Application of ZmGAD gene and InDel molecular marker in regulation and control of GABA content of corn root system

Abstract

The invention relates to a molecular marker and application thereof, in particular to application of a ZmGAD gene and an InDel molecular marker in regulating and controlling the GABA content of a corn root system. The molecular marker ZmGAD-INDEL10842 provided by the invention has the characteristics of stable amplification, high detection efficiency and the like, provides an effective marker resource for molecular marker-assisted breeding of the GABA content of the corn root system, can promote genetic improvement of the stress resistance of the corn, and assists in cultivation of new high-yield varieties of the corn.

Description

Technical Field

[0001] The invention belongs to the technical field of crop seed selection and breeding, and particularly relates to the application of ZmGAD gene and InDel molecular marker in regulating the GABA content of corn root system. Background Art

[0002] As one of the most important food crops in the world, the yield and quality of corn have always attracted the attention of agricultural scientists. With the rapid development of bioinformatics, genome-wide association study (GWAS) has become a hot topic in genomic research in recent years. By testing the significance of the association between genome-wide genetic markers and phenotypic variation, genetic loci related to traits are located, and the genetic basis of traits is analyzed at the population level, which can provide a theoretical basis and reference for crop trait genetic improvement and molecular marker-assisted breeding.

[0003] The root system is not only the main organ for absorbing water and nutrients, but also can adapt to the changing soil environment by regulating root structure, synthesizing or secreting hormones, organic acids and enzymes. The quality of maize root development is an important factor affecting maize stress resistance. γ-Aminobutyric acid (GABA) is a non-protein amino acid that is ubiquitous in plants. It is recognized as an endogenous plant signal transduction molecule and participates in a variety of physiological and biochemical reactions. It also participates in signal transduction, nitrogen metabolism, osmotic regulation and antioxidant stress protection. GABA can directly or indirectly improve the plant's stress resistance and alleviate the damage of abiotic stress to plants. At present, there are very few reports on sites and genes related to the GABA content in maize roots, and there are no relevant reports on target sites. Therefore, it is of great significance to explore the main effect sites of maize root GABA content stability, develop functional markers and use them in breeding, and accelerate the selection of new maize varieties with stress resistance. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides an application of a ZmGAD gene and an InDel molecular marker in regulating the GABA content of corn roots. The molecular marker can be widely used to identify the GABA content of corn roots to be tested, thereby accelerating the breeding process.

[0005] The technical solution provided by the present invention is as follows:

[0006] Application of maize ZmGAD gene in regulating maize root growth, the nucleotide sequence of the maize ZmGAD gene is as shown in SEQ ID NO.1; or generated by adding, replacing or deleting one or several bases from the nucleotide sequence shown in SEQ ID NO.1, and encoding a nucleotide sequence that controls maize ZmGAD protein.

[0007] Furthermore, the maize ZmGAD gene is as follows (a) or (b):

[0008] (a) a protein consisting of the amino acid sequence shown in SEQ ID No. 2;

[0009] (b) A protein derived from SEQ ID No. 2 by substitution and / or addition and / or deletion of one or more amino acid residues in the sequence shown in SEQ ID No. 2.

[0010] Furthermore, the regulating the growth of corn root system includes regulating the root length of corn, L-glutamic acid content and GABA content in the root.

[0011] The present invention also provides a method for promoting the growth of corn root system, wherein the CDS sequence of corn ZmGAD gene is constructed into a plant expression vector, and transformed into a target plant to obtain positive overexpression transgenic corn; the transgenic corn has a higher yield than the target plant, and the nucleotide sequence of the corn ZmGAD gene is shown in SEQ ID NO.1.

[0012] Furthermore, the method for promoting the growth of corn root system includes increasing the root length and GABA content of corn and reducing the L-glutamic acid content in the root.

[0013] The present invention also provides a molecular marker related to the GABA content of corn roots. The sequence of the molecular marker is shown in SEQ ID NO.1, and the polymorphism at position 628 of SEQ ID NO.1 is deletion or CT, and the insertion / deletion is located in the fourth exon region of the ZmGAD gene.

