A kind of black fungus strain L7013 and cultivation method thereof

Abstract

The present invention relates to a black fungus strain L7013 and a cultivation method thereof, and belongs to the field of microbial technology. The black fungus strain L7013 has been deposited in the Guangdong Microbiological Culture Collection Center of China on February 28, 2024, with a deposit number of GDMCC No: 64380. The black fungus strain L7013 of the present invention has the characteristics of good mushroom production, good uniformity of mushroom production, stable cultivation characteristics, dark brown fruiting bodies, ear pieces in ear shape, clustered, dense ear piece growth, high yield, high conversion rate, high protein and crude polysaccharide content, rich nutrients, etc. The strain has a wide temperature adaptability range, is suitable for large-scale promotion and cultivation in the low-latitude plateau Yunnan area, and has good market prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a black fungus strain L7013 and a cultivation method thereof. Background Art

[0002] There are more than 30 species of Auricularia auricula in the world, and there are 20 species in my country, including black fungus, horny fungus, wrinkled fungus, ivory fungus, brown fungus, Hainan fungus, big hairy fungus, felt fungus, black wrinkled fungus, gorgeous fungus, elusive fungus, hairy fungus, thin meat fungus, Xisha fungus, etc. Among them, black fungus and hairy fungus are the two main cultivated varieties in my country, and they are widely studied and applied.

[0003] Black Fungus Auricularia auricμLa (L.exhook.) Underw] Also known as black vegetable, fungus, cloud ear, it belongs to the genus Auriculariaceae, Auriculariales, Heterobasidiomycetes, Basidiomycetes, Fungi. Black fungus grows on broad-leaved trees such as oak, elm, poplar, banyan, and acacia, or on rotten wood and coniferous fir. It grows in dense clumps and can cause wood decay. Fungus growing on different trees has different names and different effects. Black fungus is a kind of edible fungus with important nutritional and medicinal value. It is one of the four famous edible fungi in the world (Agaricus bisporus, Oyster mushroom, Lentinus edodes, and Fungus). It is known as "the meat among vegetarians", "the king of vegetarians" and "the treasure among fungi".

[0004] According to modern scientific analysis, wood ear has a variety of nutrients, including protein, vitamins, mineral elements, etc. Studies have found that dried wood ear contains the most carbohydrates (accounting for 65%), 11% water, 10.6% protein (6 times the content of milk), 7% crude fiber, 5.8% ash, 0.357% calcium, 0.201% phosphorus, 0.2% fat, 0.185% iron (100 times the content of meat), and also contains niacin, riboflavin, thiamine and carotene and other trace elements. In addition, wood ear, as an important edible and medicinal fungus, contains polysaccharides, adenosine, amino acids and other bioactive ingredients, which have multiple functions such as tonic, anti-tumor, anti-inflammatory, laxative, lowering blood lipids, lowering blood sugar, anti-atherosclerosis, anti-platelet aggregation, anti-radiation, and enhancing immunity. Wood ear has high nutritional value and many functions, and has great application potential in food, medicine, cosmetics and other fields.

[0005] At present, the quality of fungus strains in the actual production process of fungus in Yunnan Province is uneven, resulting in the phenomenon of failure to produce mushrooms normally after cultivation, and the fruiting body yield is not stable enough. In recent years, the fungus industry in Yunnan has continued to expand, and the cultivation technology has gradually matured. However, the cultivation suitability, yield and bioconversion rate of mature fungus varieties and technologies introduced from outside the province are not stable in Yunnan Province with a multi-dimensional climate, which hinders the large-scale promotion of fungus. At present, there is a great lack of varieties of local fungus in Yunnan Province that have been recognized (approved) or identified, especially varieties suitable for cultivation in Yunnan's different temperature types and three-dimensional climate.

[0006] Therefore, how to overcome the shortcomings of the existing technology is an urgent problem to be solved in the field of microbial technology. Summary of the invention

[0007] The purpose of the invention is to solve the deficiencies of the prior art and to provide a black fungus strain L7013 and a cultivation method thereof.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] The first aspect of the present invention provides a black fungus strain L7013, wherein the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0010] The second aspect of the present invention provides a cultivation method of black fungus strain L7013, comprising the following steps:

[0011] Step (1), mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 7-10 days;

[0012] The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water;

[0013] Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 24°C culture room for constant temperature culture for 25-30 days to obtain the stock seed;

[0014] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 72-74 parts of sawdust, 23-25 ​​parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0015] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 30-35 days to obtain cultivated seeds;

[0016] The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0017] Step (4), post-ripening opening: after the mycelium in step (3) has grown all over the cultivation material bag, the temperature of the culture room is adjusted to 17.5-18.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium;

[0018] Step (5), mushroom stick cultivation and ear management: the mushroom sticks with holes for cultivation are planted in the field and placed in rows with a width of 1.4-1.6 meters, and 6-7 mushroom sticks are placed in each row; watering begins three days after planting, using dry-wet alternating management, and the watering temperature is 14-25°C.

[0019] Furthermore, in step (4), 160-200 holes are pierced on each stick.

[0020] Furthermore, in step (4), avoid direct sunlight during the culture, avoid temperatures exceeding 28°C, and maintain ventilation.

[0021] Furthermore, in step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes.

[0022] Furthermore, in step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0023] The third aspect of the present invention provides another method for cultivating black fungus strain L7013, comprising the following steps:

[0024] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7-10 days to obtain mycelium blocks;

[0025] The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water;

[0026] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5°C for 7-10 days to obtain seed liquid;

[0027] The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 19-21 parts of lactose, 1.9-2.1 parts of peptone, 0.19-0.21 parts of calcium chloride, 990-1010 parts of water, and a pH of 8.8-9.2;

[0028] Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, culturing at 23.5-24.5° C. for 8-11 days, to obtain a liquid strain;

[0029] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of glucose, 190-210 parts of peptone, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of calcium chloride, 99000-101000 parts of water, and the pH is 8.8-9.2;

[0030] Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 24°C for 30-35 days;

[0031] The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 17-19 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.5-0.8 parts of lime powder; pH value 6-8, water content 55-65%;

[0032] Step E, post-ripening opening: after the mycelium has grown all over the cultivation bag, the temperature of the culture room is adjusted to 17.5-18.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium;

[0033] Step F, mushroom stick cultivation and ear management: plant the mushroom sticks with holes and place them in rows with a width of 1.4-1.6 meters, and place 6-7 mushroom sticks in each row; start watering three days after planting, using alternating dry and wet management, and the watering temperature is 14-25°C.

[0034] Further, in step B, the shaking speed is 170-190 r / min -1 .

[0035] Furthermore, in step E, 160-200 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28° C., and maintain ventilation.

[0036] Further, in step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes;

[0037] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0038] The invention adopts an open-air ground swing type cultivation method to carry out mushroom stick cultivation.

[0039] In the present invention, the specific method of dry-wet alternating management can be adopted from the existing technology, and the present invention does not limit this. When watering, the present invention adopts conventional sprinkler irrigation, and the sprinkler irrigation flow rate can be 1.33m 3 / h, the present invention does not impose any limitation on this.

