Performance-improved phi29 DNA polymerase mutant as well as preparation method and application thereof

Abstract

The invention discloses a performance-improved phi29 DNA polymerase mutant as well as a preparation method and application thereof, and relates to the technical field of biology. The invention specifically discloses a phi29 DNA polymerase mutant which contains mutation sites of Y163K, F181K, Y224K, W277K / W277P, Y298K, Y369K, Y439K and F526R relative to a wild type phi29 DNA polymerase, and a preparation method of the phi29 DNA polymerase mutant. The amino acid sequence of the wild type phi29 DNA polymerase is as shown in SEQ ID NO: 1. Compared with wild type phi29 DNA polymerase, the DNA polymerase has higher specific enzyme activity, stability and amplification efficiency, and has a good application prospect in the fields of nucleic acid amplification, sequencing and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a phi29 DNA polymerase mutant with improved performance, and a preparation method and application thereof. Background Art

[0002] Phi29 DNA polymerase is encoded by Bacillus subtilis phage phi29 and is a viral DNA replicase that can be widely used in nucleic acid amplification, virus detection and various sequencing technologies, including multiple displacement amplification (MDA), rolling circle amplification (RCA), whole genome amplification (WGA), SNP detection, single polymerase molecule real-time DNA sequencing, DNA nanoball sequencing and nanopore sequencing using synthetic sequencing methods.

[0003] Studies have shown that the stability of phi29 DNA polymerase is poor. The half-life of wild-type phi29 DNA polymerase is 18 min at 30°C when no substrate is added, and only 1 min at 40°C. In addition, a higher salt ion concentration is usually required in its storage buffer to ensure the stability of the enzyme.

[0004] Therefore, it is important to provide a Phi29 DNA polymerase that has good stability under low salt ion concentration conditions. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a phi29 DNA polymerase mutant, which still has good stability under low salt ion concentration conditions and has higher thermal stability and amplification efficiency than the wild-type phi29 DNA polymerase.

[0006] The invention also provides a recombinant protein.

[0007] The present invention also provides biological materials related to the phi29 DNA polymerase mutant or recombinant protein.

[0008] The invention also provides an enzyme preparation.

[0009] The present invention also provides a method for preparing the phi29 DNA polymerase mutant.

[0010] The invention also provides a method for amplifying DNA molecules.

[0011] The present invention also provides applications related to the phi29 DNA polymerase mutant, recombinant protein, biological material or enzyme preparation.

[0012] The invention also provides a kit for nucleic acid amplification or sequencing.

[0013] According to a phi29 DNA polymerase mutant of the first aspect of the present invention, the phi29 DNA polymerase mutant comprises any one of the mutation sites A1) to A2) compared to the wild-type phi29 DNA polymerase: A1), Y163K, F181K, Y224K, W277K, Y298K, Y369K, Y439K, F526R; A2), Y163K, F181K, Y224K, W277P, Y298K, Y369K, Y439K, F526R; The amino acid sequence of the wild-type phi29 DNA polymerase is shown in SEQ ID NO:1.

[0014] The phi29 DNA polymerase mutant according to the embodiment of the present invention has at least the following beneficial effects: By analyzing the molecular structure of wild-type phi29 DNA polymerase, it was found that its protein surface contains more hydrophobic groups, which may be related to the stability of phi29 DNA polymerase in solution. The present invention transforms some surface hydrophobic groups on wild-type phi29 DNA polymerase into polar groups through protein modification engineering technology to enhance the solubility of its protein in the buffer system, thereby improving its performance and stability.

[0015] Compared with the wild-type phi29 DNA polymerase, the phi29 DNA polymerase mutant of the embodiment has a higher specific enzyme activity, which is 2 to 2.7 times that of the wild-type phi29 DNA polymerase; has a higher genome amplification efficiency, and when the single-cell library is constructed by MDA technology, the brightness of the bands obtained after amplification is higher than that of the wild type, and the amplification efficiency is higher; has higher thermal stability, and still has good amplification performance after treatment at 37°C; has higher stability and solubility in low-salt solution. It has a good application prospect in the field of nucleic acid amplification and sequencing.