[0014] Furthermore, in the Indel site of the molecular marker, the GABA content in the corn root system of the base-deficient type is higher than that of the inserted type base.

[0015] The present invention also provides the above-mentioned molecular marker primers related to the GABA content of corn roots, and the sequences of the primers are as follows:

[0016] ZmGAD-INDEL10842-Fg: 5'-GAAGGTGACCAAGTTCATGCTTCGCGGCCATCCTCG-3';

[0017] ZmGAD-INDEL10842-Ft: 5'-GAAGGTCGGAGTCAACGGATTTGTGGCGGCCATCCTCT-3';

[0018] ZmGAD-INDEL10842-R: 5'-TCCTCGAACTCGCCGTTC-3.

[0019] The present invention also provides the use of the above-mentioned molecular markers related to the GABA content of corn roots or the above-mentioned primers in identifying the GABA content of corn roots and cultivating corn varieties with developed root systems.

[0020] The present invention also provides a method for cultivating a corn variety with a developed root system, comprising the following steps: performing PCR amplification on the DNA of the corn variety to be tested to obtain a PCR product, using the above-mentioned primers as amplification primers, and after the amplification is completed, reading the fluorescent signal to obtain the genotype result; and selecting gene-deficient corn plants for breeding.

[0021] A molecular marker related to the GABA content in maize roots is named ZmGAD-INDEL10842, which is an ARMS marker. It is obtained by amplification using two forward primers shown in SEQ ID NO:1 and SEQ ID NO:2, and one reverse primer shown in SEQ ID NO:3. The 5' ends of the forward primers of SEQ ID NO:1 and SEQ ID NO:2 are respectively combined with FAM and HEX fluorescent groups. In the fluorescence detection, if the detected fluorescent signal is blue, it indicates that the base of the Indel site is deleted (--); if the fluorescent signal is green, it indicates that the base of the Indel site is inserted (CT).

[0022] According to the mutation site, the test population was divided into two types, and there were significant differences in L-glutamate content, ZmGAD gene expression and root traits between the two types. Among them, the base deletion (--) at the Indel site was identified as the superior type of the maize ZmGAD gene.

[0023] Beneficial Effects

[0024] Based on whole genome association analysis, the present invention discovered a new site significantly associated with the GABA content in maize roots and developed a molecular marker ZmGAD-INDEL10842 for regulating the GABA content in maize roots. The molecular marker can be widely used to identify the GABA content in maize roots to be tested, thereby accelerating the breeding process.

[0025] The molecular marker ZmGAD-INDEL10842 provided by the present invention has the characteristics of stable amplification and high detection efficiency, etc., and provides an effective marker resource for molecular marker-assisted breeding of GABA content in corn roots, which can promote the genetic improvement of corn stress resistance and assist in the breeding of new high-yield corn varieties.

[0026] By applying the molecular marker ZmGAD-INDEL10842 related to the GABA content of corn provided by the present invention, it is possible to determine whether the synergistic variation of the corn GABA locus of the corn variety (line) to be tested exists, which greatly improves the selection efficiency and quality of corn varieties (lines), minimizes costs, and directly realizes the identification of target trait loci in corn germplasm resources and breeding offspring, providing a reliable molecular marker for corn molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The purpose is to map the mQTLs related to GABA and L-glutamate content on chromosome 1 of maize, the distribution of ZmGAD genes, the relationship between gene expression and metabolite abundance, and the comparison of phenotypes and root characteristics of different genotypes and materials (including wild type, knockout and overexpression materials). (A) mQTL mapping of γ-aminobutyric acid (GABA) content in roots on maize chromosome 1; (B) mQTL mapping of L-glutamate content in roots on maize chromosome 1; (C) Distribution and location of ZmGAD gene on maize chromosome 1; (D) Relationship between gene expression level and GABA abundance; (E) Relationship between gene expression level and L-glutamate abundance; (F) Changes in various indicators between two genotypes (CC and TT); (G) Difference in GABA abundance between ZmGAD wild-type and knockout material sample groups; (H) Difference in GABA abundance between ZmGAD wild-type and overexpression material sample groups; (I) Difference in root L-glutamate content between different sample groups; (J) Comparison photos of ZmGAD wild-type and knockout mutant materials; (K) Difference in root length between ZmGAD wild-type and knockout mutant materials; (L) Comparison photos of ZmGAD wild-type and overexpression materials; (M) Difference in root length between ZmGAD wild-type and overexpression materials.