[0040] The furrow length of the present invention is not limited and can be set according to the site.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] (1) The black fungus strain L7013 was selected and bred from wild black fungus resources collected in Yunnan Province. The mycelium of this strain is thick and dense, the growth rate is fast, and the resistance to foreign bacteria is strong. It has excellent results in field cultivation in Yunnan Province, and can adapt to a wide range of temperatures. It can produce ears normally in an environment of 15℃ to 28℃. The ear pieces grow in ear-shaped clusters, the dry weight yield reaches 759.7g / bag, and the biological conversion rate reaches 138.1%. It is a high-quality and high-yield strain that can be promoted on a large scale in production;

[0043] (2) The black fungus strain L7013 was produced and domesticated by the technology of the present invention, and nourished by the climate of the low-dimensional plateau of Yunnan, so it has a higher nutritional value. The enrichment of the functional component crude polysaccharide is more than 4 times that of the control, and the protein content is nearly 2 times that of the control;

[0044] (3) After the black fungus strain L7013 was optimized through the technical test of the present invention, a flexible seed production technology can be adopted. The seed production effects of both solid and liquid strains are relatively good. After optimization tests, it was found that the strain has the best effect when cultivated in the field. This cultivation technology does not require the construction of a planting greenhouse, shading, or environmental parameter control, thus saving a lot of costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a comparison chart of 1TIS base differences; 1HAO is the control CK Heibao No. 1, and L7013 is the test strain;

[0046] Figure 2 This is a comparison chart of nLSU base differences; 1HAO is the control CK Heibao No. 1, and L7013 is the test strain;

[0047] Figure 3This is the multi-gene phylogenetic tree of Auricularia auriculariae strain L7013 based on ITS+nLSU sequences;

[0048] Figure 4 Antagonism diagram of Auricularia auricula strain L7013 and control CK Heibao No. 1 strain; the mycelium block marked with 13 on the left is the L7013 strain, and the mycelium block on the right is the control CK Heibao No. 1;

[0049] Figure 5 It is the gel map of SSR molecular marker of Auricularia auricula strain L7013; wherein, YE2H is strain L7013, CK is control strain Heibao No. 1, and Marker is template; a is the gel map of SSR molecular marker using primer YE2H-01; b is the gel map of SSR molecular marker using primer YE2H-02; c is the gel map of SSR molecular marker using primer YE2H-03; d is the gel map of SSR molecular marker using primer YE2H-04; e is the gel map of SSR molecular marker using primer YE2H-05; f is the gel map of SSR molecular marker using primer YE2H-06;

[0050] Figure 6 The morphological diagram of Auricularia auricula strain L7013; a is the wild morphology of the fruiting body; b is the cross section of the fruiting body; c is the soft hairs on the sterile surface; df is the diagram of basidia and pseudo-basidiospores in the hymenium; gl is the diagram of basidiospores; scale b=6μm, c=10μm, df=30μm, gl=5μm;

[0051] Figure 7 The following are the results of the demonstration cultivation of black fungus strain L7013; a is the physical form of mushrooms cultivated in Songming County, Kunming City, Yunnan Province, b is the physical form of mushrooms cultivated in Lida Town, Funing County, Wenshan Prefecture, Yunnan Province, c is the overall morphology of mushrooms cultivated in Muyang Town, Funing County, Wenshan Prefecture, Yunnan Province, d is the physical form of mushrooms cultivated in Muyang Town, Funing County, Wenshan Prefecture, Yunnan Province, e is the front of the ear piece, f is the back of the ear piece, and g is the fresh weight of a single flower;

[0052] Figure 8 This is a bar graph of mycelium growth rate in the carbon source single factor screening test;

[0053] Fig. 9 This is the mycelial growth morphology diagram of the carbon source single factor screening test;

[0054] Fig.10 This is a bar chart of mycelium growth rate in the nitrogen source single factor screening test;

[0055] Fig.11 This is the mycelial growth morphology diagram of the nitrogen source single factor screening test;

[0056] Fig.12 This is a bar graph of mycelium growth rate in the inorganic salt single factor screening test;

[0057] Fig.13 This is the mycelial growth morphology diagram of the inorganic salt single factor screening test;

[0058] Fig.14 This is the bar graph of mycelium growth rate in the temperature single factor screening test;

[0059] Fig.15 This is the mycelial growth morphology diagram of the temperature single factor screening test;

[0060] Fig.16 This is the bar graph of mycelium growth rate in the pH single factor screening test;

[0061] Fig.17 This is the mycelial growth morphology diagram of the pH single factor screening test. DETAILED DESCRIPTION

[0062] The present invention is further described in detail below in conjunction with embodiments.

[0063] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0064] Unless otherwise specified, all percentages in this document refer to volume percentages.

[0065] Example 1

[0066] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0067] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0068] Step (1), mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 8 days;

[0069] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0070] Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 24°C culture room for constant temperature culture for 28 days to obtain the stock seed;

[0071] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 73 parts of sawdust, 24 parts of bran, 1 part of sugar, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0072] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 33 days to obtain cultivated seeds;

[0073] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 17 parts of wheat bran, 1 part of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0074] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 18°C ​​for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0075] Step (5), mushroom stick cultivation and ear management: the mushroom sticks that have been punctured and cultured are planted in the field and placed in rows with a width of 1.5 meters and 6 mushroom sticks placed in each row; watering begins three days after planting, using dry-wet alternation management, and the watering temperature is 18-22°C.

[0076] Example 2

[0077] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0078] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0079] Step (1), mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 7 days;

[0080] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water;

[0081] Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 24°C culture room for constant temperature culture for 25 days to obtain the stock seed;

[0082] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 72 parts of sawdust, 23 parts of bran, 0.9 parts of sugar, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 6, water content 55-65%;

[0083] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 30 days to obtain cultivated seeds;

[0084] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 77 parts of sawdust, 16 parts of wheat bran, 1.9 parts of bean cake powder, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 6, water content 55-65%;

[0085] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 17.5°C for post-ripening cultivation for 6.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3 days to restore the mycelium;

[0086] Step (5), mushroom stick cultivation and ear management: the mushroom sticks that have been punctured and cultured are planted in the field and placed in rows. The width of the row is 1.4 meters, and 6 mushroom sticks are placed in each row. Watering begins three days after planting, using dry-wet alternation management, and the watering temperature is 14-18°C.

[0087] In step (4), 160 holes are pierced on each stick.

[0088] In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

[0089] In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 2 minutes.

[0090] In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0091] Example 3

[0092] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0093] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0094] Step (1), mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 10 days;

[0095] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water;

[0096] Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a culture room at 24°C for 30 days to obtain the stock seed;

[0097] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 74 parts of sawdust, 25 parts of bran, 1.1 parts of sugar, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 8, water content 55-65%;

[0098] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 35 days to obtain cultivated seeds;

[0099] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 79 parts of sawdust, 18 parts of wheat bran, 2.1 parts of bean cake powder, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 8, water content 55-65%;

[0100] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 18.5°C for post-ripening cultivation for 7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 5 days to restore the mycelium;

[0101] Step (5), mushroom stick cultivation and ear management: the mushroom sticks with holes for cultivation are planted in the field and placed in rows with a width of 1.6 meters and 7 mushroom sticks placed in each row; watering is started three days after planting, using dry-wet alternation management and the watering temperature is 20-25°C.

[0102] In step (4), 200 holes are pierced on each stick.

[0103] In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

[0104] In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 30 minutes.

[0105] In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0106] Example 4

[0107] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0108] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0109] Step (1), mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 9 days;

[0110] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0111] Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 24°C culture room for constant temperature culture for 27 days to obtain the stock seed;

[0112] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 73 parts of sawdust, 24 parts of bran, 1 part of sugar, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0113] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 33 days to obtain cultivated seeds;

[0114] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 17 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0115] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 18°C ​​for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0116] Step (5), mushroom stick cultivation and ear management: the mushroom sticks with holes for cultivation are planted in the field and placed in rows with a width of 1.5 meters and 7 mushroom sticks placed in each row; watering is started three days after planting, using dry-wet alternation management and the watering temperature is 18-23°C.

[0117] In step (4), 180 holes are pierced on each stick.

[0118] In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

[0119] In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 25 minutes.