[0016] According to some embodiments of the present invention, the amino acid sequence of the phi29 DNA polymerase mutant is shown in SEQ ID NO:3 or SEQ ID NO:5.

[0017] A recombinant protein according to an embodiment of the second aspect of the present invention comprises a tag and the phi29 DNA polymerase mutant described in an embodiment of the first aspect of the present invention.

[0018] According to some embodiments of the present invention, the tag is connected to the middle and / or N-terminus and / or C-terminus of the phi29 DNA polymerase mutant.

[0019] According to some embodiments of the present invention, the tag sequence includes at least one of the tag sequences that facilitate the dissolution, purification and detection of the phi29 DNA polymerase mutant. It is understandable that the phi29 DNA polymerase mutant of the present invention may include one or more tag sequences; multiple tag sequences may include a combination of multiple identical tag sequences, or a combination of multiple different tag sequences. For example: tags that facilitate the dissolution of phi29 DNA polymerase mutants include but are not limited to nus tag sequences or maltose binding protein tag sequences; tags that facilitate the purification of phi29 DNA polymerase mutants include but are not limited to strep tag sequences, His tag sequences, GST tag sequences, pelB signal tag sequences or ompA signal tag sequences; tags that facilitate the detection of phi29 DNA polymerase mutants include but are not limited to horseradish peroxidase (HRP) tag sequences, β-galactosidase tag sequences, luciferase tag sequences, green fluorescent protein (GFP) tag sequences, HcRed tag sequences, DsRed tag sequences or cyan fluorescent protein (CFP) tag sequences. The tag can specifically be a His tag sequence.

[0020] According to the third aspect of the present invention, the biological material related to the phi29 DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is any one of B1) to B4): B1), a nucleic acid molecule encoding the phi29 DNA polymerase mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

[0021] According to some embodiments of the present invention, the nucleic acid molecule has any one of B11) to B14): B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO:4; B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6; B13), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B12), and encoding the phi29 DNA polymerase mutant; B14), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B13) under stringent conditions and encodes the phi29 DNA polymerase mutant.

[0022] According to some embodiments of the present invention, the stringent conditions can be hybridization in a 2×SSC, 0.1% SDS solution at 68°C and washing the membrane twice, each time for 5 min; or hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C and washing the membrane twice, each time for 15 min.

[0023] According to some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the phi29 DNA polymerase mutant in a host cell. The DNA may include not only a promoter for initiating transcription of the phi29 DNA polymerase mutant gene, but also a terminator for terminating transcription of the phi29 DNA polymerase mutant gene. Further, the expression cassette may also include an enhancer sequence.

[0024] According to some embodiments of the present invention, the vector may be a plasmid, a cosmid, a phage or a viral vector. For example, it may be a PET-28a vector.

[0025] According to some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the phi29 DNA polymerase mutant into the multiple cloning site of the vector.

[0026] According to some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. Among them, the bacteria can be Escherichia coli, such as E. coli DH5α or E. coli BL21. The recombinant biological cell does not contain reproductive material.

[0027] According to some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule B1), the expression cassette B2) or the recombinant vector B3) into the biological cell. E. coli DH5α or E. coli The recombinant Escherichia coli was obtained by introducing the recombinant vector into BL21.

[0028] An enzyme preparation according to the fourth aspect of the present invention comprises the phi29 DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention.

[0029] According to some embodiments of the present invention, the enzyme preparation further includes a reaction premix.

[0030] According to some embodiments of the present invention, the reaction premix includes Tris-HCl, Mg 2+ NH4 + , DTT, dNTPs, and BSA.

[0031] According to some embodiments of the present invention, the NH4 + The source is an ammonium salt. The ammonium salt includes at least one of an organic ammonium salt (including but not limited to ammonium acetate) and an inorganic ammonium salt (including but not limited to (NH4)2SO4, NH4Cl or a combination thereof).

