15 sec, 50℃ for 15 sec, 72℃ for 2 sec, 33 cycles; ③ 72℃ for 5 min.

[0028] The cucumber CsAPT3 gene or the cucumber DNA methylation molecular marker or primer pair of the cucumber CsAPT3 gene of the present invention is used in screening individuals with low methylation levels as breeding parents.

[0029] The cucumber CsAPT3 gene or the cucumber DNA methylation molecular marker or primer pair of the cucumber CsAPT3 gene of the present invention is used in cultivating cucumber germplasm with low methylation degree.

[0030] The invention uses an aphid-susceptible cucumber variety JY30 and an aphid-resistant cucumber variety BN32-7 as samples, performs insect inoculation treatment on them, obtains differential methylation regions (DMRs), differential methylation region-related genes (DMR genes), differentially expressed genes (DEGs), and differentially methylation-related differentially expressed genes (DMR DEGs) of cucumber aphid-resistant and aphid-susceptible varieties through whole genome bisulfite sequencing (WGBS) and transcriptome, and through differential methylation and differential expression analysis, respectively, obtains CsAPT3 gene DMRDEG in cucumber aphid-resistant material BN32-7, and the gene is not induced to be differentially methylated and differentially expressed in cucumber aphid-susceptible material JY30, so the aphid resistance of cucumber germplasm can be judged through the gene, and further determines the DNA methylation molecular marker csapt3 located at the CsAPT3 gene. The DNA methylation molecular marker csapt3 of cucumber CsAPT3 gene was applied to screen cucumber germplasms with different aphid resistance levels. The DNA methylation level of CsAPT3 in germplasms with different aphid resistance levels was verified by sulfite treatment, PCR amplification with primers of molecular marker csapt3 and Sanger sequencing.

[0031] The results showed that the DNA methylation level of the DNA methylation molecular marker csapt3 of the cucumber CsAPT3 gene was related to the aphid resistance of cucumber, and there was a negative correlation between the aphid resistance of cucumbers of different germplasms and the DNA methylation level, that is, the lower the DNA methylation level, the higher the aphid resistance of the cucumber. At the same time, the results obtained by the present invention were consistent with those obtained by the traditional cucumber aphid resistance identification method, which proved that the molecular marker provided by the present invention can be applied to the breeding of aphid-resistant cucumber germplasm.

[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0033] The present invention develops a brand-new cucumber CsAPT3 gene and a cucumber DNA methylation molecular marker thereof. The DNA methylation level of the molecular marker csapt3 of the cucumber aphid response-related gene CsAPT3 is related to the aphid resistance of the cucumber. The aphid resistance of cucumbers of different germplasms is negatively correlated with the DNA methylation level, that is, the lower the DNA methylation level of the molecular marker csapt3, the higher the aphid resistance of the cucumber. Therefore, this molecular marker has a huge application prospect in the breeding of cucumber aphid-resistant germplasm. At the same time, the present invention designs a specific primer pair of the molecular marker for amplification and detection, which can effectively and quickly screen out excellent aphid-resistant cucumber varieties, improve the selection efficiency, and can also improve the accuracy of selection in the separation generation.

[0034] The present invention designs DNA methylation primers for CsAPT3 gene molecular marker csapt3 through molecular markers, which can be used to effectively, accurately and quantitatively detect the DNA methylation degree of cucumber CsAPT3 gene molecular marker csapt3. The DNA methylation molecular marker of cucumber CsAPT3 gene provided by the present invention can be used as a novel epigenetic molecular marker, providing a theoretical basis and genetic foundation for cultivating cucumber molecular breeding with aphid resistance, and is also applied to cucumber aphid-resistant germplasm breeding, which can effectively improve the breeding rate of cucumber aphid-resistant excellent varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is the expression level of CsAPT3 in cucumber resistant and susceptible varieties before and after insect inoculation;

[0036] Figure 2 is the DNA methylation level of CsAPT3 before and after inoculation in cucumber resistant and susceptible varieties;