[0120] In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0121] Example 5

[0122] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0123] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0124] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA medium, place it in a constant temperature culture at 24°C for 8 days to obtain mycelium blocks;

[0125] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0126] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28° C. for 8 days to obtain seed liquid;

[0127] The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 20 parts of lactose, 2 parts of peptone, 0.2 parts of calcium chloride, 1000 parts of water, and the pH is 9;

[0128] Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24° C. for 9 days to obtain a liquid strain;

[0129] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of glucose, 200 parts of peptone, 120 parts of potassium dihydrogen phosphate, 60 parts of calcium chloride, 00000 parts of water, and the pH is 9;

[0130] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 34 days;

[0131] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 18 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 0.7 parts of lime powder; pH value 7, water content 55-65%;

[0132] Step E, post-ripening opening: after the mycelium has grown all over the cultivation bag, the temperature of the culture room is adjusted to 18°C ​​for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0133] Step F, mushroom stick cultivation and ear management: plant the mushroom sticks with holes for cultivation and place them in rows with a width of 1.5 meters and 6 mushroom sticks in each row; start watering three days after planting, adopt dry-wet alternation management, and the watering temperature is 17-23°C.

[0134] Example 6

[0135] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0136] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0137] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7 days to obtain mycelium blocks;

[0138] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water;

[0139] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5° C. for 7 days to obtain seed liquid;

[0140] The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 19 parts of lactose, 1.9 parts of peptone, 0.19 parts of calcium chloride, 990 parts of water, and a pH of 8.8;

[0141] Step C, liquid fermentation tank fermentation culture: inoculate the seed liquid obtained in step B into the fermentation liquid culture medium, and culture at 23.5° C. for 8 days to obtain liquid strains;

[0142] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350 parts of glucose, 190 parts of peptone, 115 parts of potassium dihydrogen phosphate, 59 parts of calcium chloride, and 99,000 parts of water, with a pH of 8.8;

[0143] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 30 days;

[0144] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 77 parts of sawdust, 17 parts of wheat bran, 1.9 parts of bean cake powder, 0.9 parts of gypsum powder, and 0.5 parts of lime powder; pH value 6, water content 55-65%;

[0145] Step E, post-ripening opening: after the mycelium has grown all over the cultivation bag, the temperature of the culture room is adjusted to 17.5°C for post-ripening cultivation for 6.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3 days to restore the mycelium;

[0146] Step F, mushroom stick cultivation and ear management: plant the mushroom sticks with holes for cultivation and place them in rows with a width of 1.4 meters and 6 mushroom sticks in each row; start watering three days after planting, adopt dry-wet alternation management, and the watering temperature is 14-18°C.

[0147] In step B, the shaking speed is 170 r / min -1 .

[0148] In step E, 160 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28°C, and maintain ventilation.

[0149] In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20 minutes;

[0150] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0151] Example 7

[0152] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0153] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0154] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 10 days to obtain mycelium blocks;

[0155] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water;

[0156] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28.5° C. for 10 days to obtain seed liquid;

[0157] The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 21 parts of lactose, 2.1 parts of peptone, 0.21 parts of calcium chloride, 1010 parts of water, and the pH is 9.2;

[0158] Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24.5° C. for 11 days to obtain a liquid strain;

[0159] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2450 parts of glucose, 210 parts of peptone, 125 parts of potassium dihydrogen phosphate, 61 parts of calcium chloride, and 101,000 parts of water, with a pH of 9.2;

[0160] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 35 days;

[0161] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 79 parts of sawdust, 19 parts of wheat bran, 2.1 parts of bean cake powder, 1.1 parts of gypsum powder, and 0.8 parts of lime powder; pH value 8, water content 55-65%;

[0162] Step E, post-ripening opening: after the mycelium has grown all over the cultivation bag, the temperature of the culture room is adjusted to 18.5°C for post-ripening cultivation for 7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 5 days to restore the mycelium;

[0163] Step F, mushroom stick cultivation and ear management: plant the mushroom sticks with holes and place them in rows. The row width is 1.6 meters, and 7 mushroom sticks are placed in each row. Watering begins three days after planting, using dry-wet alternation management at a watering temperature of 20-25°C.

[0164] In step B, the shaking speed is 190 r / min -1 .

[0165] In step E, 200 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28°C, and maintain ventilation.

[0166] In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 30 minutes;

[0167] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0168] Example 8

[0169] A black fungus strain L7013, the black fungus strain L7013 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

[0170] The cultivation method of the black fungus strain L7013 comprises the following steps:

[0171] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA medium, place it in a constant temperature culture at 24°C for 8 days to obtain mycelium blocks;

[0172] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0173] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28° C. for 8 days to obtain seed liquid;

[0174] The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 20 parts of lactose, 2 parts of peptone, 0.2 parts of calcium chloride, 1000 parts of water, and the pH is 9;

[0175] Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24° C. for 10 days to obtain a liquid strain;

[0176] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of glucose, 200 parts of peptone, 120 parts of potassium dihydrogen phosphate, 60 parts of calcium chloride, and 100,000 parts of water, with a pH of 9;

[0177] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 32 days;

[0178] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 18 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 0.6 parts of lime powder; pH value 7, water content 55-65%;

[0179] Step E, post-ripening opening: after the mycelium has grown all over the cultivation bag, the temperature of the culture room is adjusted to 18°C ​​for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0180] Step F, mushroom stick cultivation and ear management: plant the mushroom sticks with holes for cultivation and place them in rows with a width of 1.5 meters and 7 mushroom sticks in each row; start watering three days after planting, adopt dry-wet alternation management, and the watering temperature is 17-23°C.

[0181] In step B, the shaking speed is 180 r / min -1 .

[0182] In step E, 180 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28°C, and maintain ventilation.

[0183] In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 25 minutes;

[0184] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0185] Application Examples

[0186] 1. Isolation, purification and identification of Auricularia auricula strain L7013

[0187] On May 6, 2022, the inventor of the present invention, the breeding team collected wild black fungus from the fallen trunk of an oak tree in Jinjiang Town, Shangri-La City, Diqing Tibetan Autonomous Prefecture, Yunnan Province, and obtained a pure strain, black fungus strain L7013, through tissue separation and purification.

[0188] 1.1 Isolation and purification (tissue separation)

[0189] Small pieces of internal tissue of wild black fungus were cut near an alcohol lamp and placed on a PDA culture medium for germination and purification to obtain pure strains. The mycelium growth, including growth rate, thickness, density, etc., were compared under the same culture conditions. Strains with weak mycelium were eliminated and effective strains with the best mycelium growth and ability to grow fruiting bodies were screened out to obtain the black fungus strain L7013, which was named "Yun'er No. 2".

[0190] 1.2 Molecular identification

[0191] Scrape an appropriate amount of pure culture mycelium, grind it with liquid nitrogen (or grinder), and use the steps of the Plant Genomic DNA Extraction Kit (Shanghai Shenggong Biotechnology Co., Ltd.) to extract total DNA. Use RNA polymerase chain reaction (PCR) technology to select four gene fragments: ITS and LSU for amplification. The base composition of the specific primers is shown in Table 1. The PCR amplification system uses a 30μL reaction system, including 15μL MIX amplification buffer, 0.5μL of forward and reverse primers (both at a concentration of 0.03mmoL / μL), 1-2μL of DNA template (the amount varies depending on the DNA concentration), and dilute to 30μL with ddH2O. Then perform PCR amplification.

[0192] Table 1 Primers and base compositions used in PCR amplification

[0193]

[0194] The thermal cycle parameters of the ITS reaction program are as follows: pre-denaturation at 95°C for 3 min, followed by 34 consecutive cycles (denaturation at 94°C for 40 s, annealing at 54°C for 45 s, and extension at 72°C for 1 min). After the cycle is completed, extension is performed at 72°C for 10 min and the reaction is stored at 4°C.