[0032] According to some embodiments of the present invention, the Mg 2+ The source includes at least one of magnesium chloride, magnesium acetate and magnesium sulfate.

[0033] According to some embodiments of the present invention, the reaction premix includes 20-100 mmol / L Tris-HCl, 9-12 mmol / L Mg 2+ 、9~12 mmol / L NH4 + 、4~6 mmol / L DTT、120~140 μmol / L dNTPs、100~120 ng / μL BSA. For example: the reaction premix may include 50 mmol / L Tris-HCl、10 mmol / L Mg 2+ 、10 mmol / L NH4 + , 4 mmol / L DTT, 125 μmol / L dNTPs, 100 ng / μL BSA.

[0034] According to some embodiments of the present invention, the pH of the reaction premix is ​​7.2-7.8.

[0035] It is understandable that the reaction premix should preferably not affect the activity of the phi29 DNA polymerase mutant.

[0036] According to a fifth aspect of the present invention, a method for preparing the phi29 DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention comprises: The coding gene of the phi29 DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is introduced into a biological cell to express the coding gene to obtain the phi29 DNA polymerase mutant or the recombinant protein.

[0037] According to some embodiments of the present invention, the biological cells include prokaryotic cells and eukaryotic cells.

[0038] According to some embodiments of the present invention, the prokaryotic cell comprises bacteria or algae. Wherein, the bacteria may be Escherichia coli (e.g.: E. coli BL21).

[0039] According to some embodiments of the present invention, the eukaryotic cells include fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0040] A method for amplifying a DNA molecule according to a sixth aspect of the present invention comprises the following steps: The DNA molecule is amplified using the phi29 DNA polymerase mutant described in the embodiment of the first aspect of the present invention, the recombinant protein described in the embodiment of the second aspect of the present invention, or the enzyme preparation described in the embodiment of the fourth aspect of the present invention.

[0041] According to some embodiments of the present invention, the following steps may be specifically included: The phi29 DNA polymerase mutant / recombinant protein / enzyme preparation, the DNA molecule (template DNA), the primer and the reaction premix are mixed and reacted.

[0042] Use of any one of C1) to C4) according to the seventh aspect of the present invention in preparing a nucleic acid amplification or sequencing product; C1), the phi29 DNA polymerase mutant described in the embodiment of the first aspect of the present invention; C2), the recombinant protein described in the embodiment of the second aspect of the present invention; C3), the biomaterial described in the embodiment of the third aspect of the present invention; C4), the enzyme preparation described in the embodiment of the fourth aspect of the present invention.

[0043] According to some embodiments of the invention, the product comprises a kit.

[0044] According to the eighth aspect of the present invention, the use of the phi29 DNA polymerase mutant described in the first aspect of the present invention, the recombinant protein described in the second aspect of the present invention, or the enzyme preparation described in the third aspect of the present invention in nucleic acid amplification or sequencing.

[0045] According to some embodiments of the present invention, the nucleic acid amplification includes but is not limited to rolling circle amplification or multiple strand displacement amplification.

[0046] According to some embodiments of the present invention, the sequencing includes DNA sequencing, including but not limited to single-cell sequencing (such as being used as a DNA polymerase for single-cell library construction), single polymerase molecule real-time DNA sequencing, DNA nanoball sequencing or nanopore sequencing.

[0047] According to the ninth aspect of the present invention, a kit for nucleic acid amplification or sequencing comprises the above-mentioned phi29 DNA polymerase mutant, the above-mentioned recombinant protein or the above-mentioned enzyme preparation.