[0037] Figure 3 It is the result of PCR amplification of DNA methylation molecular markers;

[0038] Figure 4 Screening results for positive clones;

[0039] Figure 5 The DNA methylation levels of CsAPT3 gene in cucumber germplasms with different aphid resistance after inoculation;

[0040] Figure 6 These are the screening results of traditional cucumber aphid resistance identification methods for cucumber germplasms with different aphid resistance. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0042] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0043] The experimental methods without specific conditions in the examples are usually carried out under conventional conditions or conditions recommended by the manufacturers.

[0044] Cucumber variety JY30: Liang Dana, Hu Qijing, Cao Lei, et al. Effects of aphid infestation on malondialdehyde content and protective enzyme activity in cucumber leaves [J]. Journal of Jiangsu Agricultural Sciences, 2016, 32(2): 7. DOI: 10.3969 / j.issn.1000-4440.2016.02.007. This germplasm resource was provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0045] Cucumber variety BN32-7: Shen Di. Genetic diversity analysis of Xishuangbanna cucumber population and QTL positioning of cucumber flesh color [D]. Chinese Academy of Agricultural Sciences, 2009. This germplasm resource was provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0046] Cucumber variety YVnv: WANG FuDong, CAI ZhuHu, JIANG PanPan. New super-small fruit cucumber varieties Jintong and Yunu [J]. China Vegetables, 2011, 1(17). This germplasm resource is provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0047] Cucumber variety 407: Wang Lei, Liu Xingwang, Jin Baoyan, et al. Physiological and CATmRNA gene response mechanism of salicylic acid improving cucumber low temperature tolerance[J]. Acta Agriculturae Boreali-Sinica, 2010,

[0048] 25(3):92-96.DOI:10.7668 / hbnxb.2010.03.021. The germplasm resources were provided by the seed bank of Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0049] Cucumber variety JY35: Fu Xin, Zhang Yanyan, Che Haojie, et al. Salicylic acid participates in grafting-induced cold tolerance of cucumber seedlings [J]. Journal of Plant Physiology, 2022, 58(12): 2386-2400. This germplasm resource is provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0050] Cucumber variety OFBAT18: Chen Xuehao, Liu Qianya, Xu Xuewen, et al. Two InDel markers closely linked to the yellow-white peel of cucumber and their application. CN201710818568.8 [2024-06-19]. This germplasm resource is provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0051] Cucumber variety SXLH: Qin Lien. Pollution-free high-yield cultivation of Japanese summer cucumber in facilities [J]. Agricultural Research and Application, 2008, 000(003): 36-38. DOI: 10.3969 / j.issn.2095-0764.2008.03.015. This germplasm resource is provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0052] Cucumber variety C8: Fang Xiujuan, Gu Xingfang. Breeding of a new open-field cucumber variety Zhongnong 8 [J]. Chinese Vegetables, 1996(1):3. DOI:CNKI:SUN:ZGSC.0.1996-01-004. This germplasm resource was provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0053] Cucumber variety YVlong: Wang Ying, Li Lei, Qin Yuhong, et al. Breeding of a new cucumber variety Yulong in South China [J]. Shanghai Vegetables, 2018(2):2. DOI:CNKI:SUN:SHSC.0.2018-02-004. The germplasm resources are provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0054] Cucumber variety ACU057: VanN TT, Chen Jinfeng. Anther culture of cucumber (Cucumis issativus L.) [J]. Chinese Vegetables, 2012, 25(2): 5. DOI: 10.3969 / j.issn.1673-2871.2012.02.001. This germplasm resource was provided by the seed bank of the Cucumber Genetics, Breeding and Molecular Biology Laboratory, College of Horticulture and Landscape Architecture, Yangzhou University.