[0195] Thermal cycle parameters of the nLSU reaction program: 94°C pre-denaturation for 1 min, 34 consecutive cycles (94°C denaturation for 30 s, 50°C annealing for 1 min, 72°C extension for 1.5 min). After the cycle is completed, extend at 72°C for 10 min and store at 4°C.

[0196] Use an electronic balance to accurately weigh 2g of agarose and dissolve it in 100mL TBE buffer (Tris-borate-EDTA). Heat it in a microwave oven on medium heat for 2.0min to make it clear and transparent. When the temperature reaches 65℃, add 2μL of nucleic acid dye and shake it thoroughly. Pour it into a silica gel plate, cool it for use, put it into the electrophoresis pool and use a pipette to spot the sample. The spotting volume is 5μL. The voltage during electrophoresis is 160V, the current is 90A, and the time is 15min. After electrophoresis in 1.0×TBE buffer, observe, take pictures and record the results on a UV gel imager, detect the concentration of the extracted DNA, and send the positive product to Shanghai Shenggong for sequencing. Use primers (ITS4 / ITS5, LR0R / LR5) to send the successful PCR product to Shenggong Biotechnology Co., Ltd. for sequencing. When the sequence has a heterozygous INDEL or an unclear site, the sample is sequenced bidirectionally to splice the amplified region or verify the unclear site. The ITS and LSU fragments were compared in the NCBI database, and the sequences with higher similarity were downloaded for comparison, and it was determined that "Yun'er No. 2" was black fungus ( Auricularia heimuer ).

[0197] ITS is: ttctaaggcttcggtcttaatttcggctgtgcgctcaggctgcacgccgataacctctcacacctgtgcaccttttcggttgcggtttcggccgcttccgcttttacatgcaaccacgaaaagtctagaatgtgacgagaactataaagtaacaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccatggagcatgcctgtttgagtgtcacgtaaaccctcacccctgcgatgtaacagtcgcctgcggtggacttggaccgtgccggtaatcggctcgtcttgaaatgcattagctggtgcttttagagtgctgggcgaacggtgtgataattatctgcgccgactgccctgggcctcttcagcggcgctgcttacagccgtcccttgtggacaactattttaaagctttggcctc (SEQ ID NO.5)

[0198]

[0199] 1.3 Multi-gene sequence alignment

[0200] The two gene sequences of the mycelium of Auricularia auricula strain L7013 were spliced ​​forward and reversely, and compared in the NCBI database. The results showed that the ITS sequence of Auricularia auricula strain L7013 was similar to that of Auricularia auricula strain L7013. Auricularia heimuer (GXMRI YE1) sequence similarity rate reached 100%; nLSU sequence and Auricularia auricula Auricularia heimuer (Dai14760) sequence similarity reached 100%. Auricularia heimuer The sequence similarity rate of Cui 7101 was 100%. There was 1 base difference in the ITS sequence of Auricularia auricula strain L7013 and the control CK Heibao No. 1, and 5 base differences in the nLSU sequence. The sequence comparison results showed that both the Auricularia auricula strain L7013 and the control CK Heibao No. 1 were similar to Auricularia auricula strain L7013 and the control CK Heibao No. 1. Auricularia heimuer There is a high similarity rate. According to the large fungal gene similarity rate of more than 97%, it is generally considered to be the same species. Therefore, it is preliminarily determined that the black fungus strain L7013 and the control CK Heibao No. 1 are both black fungus. Auricularia heimuer , but there are some differences in molecular sequences and evolutionary branches, so they are different strains of the same species.

[0201] 1.4 Base Differences

[0202] (1) 1TIS base difference

[0203] The ITS sequences of Auricularia auriculariae strain L7013 and control CK Heibao No. 1 were compared using BioEdit software. The results showed that there was one base difference between the ITS sequences of Auricularia auriculariae strain L7013 and control CK Heibao No. 1. Figure 1 shown.

[0204] (2) nLSU base differences

[0205] The nLSU sequences of Auricularia auriculariae strain L7013 and control CK Heibao No. 1 were compared using BioEdit software. The results showed that there were 5 base differences between the nLSU sequences of Auricularia auriculariae strain L7013 and control CK Heibao No. 1. Figure 2 shown.

[0206] 1.5 Phylogenetic analysis

[0207] The relevant reference sequences were downloaded from GenBank, and the gene sequences of 25 species of Auricularia were selected and used as Elmerina dimidiata and Exidia candidaAs an outgroup, multigene phylogenetic analysis was performed based on ITS+nLSU sequences. For maximum likelihood (ML) phylogenetic analysis, the combined dataset analysis by RAxML generated a best-scoring tree, with bootstrap values ​​of ML greater than 70% displayed at the nodes.

[0208] like Figure 3 As shown in the figure, phylogenetic analysis showed that the black fungus strain L7013 and the control CK Heibao No. 1 were different from the reported black fungus strains in the phylogenetic tree of the genus Auricularia. A. heimuer Form a separate branch and get 100% support rate. Combined with the morphology, it is determined that "Yun Er No. 2" is black fungus A. heimuer , and the control strain are of the same species, but have certain differences in genetic distance.

[0209] 1.6 Antagonism test

[0210] The antagonistic test was conducted between the isolated black fungus strain L7013 and the control CK Heibao No. 1 (a large-scale cultivated variety in the north). The results showed that the black fungus strain L7013 and the control Heibao No. 1 had a strong antagonistic reaction and had no affinity, forming a "concave line" antagonistic line, such as Figure 4 shown.

[0211] 1.7 SSR molecular markers

[0212] (1) DNA extraction

[0213] The tested strains were transferred to PDA (200 g potato, 20 g glucose, 18 g agar powder, 1000 mL water) medium and cultured at 25°C for 15 days before collecting mycelium. The genomic DNA of mycelium was extracted using the Jinsha Biotech DE711-50 kit, and the purity and concentration of the DNA were detected by agarose gel electrophoresis and biospectrophotometer.

[0214] (2) Genome sequencing

[0215] After DNA extraction, purification and library construction, the samples were sequenced using sequencing technology based on a sequencing platform to search for SSR sites in the genome sequence of the black fungus strain L7013.

[0216] (3) Development of SSR primers based on genome sequencing results

[0217] Based on the Auricularia auricularia genome data, six pairs of SSR primers YE2H-01, YE2H-02, YE2H-03, YE2H-04, YE2H-05, and YE2H-06 were developed and screened to clearly distinguish the Auricularia auricularia strain L7013 from the control CK Heibao No. 1. The detailed primer information is shown in Table 2.

[0218] Table 2 SSR marker primer information

[0219]

[0220] (4) PCR amplification

[0221] Use SSR molecular markers to perform PCR amplification of SSR markers on the extracted DNA:

[0222] The PCR amplification system was as follows: total volume 25 μL, including: 17 μL of Santech 2×San Taq PCR Mix (with BμLe Dye); 1 μL of SSR marker forward primer and reverse primer (both at a concentration of 0.025 mmoL / μL), and 2 μL of template DNA. PCR reaction conditions: 95°C for 3 min; 94°C for 40 s, 60°C for 30 s, 72°C for 30 s, 34 cycles; 72°C for 10 min. To ensure the accuracy of identification, the experiment was repeated three times. The control CK Heibao No. 1 was subjected to the above conditions and repeated three times.

[0223] (5) Electrophoresis:

[0224] Use polyacrylamide gel electrophoresis, and then silver stain to show the bands:

[0225] Mix the following reagents: 48 mL of 1× TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED;

[0226] After mixing, pour the gel immediately and expel the bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 2μL per well, and the electrophoresis condition is 270V constant voltage for 1h. After the electrophoresis is completed, wash the gel twice with distilled water; add 400mL of 10% silver nitrate solution and shake on a shaker for 8min; after silver staining, wash it twice with water; add sodium hydroxide and formaldehyde for color development (NaOH 6g, distilled water 400mL, formaldehyde solution 2mL).