[0028] Figure 2 Schematic diagram of the association between ZmGAD gene variation and GABA and L-glutamate, haplotype difference analysis caused by InDel10842, and structural changes of ZmGAD caused by this variation. (A) The regional Manhattan plot shows the association between the genetic variation of ZmGAD and the expression levels of GABA, L-glutamate and ZmGAD in maize inbred lines. The figure shows the structure diagram of the ZmGAD gene. The gray dotted line indicates the significant p-value threshold (p=2.278×10^-5). Significant variations associated with the expression levels of GABA, L-glutamate and ZmGAD are highlighted in red, blue and green, respectively. InDel10842 is marked with a red dotted line. (B) Schematic diagram of structural variation shows the changes caused by the insertion of 2 bases. The structure is predicted by NCBI's conserved domain search service, showing that ZmGAD - -Contains the glutamate decarboxylase (GAD) domain. The red line indicates the location of InDel10842. This insertion causes premature translation termination and interrupts the glutamate decarboxylase domain. (C) The haplotypes of ZmGAD in the natural variation population are shown according to InDel10842. The box plot shows the GABA content, L-glutamate content, ZmGAD expression, and total root length (TRL) of each haplotype. n indicates the number of maize inbred lines in each haplotype. Comparisons were performed using a two-sided Student's t test, and p values ​​are indicated.

[0029] Figure 3 This is the typing diagram of the ZmGAD-INDEL10842 site-specific primer connected to the FAM fluorescent group. DETAILED DESCRIPTION

[0030] Example 1

[0031] Validation of candidate genes

[0032] Untargeted metabolome analysis was performed on root samples of 273 maize inbred lines, and a total of 406 metabolites were identified. A genome-wide association analysis was performed on the 406 root metabolites using 300,877 high-quality SNPs obtained from transcriptome data. mQTLs associated with root metabolites (GABA and L-glutamate) were determined by GWAS, and eQTLs for ZmGAD were identified in combination with transcriptome data. Analysis of variance (ANOVA) was used to assess the correlation between the abundance of GABA, L-glutamate, and ZmGAD expression. An mQTL hotspot with linked variants was found on chromosome 1, which were co-associated with GABA and L-glutamate. There were three overlapping mQTLs between L-glutamate and GABA. Based on information such as gene sequence variation, gene expression, and functional annotation, the candidate gene was identified as ZmGAD, encoding glutamate decarboxylase, which is a key enzyme that catalyzes the conversion of L-glutamate to GABA. The eGWAS results of ZmGAD showed that the eQTLs (including S1_269571758, S1_269571776 and S1_269571900) in the coding region of ZmGAD overlapped with the mQTLs related to L-glutamate and GABA. The expression level of ZmGAD was significantly correlated with the abundance of both GABA and L-glutamate. The peak SNP (S1_269571758) was located in the 7th exon of ZmGAD. The test population was divided into two types according to the variant site. There were significant differences in GABA content, L-glutamate content, ZmGAD gene expression and root traits between the two types of samples. Among them, cytosine (C) and thymine (T) were associated with high abundance and low abundance of GABA, respectively. Inbred lines with C alleles had lower L-glutamate abundance than inbred lines with T alleles. The expression level of ZmGAD in inbred lines carrying the C allele was significantly higher than that in inbred lines carrying the T allele (P = 1.163 × 10-41). In addition, we observed that the TRL in inbred lines with the C allele was significantly longer than that in inbred lines with the T allele. There was a significant correlation between the SNP loci of the ZmGAD gene and GABA and L-glutamate, indicating that this gene plays an important role in the metabolic regulation of maize roots. The identified C allele was associated with better root traits and metabolite abundance, providing a genetic basis for maize improvement. Therefore, it is of great value to further study the performance of ZmGAD under different environmental conditions and its application in maize variety improvement.