[0055] Example 1

[0056] Cucumber transcriptome and DNA methylation sequencing

[0057] The highly susceptible cucumber aphid variety JY30 and the highly resistant variety BN32-7 were used for the study. Six replicates were taken for each variety and cultured in the same environment until the one-leaf-one-heart stage. 40 2-3-year-old cucumber aphids were selected and inoculated on the leaves. The aphids were removed after 72 hours, and leaf samples were taken for subsequent experiments to extract DNA and RNA. Transcriptome and DNA methylation sequencing were performed according to the following steps.

[0058] Transcriptome sequencing was completed by Wuhan Bena Technology Co., Ltd. The process is as follows:

[0059] S1: Transcriptome sequencing of cucumber varieties with high aphid susceptibility and resistance;

[0060] (1) RNA Easy Fast Plant Tissue RNA Rapid Extraction Kit (Tian Gen) was used to extract RNA from insect-infected JY30, insect-infected BN32-7, non-infected JY30, and non-infected BN32-7.

[0061] (2) The deionized TotalRNA sample was denatured at an appropriate temperature to open its secondary structure, and mRNA was enriched using oligo(dT) magnetic beads.

[0062] (3) Add a fragmentation reagent to the mRNA obtained in (2), and react at an appropriate temperature for a certain period of time to fragment the mRNA.

[0063] (4) Add the first-strand synthesis reaction system prepared in advance to the interrupted mRNA, synthesize the first-strand cDNA according to the corresponding program on the PCR instrument, prepare the second-strand synthesis reaction system, react at an appropriate temperature for a certain period of time, and synthesize the second-strand cDNA.

[0064] (5) preparing a reaction system, reacting at an appropriate temperature for a certain period of time, repairing the ends of the double-stranded cDNA, adding an A base to the 3' end, preparing an adapter ligation reaction system, reacting at an appropriate temperature for a certain period of time, and ligating the adapter to the cDNA.

[0065] (6) Prepare a PCR reaction system and set a reaction program to amplify the ligation product.

[0066] (7) After the PCR product is denatured into a single strand, a circularization reaction system is prepared, which is thoroughly mixed and reacted at an appropriate temperature for a certain period of time to obtain a single-stranded circular product. After digesting the linear DNA molecules that have not been circularized, the final library is obtained.

[0067] (8) Use Agilent 2100 Bioanalyzer to detect the fragment size and concentration of the library.

[0068] (9) After the library is qualified, it is sequenced using the BGI high-throughput sequencing platform T7.

[0069] S2: DNA methylation sequencing of cucumber varieties with high sensitivity and resistance to aphids;

[0070] (1) DNA was extracted using the Tiangen Plant Genomic DNA Extraction System.

[0071] (2) After the sample passed the test, 100 ng of genomic DNA and 0.5 ng of unmethylated lambda DNA were mixed using a Covaris S220 ultrasonic disruptor, and then fragmented into 200-400 bp fragments.

[0072] (3) After fragmentation, the unmethylated cytosine was converted to uracil using the EZ DNA Methylation-Gold™ Kit (Zymo Research), followed by construction of a small fragment library (Benagen, WuHan, China).

[0073] (4) The library was tested using the 5400 Fragment Analyzer System. Samples that passed the test were subjected to paired-end sequencing using the Illumina Novasek (Illumina, CA, USA) sequencing platform, using the PE150 sequencing strategy.

[0074] The obtained transcriptome sequencing raw data were subjected to differential expression analysis using DESeq2 (v1.36.0). By comparing the cucumber aphid highly susceptible variety JY30 and the highly resistant variety BN32-7, the differentially expressed genes (DEGs) with significantly upregulated or downregulated expression levels were obtained. The screening criteria were |Log2(FoldChange)|≥1 and padj<0.05.