[0227] Table 3 Comparison of the amplified fragment sizes of primers in Auricularia auriculariae strain L7013 and control CK Heibao No. 1

[0228]

[0229] Depend on Figure 5As shown in the results of Table 3, the SSR primers YE2H-01, YE2H-01, YE2H-01, YE2H-01, YE2H-01, YE2H-01 can distinguish the black fungus strain L7013 from the control CK Heibao No. 1. The sizes of the specific fragments amplified by the black fungus strain L7013 are 145, 156, 168, 149, 144, and 149 bp, respectively, and the sizes of the fragments of the control CK Heibao No. 1 are 159, 175, 165, 163, 150, and 159 bp, respectively. This shows that the two have genetic differences.

[0230] 2. Fruiting body morphological characteristics

[0231] 2.1 Morphological observation results

[0232] Morphological observations Figure 6 As shown, the fruiting body is annual, colloid, light brown or reddish brown when fresh, solitary or clustered, sessile or stalked; auricular or petal-shaped, with entire margins, the widest diameter of the auricle can reach 12cm, 0.8mm-1.5mm thick, 0.04mm-0.24mm thick, gray-brown to grape brown when dry; the upper surface has soft hairs, sometimes wrinkled; the lower surface is smooth, sometimes with shallow wrinkles; dark brown or black after drying. Internal characteristics: medulla can be seen in the center of the cross section; no crystals; the base of the soft hairs is slightly swollen, transparent, thick-walled, with a narrow lumen, gradually pointed or obtuse at the top, single or clustered, 50-150×4-6.5μm; hyphae are locked, with a diameter of 0.5μm-3μm in KOH; basidia are rod-shaped, with 3 transverse septa, tubular, 40-67×3-6.5μm; the cyst is absent. The basidiospores do not change color in Melzer's reagent (IKI-) and do not show a blue-loving reaction in cotton blue reagent (CB-). The basidiospores are 11~13(-13.1)×4~5(-5.1)μm, with an average spore length (L) of 12μm and an average width (W) of 4.71μm. The ratio of the average length to the average width (Q) is 2.43-2.74 (n=120 / 4).

[0233] Habitat: Fruiting bodies usually occur in summer and autumn. The host is Quercus. It mainly grows on moist fallen trees and rotten wood and is widely distributed in Asia.

[0234] Black fungus A. heimuer and A. villosula Malysheva, the latter has larger basidiospores (13-15.5 × 5-6.1 μm) and basidiospores are uncommon in wild fruiting bodies. A. heimuer Considered to be similar to Europe A. auricula-judae They are the same species, because their morphologies are very similar after planting; later, Dai Yucheng's team found that the two species are two different branches on the phylogenetic tree, and each branch has a high support rate, so they put black fungus A. heimuer established as an independent species.

[0235] 3. Summary of multi-year multi-site tests on black fungus strain L7013

[0236] 3.1 Test strains

[0237] One test strain was provided by the Institute of Biotechnology and Germplasm Resources, Yunnan Academy of Agricultural Sciences. The Northern Heibao No. 1 strain was used as the control CK.

[0238] 3.2 Culture medium formulation

[0239] (1) The formula of the mother culture medium is PDA medium. The formula is: 200g potato, 20g glucose, 20g agar, 1000mL water.

[0240] Preparation method of mother culture medium:

[0241] A. Cooking: Peel, wash and slice potatoes, weigh 200g, add 1000mL of water, heat and boil until the potato slices are crisp but not mushy, and filter through six layers of gauze;

[0242] B. Proportion: Add 20g glucose and 20g agar to the filtrate, add 1000mL water, and stir to dissolve;

[0243] C. Packaging and sterilization: After dissolving, pack into test tubes while hot, usually 1 / 5-1 / 4 of the length of the test tube. After packing, plug with cotton plugs, 5 in a bunch, wrap one end of the test tube with kraft paper and tie it tightly. After the test tube is wrapped, put it into the autoclave and sterilize at 121℃ for 30 minutes;

[0244] D. Slanted placement: After sterilization, take out the test tube while it is still hot and place it on the workbench to form a slope. Usually the length of the slope is 1 / 2 of the test tube. After it solidifies, place it in a clean and dry place for use.

[0245] (2) Original seed culture matrix

[0246] The stock culture matrix includes the following raw materials in parts by weight: 72-74 parts of sawdust, 23-25 ​​parts of bran, 0.9-1.1 parts of white sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder;

[0247] Preparation method of stock culture medium:

[0248] ① Ingredients and pretreatment: weigh the ingredients according to the formula, among which the sawdust and bran need to be pre-wetted with water in advance and then mixed with other auxiliary materials;

[0249] ② Mixing materials and bottling (bagging): Mix the processed main ingredients with other ingredients. Use breathable cover tissue culture bottles for original species and fungus bags for cultivated species. Fill the bottles (bags) and compact them. A hole can be punched in the center for easy inoculation.

[0250] ③Sterilization: Before sterilization, cold air must be completely removed to ensure that the bacteria in the sterilization package are completely killed. The original seed bottle is placed in an autoclave at 121°C and 0.103MPa for 2 hours;

[0251] (3) Cultivation bag substrate

[0252] The cultivation substrate in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder;

[0253] Preparation method:

[0254] ① Ingredients and pretreatment: Weigh the ingredients according to the formula. The miscellaneous sawdust needs to be pre-wetted with water 2 hours in advance. The required gypsum powder and lime powder are dissolved in water. The bran and bean cake powder are added to the sawdust in turn. Stir while adding water until it is uniform.

[0255] ②Bagging: Use 17cm×35cm×0.05cm polyethylene bags. When filling, ensure that the height of the bags is basically the same, and the tightness should be appropriate. Compact the culture medium while adding. Fill tightly. The bag height after bagging is 20-21cm. Put on the ring and lid. The dry weight of each bag of culture medium is 0.5kg, and the wet weight is 1.0-1.2kg.

[0256] ③Sterilization: Use normal pressure steam for sterilization. Expel cold air in advance during the heating process. When the temperature reaches 121°C, start timing and maintain the temperature for 2 hours. Then stop heating and allow the temperature to drop naturally. When the temperature inside the sterilizer drops below 80°C, the bags can be transferred to the cooling room for natural cooling.

[0257] ④ Inoculation and culture of original seed. Sterilize the original seed bottle in the inoculation room and sterilize it with an ultraviolet disinfection lamp for half an hour before inoculation. During operation, the aseptic operation procedures should be strictly followed. Cut the mother seed into small pieces, inoculate it into the central hole of the culture material, and connect the small pieces of fruiting body to the surface. After the inoculation, move all the original seed bottles into the culture room and control the temperature at 22℃-25℃. When the mycelium in the culture bottle fills 1 / 3 of the bag, lower the temperature of the culture room to 20℃-23℃. Check whether the original seed bottle is contaminated by bacteria at least once a week. If so, the contaminated culture bottle should be removed from the culture room in time, and the growth of mycelium of the fungus variety should be recorded.

[0258] 3.3 Test methods

[0259] 3.3.1 Demonstration Experiment Design

[0260] The black fungus strain L7013 was cultivated in a bagged field swing style. According to the requirements of GB / T 21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi, the number of cultivation bags per group in the demonstration cultivation test design was 4,000 bags. Each bag contained 550g of dry material. Liquid inoculation was used, and the inoculation volume per bag was 18mL. The inoculation volume per group was 72L, and the dry material per group of bag cultivation was 2,200kg. The market-grown strain Heibao No. 1 was used as a control. Each point used the same batch of strains and cultivation bags to ensure the same strain volume and consistent demonstration cultivation management technology.