[0048] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The expression and purification results of phi29 DNA polymerase are shown in Figure A, Figure B, Figure C, and Figure phi29-E2. M in the figure is a protein marker, and lanes 1 to 10 refer to samples 1 to 10, respectively. Figure 2 The results of genome amplification performance test of wild-type phi29 DNA polymerase, phi29 DNA polymerase mutants phi29-E1 and phi29-E2 are shown in the figure; in the figure, M is DNA marker ( GL DNA Marker 10000), 1-2 are experimental groups with a template amount of 10 ng, 3-6 are experimental groups with a template amount of 0.1 ng; Figure 3 The graph is a stability test result of wild-type phi29 DNA polymerase, phi29 DNA polymerase mutants phi29-E1 and phi29-E2 in a low-salt system; Figure 4 The results of the genome amplification performance test of phi29 DNA polymerase after treatment at different temperatures; in the figure, the marker used by the wild-type phi29 DNA polymerase is GL DNA Marker 10000, the marker used for phi29 DNA polymerase mutants phi29-E1 and phi29-E2 is GL DNA Marker 15000, lanes 1-2 in each figure are untreated groups, lanes 3-4 are 37℃ heated for 30 min groups, lanes 5-6 are 42℃ heated for 30 min groups, and lanes 7-8 are 45℃ heated for 30 min groups; Figure 5 This is the differential scanning fluorimetry (DSF) detection result of wild-type phi29 DNA polymerase; Figure 6This is a graph showing the DSF detection results of phi29 DNA polymerase mutants phi29-E1 and phi29-E2. DETAILED DESCRIPTION

[0050] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0051] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0052] In the description of the present invention, the terms "comprises" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method or product comprising a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to these processes, methods or products.

[0053] Unless otherwise defined, all scientific or technical terms in this patent are consistent with the common understanding of most ordinary persons in the field.

[0054] The following amino acid sequences are all in order from N-terminus to C-terminus; the nucleotide sequences are all in order from 5' to 3' end.

[0055] The term "amino acid" refers to the basic unit that constitutes protein, which gives protein a specific molecular structure and makes its molecule have biochemical activity. For example, the "amino acid" used in the present invention includes the following 20 natural amino acids: alanine (Ala or A), glycine (Gly or G), isoleucine (Ile or I), asparagine (Asn or N), arginine (Arg or R), lysine (Lys or K), lysine (Lys or K), cysteine ​​(Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), leucine (Leu or L), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), valine (Val or V) and tyrosine (Tyr or Y).

[0056] The term "amplification" refers to the process in which the number of target nucleic acid fragments increases under the action of nucleic acid polymerase.

[0057] In order to obtain phi29 DNA polymerase with good thermal stability and amplification performance, the wild-type phi29 DNA polymerase was mutated and a large number of screenings were performed to obtain phi29 DNA polymerase mutants phi29-E1 and phi29-E2.

[0058] The amino acid sequence of the wild-type phi29 DNA polymerase phi29-wt is shown in SEQ ID NO: 1. (SEQ ID NO: 1).

[0059] The nucleotide sequence encoding the amino acid sequence of the wild-type phi29 DNA polymerase is shown in SEQ ID NO: 2:

[0060] The phi29 DNA polymerase mutant phi29-E1 is formed by mutation of the amino acids shown in SEQ ID NO: 1, and the specific amino acid mutations are Y163K, F181K, Y224K, W277K, Y298K, Y369K, Y439K, and F526R. The amino acid sequence is specifically shown in SEQ ID NO: 3.

[0061] (SEQ ID NO:3).

[0062] The nucleotide sequence encoding the amino acid sequence of the phi29 DNA polymerase mutant phi29-E1 is shown in SEQ ID NO:4:

[0063] The phi29 DNA polymerase mutant phi29-E2 is formed by mutation of the amino acids shown in SEQ ID NO: 1, and the specific amino acid mutations are Y163K, F181K, Y224K, W277P, Y298K, Y369K, Y439K, and F526R. The amino acid sequence is specifically shown in SEQ ID NO: 5.

[0064] (SEQ ID NO:5).