[0075] The raw data of DNA methylation sequencing were evaluated for quality using FastQC (fastqc_v0.11.5), and then the raw data were filtered using fastp (fastp 0.23.1). The filtered data were clean data, and the clean data were evaluated for data quality again using FastQC, and this part of the data was used for subsequent analysis. The clean data were aligned to the reference genome using Bismark (v0.16.3; Krueger F, 2011). During the alignment, the reference genome was first base-converted (C-to-T, G-to-A), and the index of the reference genome was generated using bowtie2 (Langmead B, 2012). At the same time, the reads obtained by sequencing were also base-converted, and then directly aligned to the reference genome. The best unique alignment result was taken and aligned to the original reference genome again to obtain the methylation status and position of all C sites. When reads are aligned to the same position in the reference genome, they are considered to be repeated sequences. After removing the repeated sequences, the sequencing depth and genome coverage are counted respectively. The results of the methylation analysis are extracted (bismark_methylation_extractor, --no_overlap) and converted into BigWig format, and IGV is used to visualize the methylation analysis. Based on the conversion of the C site in lambda DNA, the BS conversion rate during library construction is evaluated. For the identified methylation sites, their methylation levels (Methylation level, ML) are calculated respectively. The calculation formula for the methylation level is:

[0076]

[0077] Where ML is the methylation level, and mC represents the number of reads supporting that the site is methylated C.

[0078] DSS (v2.12.0) was then used to analyze differentially methylated regions (DMRs). According to the distribution of DMRs in the genome, DMRs were divided into gene coding regions (from TSS to TES) and promoter regions (2 kb upstream of TSS). The R package GOseq was used to perform GO (Gene Ontology) enrichment analysis of DMR-related genes, and a P-value less than 0.05 was considered to be significantly enriched. KOBAS software was used to perform KEGG pathway enrichment analysis of DMR-related genes.

[0079] Based on the reported (Aphid feeding induces the relaxation of epigenetic control and the associated regulation of the defense response in Arabidopsis[J].New Phytologist,2021.DOI:10.1111 / nph.17226.) DNA methylation regulation of aphid stress in other plants was compared and the homologous gene CsAPT3 in cucumber was screened out. According to the transcriptome and DNA methylation data analysis of the highly susceptible cucumber aphid variety JY30 and the highly resistant variety BN32-7, such as Figure 1 As shown in Figure 2, it was found that the expression of CsAPT3 gene was significantly upregulated in BN32-7 compared with JY30 after inoculation; Figure 2 As shown, it was found that the CsAPT3 gene was a differentially expressed gene (DMR-DEG) associated with differential methylation in the cucumber aphid-resistant material BN32-7, while the gene was not induced to be differentially methylated and differentially expressed in the cucumber aphid-susceptible material JY30, and then the DNA methylation molecular marker csapt3 located in the CsAPT3 gene was designed. The CsAPT3 gene has a nucleotide sequence as shown in SEQ ID NO.1, and the nucleotide sequence of the DNA methylation molecular marker is shown in SEQ ID NO.2. Figure 1 and 2 At the same time, the combined transcriptome and DNA methylation data analysis proved that the DNA methylation level of the DNA methylation molecular marker csapt3 of the cucumber CsAPT3 gene was related to the aphid resistance of cucumber. The aphid resistance of cucumbers of different germplasms was negatively correlated with the DNA methylation level of the molecular marker csapt3, that is, the lower the DNA methylation level of the molecular marker csapt3, the higher the aphid resistance of cucumber.

[0080] Example 2

[0081] Application of DNA methylation molecular markers in screening cucumber germplasm for resistance to aphids

[0082] Step S1: extracting the genomic DNA of the cucumber to be tested;

[0083] Select cucumber varieties (JY30, YVnv, 407, JY35, OFBAT18, SXLH, C8, YVlong, ACU057, BN32-7) that need to be identified for aphid resistance. Take 3 biological replicates for each variety and culture them in the same environment until the one-leaf-one-heart stage. Select 40 2-3-year-old cucumber aphids and inoculate them on the leaves. Remove the aphids after 72 hours. Use the quick plant genomic DNA extraction system (Tiangen) to extract the genomic DNA of the leaves, and perform the experimental operation according to the instructions of the kit. The specific steps are as follows:

[0084] (1) Take 100 mg of cucumber leaves, add liquid nitrogen and grind thoroughly. Add 400 μl of buffer FP1 and 6 μl of RNase A (10 mg / ml), vortex for 1 min, and leave at room temperature for 10 min.