[0261] 3.3.2 Demonstration site selection

[0262] Songming County, Kunming City, Yunnan Province (1800m above sea level), Lida Town, Funing County, Wenshan Prefecture, Yunnan Province (1200m above sea level), Muyang Town, Funing County, Wenshan Prefecture, Yunnan Province (1500m above sea level).

[0263] 3.3.3 Cultivation methods

[0264] (1) Cultivation process

[0265] Preparation of materials → mixing of materials → bagging → sterilization → cooling and inoculation → spawning and cultivation → building of shade sheds and ridges → transfer to a new location and post-ripening → puncture and cultivation of fungi → placing bags → ear management → harvesting of fruiting bodies → data recording

[0266] (2) Cultivation and management techniques

[0267] Season selection: According to natural conditions and the growth characteristics of black fungus, the production of seeds (bags) for winter fungus in the south starts from mid-July to early October, and the cultivation season for black fungus is from mid-October to mid-January of the following year; the production of seeds (bags) for spring fungus starts from mid-November to early February, and the fungus-growing season is from early February to mid-April. Black fungus can be cultivated at natural (environmental) temperature.

[0268] Site selection: The cultivation site is mostly a solar greenhouse, choose a sunny, leeward, dry, sanitary site close to a water source. The black fungus cultivation site should be convenient for transportation, pollution-free, with a gentle slope and high humidity.

[0269] Ear management:

[0270] (1) Germination: The temperature should not be higher than 24℃, and the relative humidity of the air should be 60%-90%. Ventilation for 7-10 days can form black primordium. Avoid high temperature and humidity.

[0271] (2) Humidity management: When the ear buds are formed and the leaves open, spray water into the swing stick space from time to time to keep the relative humidity of the space at 70%-90%. The fruiting bodies are basically fully opened to prevent the humidity in the bag from being higher than the external environment and causing suffocation of the buds. During the ear leaf growth stage, the relative humidity of the air can be maintained above 60%. Water the mushroom sticks indirectly to allow the ear leaves to grow in dry and wet conditions.

[0272] (3) Temperature management: The optimum temperature for primordium differentiation and fruiting body development is 18℃-24℃. During the mycelial growth stage, the temperature is controlled at 23℃ to promote the formation of buds. When the fruiting body grows towards maturity, the suitable temperature is 15℃-24℃.

[0273] Harvesting: In order to ensure the quality of black fungus, appropriate harvesting standards should be mastered and appropriate harvesting time and methods should be determined. If harvested too early, the ear pieces are small and light in weight, and cannot meet the sales standards. If harvested too late, the quality of black fungus deteriorates and the color becomes lighter. Generally, the ear pieces grow to 3cm to 5cm, the edges are rolled inward and elastic, the ear color changes from black to dark brown, the ear pieces stretch and soften, the flesh is thick, and the ear roots shrink and become thinner, then they can be harvested. Stop spraying water 1d to 2d before harvesting. Avoid knocking off the small ear buds when harvesting to prevent affecting the yield and prolonging the harvest period.

[0274] 3.3.4 Observation and measurement items

[0275] Each demonstration site at different locations will be surveyed and data will be collected separately. The main characteristics of the tested strains will be observed and the yield will be collected. The yield will be collected after harvesting. At the same time, a qualified testing company will be commissioned to measure the content of main nutrients, heavy metals, pesticide residues, etc.

[0276] 3.4 Results and Analysis

[0277] The black fungus strain L7013 is used to make the fungus, and its mycelium is thick, the fungus grows quickly, there is less pollution, and the ability to resist weeds is strong; the fruiting body is dark brown, the ear pieces are gelatinous and elastic, and the properties are stable; it is ear-shaped, has high content of protein and crude polysaccharides, is rich in nutrients, has higher yield and active ingredients than the control, has high application value, and has good market prospects.

[0278] Table 4 Culture cycle and germination rate of Auricularia auricula strain L7013 at the demonstration site

[0279]

[0280] Table 5 Main agronomic traits and yield performance of the demonstration cultivation of Auricularia auricula strain L7013

[0281]

[0282] Note: "M±SD" stands for mean ± standard deviation. 20 bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured for yield. For fruiting body traits, 50 fruiting bodies were randomly selected to calculate the average value.

[0283] Table 6 The culture period and germination rate of the control CK Heibao No. 1 demonstration site

[0284]

[0285] Table 7 Main agronomic traits and yield performance of the demonstration cultivation of CK Heibao No. 1

[0286]

[0287] Note: "M±SD" stands for mean ± standard deviation. 20 bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured for yield. For fruiting body traits, 50 fruiting bodies were randomly selected to calculate the average value.

[0288] Demonstration cultivation effect diagram Figure 7 As shown. The demonstration results of three places in two years from 2022 to 2023 showed that the black fungus strain L7013 had good fruiting conditions, good uniformity, stable cultivation traits, dark brown fruiting bodies, ear pieces in ear shape, clustered, densely grown ear pieces, with ear veins, brown cilia on the back, weak light transmittance of ear pieces, and sessile ear pieces. Compared with the control CK Heibao No. 1, it has the characteristics of thicker fruiting bodies, higher biological conversion rate and yield, short production and cultivation cycles, and an average culture cycle of 30 days. The average diameter of the ear pieces of the black fungus strain L7013 is 6.88cm, and the average thickness of the ear pieces is 0.188cm; the average fresh weight of a single mushroom is 759.7g / bag, the average dry weight of a single bag is 67.32g, and the biological conversion rate is 138.1%. The average diameter of the ear pieces of the bag-grown fruiting bodies of the control CK Heibao No. 1 was 7.28 cm, and the average thickness of the ear pieces was 0.165 cm; the average fresh weight of a single mushroom was 654 g / bag, the average dry weight of a single bag of entities was 59.4 g, and the biological conversion rate was 118.91%. Therefore, compared with the control CK Heibao No. 1, the black fungus strain L7013 has a better overall fruiting effect, denser ear pieces, a shorter cycle, higher yield and biological conversion rate. It can be used as a new variety of black fungus, suitable for cultivation in the southwestern plateau area, and can achieve high-quality ground and facility cultivation of black fungus. It has high application value and good market prospects.

[0289] Specificity: The black fungus strain L7013 has good fruiting conditions, high germination rate, high uniformity of fruiting, stable cultivation traits, dark brown fruiting bodies, ear pieces are ear-shaped, clustered, densely grown, colloid, with ear veins, brown cilia on the back, weak light transmittance of ear pieces, and no sessile ear pieces. The average culture period is 30 days. The average diameter of the ear pieces of the black fungus strain L7013 is 6.88cm, and the average thickness of the ear pieces is 0.188cm; the average fresh weight of a single mushroom is 759.7g / bag, the average dry weight of a single bag is 67.32g, and the biological conversion rate is 138.1%. The control CK Heibao No. 1 has dark brown fruiting bodies, ear pieces are ear-shaped, densely grown, with ear veins, gray-white cilia on the back, weak light transmittance of ear pieces, and no sessile ear pieces. The average diameter of the ear pieces of bag-grown fruiting bodies is 7.28cm, and the average thickness of the ear pieces is 0.165cm; the average fresh weight of a single mushroom is 654g / bag, the average dry weight of a single bag of bodies is 59.4g, and the biological conversion rate is 118.91%.

[0290] Consistency: Through observations of two years of cultivation demonstrations in three locations, the black fungus strain L7013 has consistency.

[0291] Stability: Auricularia auricula strain L7013 is consistent and stable in principle.

[0292] 4. Distinctive identification

[0293] 4.1. Solid culture characteristics

[0294] After the PDA medium is prepared and mixed, it is sterilized at 121°C and 0.103 MPa for 30 min and poured into a 90 mm culture dish to make a plate. The preserved L7013 strain is activated and transferred to the culture dish, and the culture dish is used after the mycelium has grown full.