[0065] The nucleotide sequence encoding the amino acid sequence of the phi29 DNA polymerase mutant phi29-E2 is shown in SEQ ID NO:6:

[0066] Example 1 1. Construction of expression vector: Hunan Aikerui Bioengineering Co., Ltd. was commissioned to design a nucleotide sequence encoding a histidine tag (HHHHHHHH) and a connecting peptide (GS) at the 3' end based on the coding nucleotide sequence information of phi29-wt, phi29-E1 and phi29-E2, namely ATGCATCACCACCATCACCATCACCACGGTAGC (SEQ ID NO: 7), and synthesize the corresponding DNA molecules. The DNA molecules were then connected to the PET-28a vector by overlapping PCR to obtain the recombinant expression vectors PET-28a / phi29-wt, PET-28a / phi29-E1 and PET-28a / phi29-E2.

[0067] Further, the above recombinant expression vectors were used as templates for PCR amplification, and then Steady The PCR product was purified and recovered using the PurePCR reaction solution purification kit (Hunan Aikerui Biotechnology Co., Ltd., Catalog No. AG21003), and the recovered product was transformed into DH5α competent cells. The positive single clones were screened for sequencing verification. After verification, the results were consistent with expectations.

[0068] 2. Expression: The recombinant plasmids obtained in step 1 were transformed into host cells E. coli From BL21, single colonies were picked and inoculated into 100 mL LB medium containing 50 μg / mL ampicillin. After incubation in a shaker at 37°C overnight, they were inoculated into 2 L LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100 and incubated in a shaker at 37°C until 0 D 600 is 0.6~0.8; add IPTG to a final concentration of 0.4 mmol / L, lower the temperature to 16℃ and continue shaking induction for 16 h~18 h; collect the induced bacteria by centrifugation and weigh them, record the wet weight of the bacteria, and store them at -80℃.

[0069] 3. Purification: Take the cells frozen at -80℃ after induction of expression, add 3 mL of lysis buffer (50 mMTris-HCl, 1 mM EDTA, 300 mM NaCl, 1 mM DTT, pH 7.5) per gram of wet weight to resuspend the cells, and use a high-pressure crusher to lyse the cells. The high-pressure crushing condition is 700 bar, and the crushing is repeated three times. Centrifuge the lysed cells at 4℃ and 12000 rpm for 30 minutes, take the supernatant A (sample 1) to a 200 mL sterile beaker, and discard the precipitate A (sample 2). Add 10% PEI to the supernatant A to a final PEI concentration of 0.6%, stir at low speed for 30 min~60 min, and centrifuge at 4℃ and 12000 rpm for 30 min, take the supernatant B (sample 3) to a new 200 mL sterile beaker, and discard the precipitate B (sample 4). After adding (NH4)2SO4 to the supernatant B until the final concentration of (NH4)2SO4 is 65%, centrifuge at 4°C and 12000 rpm for 30 min, take the precipitate C (sample 5), and discard the supernatant C. Dissolve the precipitate C in buffer A (50 mM Tris-HCl, 1 mM EDTA, 300 mM NaCl, 1 mM DTT, 20 mM imidazole, pH 7.5) to obtain the protein solution to be purified (sample 6).

[0070] After equilibration of the chromatography column Ni-NTA Purose 6 Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.) with buffer A, the protein solution to be purified was loaded onto the chromatography column, the column was first rinsed with buffer A, and then gradient eluted with buffer B (50 mM Tris-HCl, 1 mM EDTA, 300 mM NaCl, 1 mM DTT, 700 mM imidazole, pH 7.5) from 0% to 100%, and the eluted fractions were detected by SDS-PAGE protein electrophoresis. According to the detection results, the eluate A containing the target protein was collected (sample 7), and the eluate A was dialyzed into buffer A, and the dialyzate A (sample 8) was collected. The dialysate A was subjected to secondary nickel ion affinity chromatography purification with the same steps as above, and the eluate B (sample 9) containing the target protein was collected. The eluate B was dialyzed into enzyme preservation solution (10 mM Tris-HCl, 100 mM KCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol, 0.5% Tween20, 0.5% Nonidet P-40, pH 7.5), and the dialysate B (sample 10) was collected for later use.