[0085] (2) Add 130 μl of buffer FP2, mix thoroughly, and vortex for 1 min.

[0086] (3) Centrifuge at 12,000 rpm for 5 min and transfer the supernatant to a new centrifuge tube.

[0087] (4) Centrifuge the supernatant again at 12,000 rpm for 5 min and transfer the supernatant to a new centrifuge tube.

[0088] (5) Add 0.7 times the volume of isopropanol to the supernatant and mix thoroughly. At this time, flocculent genomic DNA will appear. Centrifuge at 12,000 rpm for 2 min, discard the supernatant, and retain the precipitate.

[0089] (6) Add 600 μl of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm for 2 minutes, and discard the supernatant.

[0090] (7) Repeat step (6).

[0091] (8) Open the lid and place it upside down at room temperature for 10 min to completely dry any remaining ethanol.

[0092] Add an appropriate amount of elution buffer TE and dissolve the DNA in a 65°C water bath for 60 minutes. Invert and mix several times to aid dissolution. Finally, a DNA solution is obtained. The concentration and purity of the extracted DNA are measured and stored at -20°C.

[0093] Step S2: Purification after sulfite conversion of DNA;

[0094] The extracted DNA was treated with bisulfite using DNAMethylation Bisulfite Kit (Novozyme), and the experimental operation was performed according to the instructions of the kit. The specific steps are as follows:

[0095] (1) Add 7 μl DNA (1000 ng / μl), 130 μl CT Conversion Mix, and 13 μl ddH2O to a 200 μl sterile PCR tube.

[0096] (2) Mix by pipetting up and down, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0097] (3) Place the PCR tube in a PCR instrument and follow the amplification program as shown in Table 1.

[0098] Table 1 DNA transformation reaction procedure

[0099]

[0100] (4) Place the EpiArt DNA Columns adsorption column in the Collection Tubes collection tube.

[0101] (5) Add 600 μl of E-Binding Buffer to the adsorption column, and then add the converted reaction product to the adsorption column. Gently invert the column 10 times to mix the reaction solution and E-Binding Buffer completely.

[0102] (6) Centrifuge at 12,000 rpm for 60 seconds. Discard the filtrate and return the adsorption column to the collection tube.

[0103] (7) Add 500 μl E-Wash Buffer (with ethanol) to the adsorption column and centrifuge at 12,000 rpm for 60 seconds. Discard the filtrate and return the adsorption column to the collection tube.

[0104] (8) Add 500 μl of E-Desulphonation Buffer to the adsorption column and allow to react at room temperature for 15 min. Centrifuge at 12,000 rpm for 60 sec. Discard the filtrate and return the adsorption column to the collection tube.

[0105] (9) Add 500 μl E-Wash Buffer (with ethanol) to the adsorption column and centrifuge at 12,000 rpm for 60 seconds. Discard the filtrate and return the adsorption column to the collection tube.

[0106] (10) Repeat step (9).

[0107] (11) Centrifuge the empty column at 12,000 rpm for 2 min.

[0108] (12) Transfer the adsorption column to a new 1.5 ml centrifuge tube, leave the tube open for 2 min to dry thoroughly, and add 10-20 μl of E-Elution Buffer to the center of the adsorption column membrane. Let stand at room temperature for 1 min, centrifuge at 12,000 rpm for 2 min, and collect the DNA filtrate. Discard the adsorption column and store the sulfite-modified genomic DNA at -20°C.

[0109] Step S3: PCR amplification;

[0110] (1) Design primers. The primer information is shown in Table 2.