[0295] Basic culture medium: including the following raw materials in parts by weight: 200 parts of potatoes, 0 parts of glucose, 2 parts of peptone, 0.2 parts of potassium dihydrogen phosphate, and 1000 parts of water; used for screening and optimization of carbon source, nitrogen source, inorganic salt, pH and temperature. After the ingredients are prepared, put them into a high-pressure steam cooker for high-temperature sterilization at 120°C-125°C for 30 minutes, take them out and cool them for use.

[0296] 4.1.1 Carbon source single factor screening test

[0297] With the basal culture medium as the control, the following carbon sources were set as treatment groups: maltose, lactose, sucrose, soluble starch, and fructose replacing glucose, and the control CK was set without adding carbon source.

[0298] A 6mm diameter puncher was used to punch holes, and the bacterial block was inoculated into the center of the solid culture medium and placed in a 24°C constant temperature incubator in the dark. Six replicates were set for each group of experiments. The colony diameter was measured once every 24 hours using the cross-line method; the mycelial morphology and growth were observed and recorded. The data results were compared with the Duncan method of SPSS 26.0 software for significant differences (P<0.05), and Excel 2019 was used to make a mycelial growth rate bar chart. The mycelial growth rate (V) formula is:

[0299] V=(L-6) / D (1)

[0300] Where: L represents the diameter of the colony; D represents the number of culture days; 6 represents the diameter of the inoculated bacterial block is 6 mm.

[0301] 4.1.2 Nitrogen source single factor screening test

[0302] With the basal culture medium as the control, the following nitrogen sources were set up as the treatment groups: yeast powder, urea, diammonium phosphate, soybean cake powder, and potassium nitrate to replace peptone, and the control group without adding nitrogen source was CK.

[0303] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0304] 4.1.3 Inorganic salt single factor screening test

[0305] With the basal culture medium as the control, the following inorganic salts were set up to replace potassium dihydrogen phosphate: dipotassium hydrogen phosphate, ferrous sulfate, magnesium sulfate, calcium chloride, and calcium carbonate as the treatment group, and the control CK was set up without adding inorganic salts.

[0306] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0307] 4.1.4 Temperature single factor screening test

[0308] The bacterial blocks were inoculated into the basal culture medium and cultured in constant temperature incubators at 20℃, 22℃, 24℃, 26℃, 28℃, 30℃ and 32℃ respectively in the dark.

[0309] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0310] 4.1.5 pH single factor screening test

[0311] Use HCl (1 mol·L -1 ) and NaOH (1 mol·L -1 ) The pH of the basal culture medium was adjusted to 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 respectively as the test culture medium;

[0312] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0313] 4.2 Results Analysis

[0314] 4.2.1 Effect of carbon source on mycelial growth rate

[0315] The results of the effects of different carbon sources on mycelial growth rate and morphology are shown in Figure 8 and Fig. 9 .

[0316] Depend on Figure 8 and Fig. 9 It can be seen that when lactose was used as the carbon source, the mycelium was the whitest and densest, and the growth rate was the fastest at (3.01±0.434) mm·d -1 When fructose was used as the carbon source, the mycelial growth rate was the slowest, at (2.20±0.164) mm·d -1 The mycelium growth was not whiter and denser than that under other carbon source conditions.

[0317] 4.2.2 Effect of nitrogen source on mycelial growth rate

[0318] The results of the effects of different nitrogen sources on mycelial growth rate and morphology are shown in Fig.10 and Fig.11 .

[0319] Depend on Fig.10 and Fig.11 It can be seen that when peptone was used as the nitrogen source, the mycelium was the whitest and densest, and the growth rate was the fastest at (2.208±0.102) mm·d -1 When urea was used as the nitrogen source, the mycelial growth rate was the slowest, which was (0.222±0.142) mm·d -1 There was no significant difference when using diammonium hydrogen phosphate as nitrogen source.

[0320] 4.2.3 Effect of inorganic salts on mycelium growth rate

[0321] The results of the effects of different inorganic salts on the growth rate and morphology of mycelium are shown in Fig.12 and Fig.13 .

[0322] Depend on Fig.12 and Fig.13 It can be seen that the mycelium grew faster when calcium chloride was used as an inorganic salt, but the density was higher than that under other conditions, and the growth rate was (3.069±0.335) mm·d -1 , which was significantly different from other inorganic salts. When ferrous sulfate was used as inorganic salt, the mycelium growth rate was the slowest, which was (0.000±0.000) mm·d -1 There is a significant difference compared with other inorganic salts. When magnesium sulfate is used as an inorganic salt, the mycelium is the densest, but the growth rate is slower.

[0323] 4.2.4 Effect of temperature on mycelium growth rate

[0324] The results of the effects of different temperatures on mycelial growth rate and morphology are shown in Fig.14 and Fig.15 .

[0325] Depend on Fig.14 and Fig.15 It can be seen that the mycelium is the whitest and densest when the temperature is 28℃, and the growth rate is faster (2.29±0.057) mm·d -1 The growth rate was the fastest at 30℃, and a high temperature inhibition zone appeared in the mycelium. The mycelium grew the slowest at 20℃, which was (1.52±0.057) mm·d -1 .

[0326] 4.2.5 Effect of pH on mycelial growth rate

[0327] The results of the effects of different pH conditions on mycelial growth rate and morphology are shown in Fig.16 and Fig.17 .

[0328] Depend on Fig.16 and Fig.17 It can be seen that the mycelium growth rate was fastest when the pH was 9.0, which was (4.958±0.482) mm·d -1 The growth rate at pH 8.0 was significantly different from that at other pH values. The mycelium growth rate was the slowest at pH 8.0, which was (1.861±0.165) mm·d -1 There was no significant difference in growth rate when pH was 7.0.

[0329] 5. Variety resistance identification

[0330] Determination of high and low temperature growth rate of mycelium: The black fungus strain L7013 and the control CK Heibao No. 1 grown on PDA (200 g potato, 20 g glucose, 20 g agar powder, 1000 mL water) plates were punched with a 0.5 cm hole puncher and placed on new PDA (200 g potato, 20 g glucose, 20 g agar powder, 1000 mL water) plates for temperature gradient growth experiment.

[0331] 11 culture temperatures were set, namely 5℃, 10℃, 15℃, 20℃, 22℃, 24℃, 26℃, 28℃, 30℃, 32℃, and 35℃, with 3 replicates for each temperature, and the growth rate was measured after a certain period of culture. Method for detecting resistance to Trichoderma: First, the black fungus strain L7013, the control CK Heibao No. 1, Penicillium, and Trichoderma grown on the PDA plate were punched with a 0.5 cm diameter puncher. Then they were placed on a new PDA (200g potato, 20g glucose, 20g agar powder, 1000mL water) plate, with the fungus strain on one side and Trichoderma on the other side. Each resistance experiment was repeated 3 times, and the growth was observed for a certain period of time.

[0332] Table 8 Mycelial growth rate of black fungus strain L7013 and control CK Heibao No. 1 (unit: mm / d)

[0333]

[0334] Results of low temperature resistance test: From Table 8, it can be seen that when cultured for 7 days at 5℃, 10℃, 15℃, 20℃, 22℃ and 24℃, the mycelium growth rate of L7013 is slightly slower than that of the control CK Heibao No. 1, and the mycelium is thick and dense as a whole; when cultured for 7 days at low temperatures of 5℃ and 10℃, it can be seen that at 5℃, the mycelium of the control CK Heibao No. 1 and the black fungus strain L7013 did not germinate. The results show that the growth rules of L7013 and CK under low temperature conditions are consistent, and the growth rate is quite different. L7013 is not easy to germinate at low temperatures.