[0071] Take 30 μL of each sample 1 to sample 10, and analyze the purification results by SDS-PAGE electrophoresis.

[0072] The results are as follows Figure 1shown.

[0073] Test Example 1 This test example tests the enzyme activity of the phi29 DNA polymerase obtained above. Within a certain period of time, a control curve is established based on the amount of product obtained under different enzyme addition amounts of the commercial DNA polymerase, and a curve of the DNA polymerase to be tested is established at the same time. The ratio of the slopes of the two is calculated, which can be used to determine the enzyme activity of the DNA polymerase to be tested. A hairpin oligonucleotide sequence is designed. Under the catalysis of the DNA polymerase, dNTPs gradually infiltrate, and the hairpin oligonucleotide sequence will eventually form a double-stranded DNA product. SYBR Green I is a highly sensitive fluorescent dye that binds to double-stranded DNA. It can bind to double-stranded DNA to produce a fluorescent signal, and its fluorescent signal intensity is positively correlated with the concentration of double-stranded DNA. By measuring the fluorescent signal value within a certain period of time, the enzyme activity value of the DNA polymerase to be tested can be calculated.

[0074] Enzyme activity assay: a hairpin oligonucleotide sequence was designed (Test 1: 5'-tagcgaaggatgtgaacctaatcccTGCTCCCGCGGCCGatctgcCGGCCGCGGGAGCA-3'). According to the brightness of the protein liquid band finally obtained in the SDS-PAGE electrophoresis gel image of the purified protein, the enzyme activity of the purified wild-type and mutant phi29 DNA polymerase was calculated in advance at a certain ratio to obtain the estimated enzyme activity value, which was diluted to an estimated 10 U / uL with enzyme preservation solution. The commercial DNA polymerase (purchased from Nearshore Protein, product number E013-02A), wild-type phi29 DNA polymerase solution and phi29 DNA polymerase mutant solution were then diluted by different multiples with the enzyme preservation solution to obtain the diluted enzyme solution. Add 5 μL of diluted enzyme solution to 20 μL reaction system (25 mmol / L Tris-HC1, 50 mmol / L KCl, 5 mmol / L (NH4)2SO4, 2.5 mmol / L MgC12, 0.1% TritonX-100, 0.25 mmol / L dNTPs, 0.5 μmol / L Test 1, pH 8.5), react at 30℃ for 5 min, immediately cool on ice, and add EDTA to a final concentration of 10 mM to terminate the reaction; add 1×SYBR dye solution at a volume ratio of 1:30, and use a microplate reader for detection. Note that 2 parallels should be prepared for each dilution factor to reduce experimental errors, and 2 blank controls should be prepared for each reaction to deduct the fluorescence background. Export the original fluorescence signal value data, deduct the fluorescence background signal value, and calculate the slope value of the fluorescence signal value and the enzyme amount.

[0075] The results of enzyme activity test of wild type phi29 and mutants phi29-E1 and phi29-E2 are shown in Table 1.

[0076] Table 1

[0077] The results showed that the purified phi29 DNA polymerase mutants phi29-E1 and phi29-E2 had higher specific enzyme activity than the wild-type phi29 DNA polymerase, which was 2 to 2.7 times.

[0078] Test Example 2 This test example tests the amplification performance of phi29 DNA polymerase mutants for single-cell library construction. Human genomic DNA is used as a template, and wild-type phi29 DNA polymerase or phi29 DNA polymerase mutants are used to perform single-cell library construction amplification reactions using MDA technology. The overall electrophoresis band brightness obtained after the amplification reaction determines its amplification efficiency. The steps are as follows: A 20 μL reaction system containing 10 ng or 0.1 ng template (50 mmol / L Tris-HCl, 10 mmol / LMgCl2, 10 mmol / L (NH4)2SO4, 4 mmol / L DTT, 125 μmol / L dNTPs, 25 μmol / L RandomPrimer 6 (purchased from NEB, product number S1230S), 100 ng / μL BSA, 10 U enzyme, pH 7.5) was incubated at 30°C for 2 h, then incubated at 65°C for 10 min, and the products were detected by electrophoresis using 1% agarose gel.