[0111] Table 2 Methylation amplification primer information

[0112]

[0113]

[0114] (2) Add 2 μl of sulfite-modified genomic DNA, 25 μl of 2× EpiArt HS TaqMaster Mix, 2 μl of each forward and reverse primer, and 19 μl of ddH2O to a sterile PCR tube.

[0115] (3) Mix by pipetting up and down, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0116] (4) Place the PCR tube in a PCR instrument and follow the amplification program as shown in Table 3.

[0117] Table 3 PCR amplification program

[0118]

[0119] (5) The PCR product was subjected to gel electrophoresis, such as Figure 3 As shown, the target fragment is consistent with the expected length, and the target fragment is recovered to obtain a molecular marker product.

[0120] (6) Connect the recovered target fragment to the 5×TA / Blunt-Zero Cloning Mix vector and prepare the reaction system: 1μl 5×TA / Blunt-Zero Cloning Mix, 1μl PCR purified product, 3μl ddH2O. Gently flick the bottom of the tube to mix, centrifuge at low speed to collect all the liquid at the bottom of the centrifuge tube, and react at room temperature for 5 minutes. After the reaction is completed, place the centrifuge tube on ice.

[0121] (7) Take out the Fast-T1 competent cells from -70℃, quickly place them on ice to thaw, add the ligation product, flick the tube wall to mix, and let it stand on ice for 30 minutes. After heat shock in a 42℃ water bath for 30 seconds, quickly place it on ice for 2 minutes, add 900μl LB liquid culture medium to the centrifuge tube, mix well, and place it in a 37℃, 200rpm shaker to recover for 1 hour. Centrifuge at 5,000rpm for 3 minutes, discard 900μl supernatant, resuspend the bacteria with the remaining culture medium, and evenly spread it on an LB solid culture medium plate containing ampicillin antibiotics. Place the plate upright in a 37℃ incubator for 10 minutes. After the bacterial solution is completely absorbed, invert the plate and culture overnight.

[0122] (8) Pick 5 single clones and mix them with 10 μl ddH2O as the template bacterial solution. Add 10 μl 2× RapidTaq Master Mix, 2 μl M13 Primer Mix, 2 μl bacterial solution, and 6 μl ddH2O to a sterile PCR tube. Place the PCR tube in a PCR instrument and follow the reaction procedure as shown in Table 4.

[0123] Table 4 PCR reaction program

[0124]

[0125] (9) The PCR product was subjected to gel electrophoresis, such as Figure 4 As shown, the target fragment was consistent with the expected length, and the positive clones were screened and sent for testing.

[0126] Step S4: sequencing and data analysis;

[0127] The determined sequences were aligned in SnapGene, and the correctly aligned results were analyzed for methylation data using GraphPad Prism, and then the results were presented graphically using TBtools, as shown in the following figure: Figure 5 As shown, the DNA methylation levels of the DNA methylation molecular marker csapt3 of the CsAPT3 gene of cucumber varieties were selected and ranked from high to low. According to the conclusion that the aphid resistance of cucumbers of different germplasms obtained by the present invention is negatively correlated with the DNA methylation level of the DNA methylation molecular marker csapt3 of the CsAPT3 gene, the aphid resistance levels of cucumber varieties were selected and ranked from low to high.

[0128] In this embodiment, the present invention is used to select a variety of cucumber materials (JY30, YVnv, 407, JY35, OFBAT18, SXLH, C8, YVlong, ACU057, BN32-7) for aphid resistance screening and identification, and a traditional cucumber aphid resistance identification method is used for screening and identification verification, including 2-hour non-selective settlement screening and 10-day simple life table screening. The specific screening steps are:

[0129] (1) The above cucumber varieties that need to be identified for aphid resistance were selected, and 10 biological replicates were taken for each variety. The varieties were cultured in the same environment until they had two leaves and one heart.