[0335] Table 9 Mycelial growth rate of black fungus strain L7013 and control CK Heibao No. 1 (unit: mm / d)

[0336]

[0337] Results of high temperature resistance test: As can be seen from Table 9, after culturing for 7 days at 26℃, 28℃, 30℃, 32℃ and 35℃, the mycelium growth rate of L7013 was slightly slower than that of the control CK Heibao No. 1. As the temperature increased, the mycelium had obvious high temperature inhibition zone and sparseness. As the temperature increased, the growth rates of both slowed down significantly, and the growth trend was consistent. At 30℃, the mycelium inoculation point of L7013 began to become sparse, with a high temperature inhibition zone and slow growth. When the temperature reached 35℃, the mycelium of L7013 declined significantly.

[0338] Combined with the results of the low-temperature resistance test, it can be found that the optimal temperature for mycelium culture of the L7013 strain is 28°C, and the optimal temperature for mycelium culture of the control CK Heibao No. 1 strain is 30°C. The results of the high-temperature resistance experiments are consistent. Therefore, L7013 is a medium-low temperature type fungus, suitable for cultivation in plateau mountainous areas.

[0339] Table 10 Antibacterial rate of black fungus strain L7013 and control CK Heibao No. 1 against Trichoderma

[0340]

[0341] The results show that: as can be seen from Table 10, in the black fungus antibacterial test against Trichoderma, the black fungus strain L7013 has a higher antibacterial rate than the control CK Heibao No. 1, indicating that the black fungus strain L7013 has a stronger ability to resist foreign bacteria. In seed production, the seed contamination rate is low, the feed eating speed is fast and it is not easy to be infected with foreign bacteria, and the ability to resist foreign bacteria is strong; and in the selection and breeding of multiple batches of cultivation tests, there are few foreign bacteria infections and pests and diseases. Therefore, it was recorded that the black fungus strain L7013 has a strong ability to resist diseases.

[0342] The mycelium of black fungus strain L7013 has strong growth potential, fast germination speed, fast growth rate, higher antibacterial rate against Trichoderma than the control CK Heibao No. 1, and strong stress resistance. Mycelium can grow normally between 15℃-30℃. Cultivated at 15℃-26℃ for 7 days, the mycelium growth rate of black fungus strain L7013 is faster than that of the control CK Heibao No. 1, and the mycelium is denser; the fruiting temperature is 15℃-24℃; the optimum fruiting temperature is 20℃-24℃.

[0343] 6. Comparison of agronomic traits of existing fungus cultivation

[0344] At present, the main varieties of black fungus in my country are mainly from Jilin, Heilongjiang and other regions in my country. This experiment uses the common cultivated black fungus strain CK Heibao No. 1 (mainly from Jilin Agricultural University) as a control. Compared with the existing varieties, the mycelium morphology, fruiting body morphology, bioconversion rate, functional component content, etc. are significantly different from the existing black fungus varieties. For details, see Table 11.

[0345] Table 11 Comparison of agronomic traits of L7013 fungus and approved varieties

[0346]

[0347] 7. Quality analysis of black fungus strain L7013

[0348] Statistical analysis of nutritional components and functional components of black fungus strain L7013 and control CK Heibao No. 1, the results are shown in Table 12.

[0349] Table 12 Statistics of ingredients in black fungus strain L7013 and control CK Heibao No. 1

[0350]

[0351] Note: *Essential amino acids

[0352] The fruiting bodies of the black fungus strain L7013 and the control CK Heibao No. 1 in the mature stage of cultivation in 2023 were dried in the greenhouse and sent to the Guangdong Provincial Microbiological Analysis and Testing Center for testing. The content of each of the 16 amino acids in the black fungus strain L7013 was higher than that in the control, with the total amount of 16 amino acids being 16.90 g / 100 g, while the total amount of 16 amino acids in the control CK Heibao No. 1 was 9.46 g / 100 g; the protein content of the black fungus strain L7013 was 20.50 g / 100 g, while the protein content of the control CK Heibao No. 1 was 11.70 g / 100 g; the fat content of the black fungus strain L7013 was 0.40 g / 100 g, while the fat content of the control CK Heibao No. 1 was also 0.30 g / 100 g; the crude polysaccharide content of the black fungus strain L7013 was 45.6 g / 100 g, while the crude polysaccharide content of the control CK Heibao No. 1 was 10.1 g / 100 g; the iron content of the black fungus strain L7013 was 1.96×10 2 mg / kg, the control CK Heibao No. 1 iron is 2.58×10 2 mg / kg; the ash content of black fungus strain L7013 is 5.8g / 100g, and the control CK Heibao No. 1 is 5.3g / 100g. All the nutrients tested in black fungus strain L7013 are higher than those in the control CK Heibao No. 1, the iron content is lower than that in the control CK Heibao No. 1, and the functional component crude polysaccharide is also higher than that in the control CK Heibao No. 1. Black fungus strain L7013 has higher nutritional value than the control CK Heibao No. 1.

[0353] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A black fungus strain L7013, characterized in that The black fungus ( Auricularia heimuer ) strain L7013 was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64380.

2. The cultivation method of the black fungus strain L7013 according to claim 1, characterized in that: The steps include: Step (1), mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 7-10 days; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 24°C culture room for constant temperature culture for 25-30 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 72-74 parts of sawdust, 23-25 ​​parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 30-35 days to obtain cultivated seeds; The cultivation matrix in the cultivation material bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH 6-8, water content 55-65%; Step (4), post-ripening opening: after the mycelium in step (3) has grown all over the cultivation material bag, the temperature of the culture room is adjusted to 17.5-18.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium; Step (5), mushroom stick cultivation and ear management: the mushroom sticks with holes for cultivation are planted in the field and placed in rows with a width of 1.4-1.6 meters, and 6-7 mushroom sticks are placed in each row; watering begins three days after planting, using dry-wet alternating management, and the watering temperature is 14-25°C.

3. The cultivation method of black fungus strain L7013 according to claim 2, characterized in that, In step (4), 160-200 holes are pierced on each stick.

4. The cultivation method of black fungus strain L7013 according to claim 2, characterized in that, In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

5. The cultivation method of black fungus strain L7013 according to claim 2, characterized in that, In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes.

6. The cultivation method of black fungus strain L7013 according to claim 2, characterized in that: In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

7. The cultivation method of the black fungus strain L7013 according to claim 1, characterized in that: The steps include: Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7013 and inoculate it into the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7-10 days to obtain mycelium blocks; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5°C for 7-10 days to obtain seed liquid; The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 19-21 parts of lactose, 1.9-2.1 parts of peptone, 0.19-0.21 parts of calcium chloride, 990-1010 parts of water, and a pH of 8.8-9.2; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, culturing at 23.5-24.5° C. for 8-11 days, to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of glucose, 190-210 parts of peptone, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of calcium chloride, 99000-101000 parts of water, and the pH is 8.8-9.2; Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 24°C for 30-35 days; The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 17-19 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.5-0.8 parts of lime powder; pH value 6-8, water content 55-65%; Step E, post-ripening opening: after the mycelium has grown all over the cultivation bag, the temperature of the culture room is adjusted to 17.5-18.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium; Step F, mushroom stick cultivation and ear management: plant the mushroom sticks with holes and place them in rows with a width of 1.4-1.6 meters, and place 6-7 mushroom sticks in each row; start watering three days after planting, using alternating dry and wet management, and the watering temperature is 14-25°C.

8. The cultivation method of black fungus strain L7013 according to claim 7, characterized in that: In step B, the shaking speed is 170-190 r / min -1 .

9. The cultivation method of black fungus strain L7013 according to claim 7, characterized in that: In step E, 160-200 holes are pierced on each stick; when growing bacteria, avoid direct sunlight and avoid temperatures exceeding 28°C, and maintain ventilation.

10. The cultivation method of black fungus strain L7013 according to claim 7, characterized in that: In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes; Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

Images