[0079] The electrophoresis results are as follows Figure 2 The concentration determination results are shown in Table 2 below.

[0080] Table 2

[0081] Under the same reaction system and reaction conditions, the brightness of the bands amplified by the phi29 DNA polymerase mutants phi29-E1 and phi29-E2 were much brighter than that of the wild-type phi29 DNA polymerase, and when the template amount was reduced to 0.1 ng / uL, the amplified bands of the phi29 DNA polymerase mutants phi29-E1 and phi29-E2 were detected, while the wild-type phi29 DNA polymerase could no longer amplify the bands. This indicates that the amplification efficiency of the phi29 DNA polymerase mutants phi29-E1 and phi29-E2 for single-cell library construction is better than that of the wild-type phi29 DNA polymerase.

[0082] Test Example 3 This test example tests the stability of phi29 DNA polymerase mutants in a low-salt buffer system.

[0083] The wild-type phi29 DNA polymerase and each phi29 DNA polymerase mutant were diluted to the same protein concentration (1.5 mg / mL) using enzyme storage solution, and then diluted 2-fold and 3-fold with deionized water and mixed. The buffer components of each protein stock solution were consistent with the enzyme storage solution. After dilution, the concentration of each component was reduced accordingly to form a low-salt buffer system. After each diluted sample was placed at 4°C for 12 h, it was centrifuged at 12000 rpm for 10 min to detect its protein precipitation.

[0084] The experimental results are as follows Figure 3 shown.

[0085] The results showed that after dilution, the protein solutions of phi29 DNA polymerase mutants phi29-E1 and phi29-E2 did not change significantly, while the wild-type phi29 DNA polymerase had obvious protein precipitation at 2 and 3 dilution multiples. This indicates that the solubility of phi29 DNA polymerase mutants phi29-E1 and phi29-E2 has increased, and their stability in the low-salt buffer system is better than that of the wild-type phi29 DNA polymerase.

[0086] Test Example 4 This test example tests the thermal stability of phi29 DNA polymerase mutants.

[0087] 1. Changes in amplification performance of single-cell library construction after phi29 DNA polymerase mutants were treated at different temperatures for 30 min.

[0088] The same volume of wild-type phi29 DNA polymerase and phi29 DNA polymerase mutants phi29-E1 and phi29-E2 obtained in Example 1 were heat treated at 37°C, 42°C, and 45°C for 30 min, respectively, and then the amplification performance changes of each sample for single-cell library construction were detected. The performance measurement method consistent with that in Detection Example 2 was used to adjust the template addition amount to 10 ng, and the amplification performance was detected.

[0089] The experimental results are as follows Figure 4 As shown, the results of the determination of the concentration of the recovered product are shown in Table 3 below.

[0090] Table 3

[0091] Note: Groups 1 and 2 were not heated, groups 3 and 4 were treated at 37°C for 30 min, groups 5 and 6 were treated at 42°C for 30 min, and groups 7 and 8 were treated at 42°C for 30 min.

[0092] The results showed that under the same reaction system, the overall brightness of the wild-type phi29 DNA polymerase band was weak, and no amplified bands were found after heat treatment at three temperatures; phi29-E1 and phi29-E2 both obtained amplified bands brighter than the wild-type phi29 DNA polymerase, and both groups treated at 37°C for 30 minutes had amplified bands. This indicates that the thermal stability of the two phi29 DNA polymerase mutants obtained by the present invention is improved.

[0093] 2. Differential scanning fluorimetry (DSF) was used to detect the Tm value of phi29 DNA polymerase mutant.