[0130] (2) Select 10 relatively active second-instar cucumber aphids and place them on the inner wall of the isolation cover. Then cover the isolation cover on the true leaves of the cucumber seedlings and fix them on the petioles of the true leaves with a movable isolation plug. Finally, seal the other end of the isolation cover.

[0131] (3) Count the number of aphids on cucumber leaves 2 hours after inoculation.

[0132] (4) Remove all aphids from the true leaves of cucumbers, select 10 relatively active second-instar cucumber aphids and place them directly on the true leaves of cucumbers, and cover the entire cucumber seedling with a breathable mesh bag.

[0133] (5) Count the number of aphids on cucumber leaves 10 days after inoculation.

[0134] (6) Combine the 2-hour non-selective settlement screening and the 10-day simple life table screening to obtain the aphid resistance of the desired cucumber variety, such as Figure 6 As shown, the aphid resistance levels of the selected cucumber varieties screened and identified according to the number of aphids on the leaves are ranked from low to high.

[0135] from Figure 5 and Figure 6 It can be seen that the results of the present invention selecting cucumber varieties by DNA methylation of specific csapt3 molecular markers and sorting them from low to high are consistent with the results obtained by the two traditional methods. It is proved that the molecular markers amplified by the primer pairs provided by the present invention can be applied to the breeding of cucumber aphid-resistant germplasm, and are now faster and more effective than the traditional methods.

Claims

1. A cucumber DNA methylation molecular marker based on cucumber CsAPT3 gene, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

2.

2. A primer pair for amplifying and detecting the cucumber DNA methylation molecular marker of the cucumber CsAPT3 gene according to claim 1, characterized in that: The primer pairs are: Upstream primer: AAATTTTAGGTATATTGTTTTAGGATATTA; Downstream primer: AAACCAAAAATTAAAAAATTTAAATAC.

3. A use of the cucumber DNA methylation molecular marker of the cucumber CsAPT3 gene according to claim 1 or the primer pair according to claim 2, characterized in that: The application includes any one or more of the following: (1) Application in breeding or testing cucumber varieties with resistance to aphids; (2) Application in identifying aphid-resistant cucumber varieties; (3) Application in the production of aphid-resistant cucumber varieties.

4. Use of the cucumber DNA methylation molecular marker of the cucumber CsAPT3 gene according to claim 1 or the primer pair according to claim 2 in improving the breeding rate of aphid-resistant superior cucumber varieties.

5. The application according to claim 4, characterized in that: Breeding aphid-resistant cucumber varieties involves the following steps: S1, extracting the cucumber genomic DNA to be tested; S2, sulfite conversion followed by DNA purification; S3, using the purified DNA as a template, and performing PCR amplification using the primers described in claim 2; S4. Sequence the amplified products and analyze the data, and select plants with low methylation levels of the CsAPT3 gene with reference to the molecular markers described in claim 1, which are cucumber aphid-resistant germplasm.

6. The use according to claim 5, characterized in that: The reaction system for sulfite conversion in step S2 is: DNA 7-10 μl, CT Conversion Mix 130-150 μl, ddH2O 13-15 μl; The amplification program was as follows: ① 98℃10 min; ② 64℃40 min; ③ 98℃5 min; ④ 64℃40 min; ⑤ 98℃5 min; ⑥ 64℃40 min; ⑦ 4℃ Hold.

7. The use according to claim 5, characterized in that: The PCR amplification system in step S3 is: 2-5 μl of genomic DNA modified with sulfite, 25-30 μl of 2×EpiArt HS Taq Master Mix, 2-3 μl of each forward and reverse primer, and 19-20 μl of ddH2O; The amplification program was as follows: ① 95℃ for 3 min; ② 95℃ for 15 sec, 50℃ for 15 sec, 72℃ for 2 sec, 33 cycles; ③ 72℃ for 5 min.

8. Use of the cucumber DNA methylation molecular marker of the cucumber CsAPT3 gene according to claim 1 or the primer pair according to claim 2 in screening aphid-resistant cucumbers as breeding parents.

Images