[0094] DSF refers to the process of slowly heating the sample on a fluorescent quantitative PCR instrument and detecting the amount of fluorescent dye bound to the structurally changed protein during the heating process to evaluate the thermal stability of the protein. DSF can monitor the changes in protein conformation during the heating process through fluorescent dyes or protein endogenous fluorescence signals to calculate its melting temperature Tm (the temperature at which the folded protein and unfolded protein are equal). Since phi29 DNA polymerase is highly hydrophobic, the fluorescent dye Basic Yellow 1 was selected as the detection dye in this experiment. When the temperature rises, the protein unfolds and the hydrophobic part is exposed. The hydrophobic dye Basic Yellow 1 (purchased from TCI, catalog number T0558) specifically binds to the hydrophobic part of the protein, and the fluorescence is enhanced. The higher the measured Tm value, the stronger the thermal stability of the protein.

[0095] A 20 μL reaction system (20 mmol / L HEPES-KOH, 150 mmol / L KCl, 1 mg enzyme, 20×BasicYellow 1 fluorescent dye, pH 8.0) was placed in a fluorescent quantitative PCR instrument, the excitation and emission wavelengths were adjusted to the corresponding wavelengths of the fluorescent dye, the heating rate was set to 1°C / 10s, the temperature range was from 25°C to 99°C, and the fluorescence intensity was measured every 1°C to 3°C. After the reaction was completed, the curve of fluorescence intensity versus temperature was drawn using the data processing software Protein Thermal Shift Software, and the Tm value and related parameters of the protein sample were calculated.

[0096] The results are as follows Figure 5 and Figure 6 shown.

[0097] The Tm value of phi29-wt was 33.4, the Tm value of phi29-E1 was 36.3, and the Tm value of phi29-E2 was 37.3, indicating that the thermal stability of phi29 DNA polymerase mutants phi29-E1 and phi29-E2 was higher than that of phi29-wt.

[0098] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A phi29 DNA polymerase mutant, characterized in that: Compared with the wild-type phi29 DNA polymerase, the phi29 DNA polymerase mutant comprises any one of the mutation sites A1) to A2): A1), Y163K, F181K, Y224K, W277K, Y298K, Y369K, Y439K, F526R; A2), Y163K, F181K, Y224K, W277P, Y298K, Y369K, Y439K, F526R; The amino acid sequence of the wild-type phi29 DNA polymerase is shown in SEQ ID NO:

1.

2. A recombinant protein, characterized in that Comprising a tag and the phi29 DNA polymerase mutant according to claim 1.

3. A biological material related to the phi29 DNA polymerase mutant of claim 1 or the recombinant protein of claim 2, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the phi29 DNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that The nucleic acid molecule has any one of B11) to B14): B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO:4; B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6; B13), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B12), and encoding the phi29 DNA polymerase mutant; B14), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B13) under stringent conditions and encodes the phi29 DNA polymerase mutant.

5. An enzyme preparation, characterized in that It includes the phi29 DNA polymerase mutant described in claim 1 or the recombinant protein described in claim 2.

6. A method for preparing the phi29 DNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2, characterized in that: include: The coding gene of the phi29 DNA polymerase mutant described in claim 1 or the recombinant protein described in claim 2 is introduced into a biological cell to express the coding gene, thereby obtaining the phi29 DNA polymerase mutant or the recombinant protein.

7. A method for amplifying a DNA molecule, characterized in that: include: The DNA molecule is amplified using the phi29 DNA polymerase mutant described in claim 1, the recombinant protein described in claim 2 or the enzyme preparation described in claim 5.

8. Use of any one of C1) to C4) in the preparation of nucleic acid amplification or sequencing products; C1), the phi29 DNA polymerase mutant according to claim 1; C2), the recombinant protein according to claim 2; C3), the biological material according to claim 3 or 4; C4) and the enzyme preparation according to claim 5.

9. Use of the phi29 DNA polymerase mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 5 in nucleic acid amplification or sequencing.

10. A kit for nucleic acid amplification or sequencing, characterized in that: It includes the phi29 DNA polymerase mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 5.

Images