[0033] Example 2

[0034] Functional analysis

[0035] We validated the functionality of ZmGAD using mutants generated by CRISPR / Cas9 with three independent lines with specific genetic modifications, including deletion, 5 bp deletion, and insertion. We also generated four transgenic plants overexpressing ZmGAD driven by the maize ubiquitin promoter. For the overexpression construct, the ZmGAD coding sequence of B73 was cloned into the pBCXUN vector and driven by the maize Ubiquitin1 promoter. These fusion vectors were transformed into immature embryos of the maize inbred line ND101 by Agrobacterium-mediated transformation. RT-qPCR was then performed to determine the expression levels of the ZmGAD overexpression lines. The nucleotide sequences of all primers used to isolate the ZmGAD overexpression lines are as follows:

[0036] ZmGAD-CRISPR-F: AGCACGCAAAGCCAGCAA (SEQ ID NO. 3);

[0037] ZmGAD-CRISPR-R:AAGGACGCCAGGTTCAGC (SEQ ID NO.4);

[0038] Actin-F: GTGTCCTGTCCACCCACTCTCT (SEQ ID NO.5);

[0039] Actin-R: GGAACTCGTTCACATCAACGTTC (SEQ ID NO. 6);

[0040] ZmGAD-OE-F: GCTACTACGTCATGGACCCG (SEQ ID NO.7);

[0041] ZmGAD-OE-R:GAAGTCCCACTCCAGTTCCG (SEQ ID NO.8);

[0042] Quantitative RT-PCR (reverse transcription polymerase chain reaction) analysis showed that the expression level of ZmGAD in the overexpression line was 2-5 times higher than that in the wild type. Compared with the wild type, the GABA content in the roots of the ZmGAD knockout line decreased by about 75.51%, while the GABA content in the ZmGAD overexpression line increased significantly, about 36 times that of the wild type, the L-glutamate content decreased by 50.36%, and the root length increased by 17.31%. These results indicate that ZmGAD plays a key role in regulating GABA and L-glutamate levels and root growth. Functional loss leads to the blockage of GABA synthesis, which causes L-glutamate to accumulate in the body as a precursor. Overexpression of ZmGAD, on the other hand, increases the efficiency of GABA synthesis and reduces the content of L-glutamate. In addition, the importance of ZmGAD for root development is also reflected. The root length of the ZmGAD knockout line is shorter than that of the wild type, while the root length of the ZmGAD overexpression line is longer. These results confirm that ZmGAD acts as a positive regulator of GABA accumulation and affects maize root development.

[0043] Example 3

[0044] Application of molecular markers

[0045] 1. Development of KASP molecular markers at SNP1 locus

[0046] Three primers were designed for the SNP1 site of the ZmGAD gene for GABA content in maize roots, and an ARMS (Allele-Specific PCR, AS-PCR) molecular marker was developed. The three primers include two specific upstream primers and one specific downstream primer. The two upstream primers are respectively denoted as ZmGAD-INDEL10842-Fg and ZmGAD-INDEL10842-Ft, and the downstream primer is denoted as ZmGAD-INDEL10842-R. The developed ARMS molecular marker is denoted as ZmGAD-INDEL10842. The nucleotide sequences of the three primers are as follows:

[0047] ZmGAD-INDEL10842-Fg:

[0048] 5'-GAAGGTGACCAAGTTCATGCTTCGCGGCCATCCTCG-3' (SEQ ID NO. 9);

[0049] ZmGAD-INDEL10842-Ft:

[0050] 5'-GAAGGTCGGAGTCAACGGATTTGTGGCGGCCATCCTCT-3' (SEQ ID NO. 10);

[0051] ZmGAD-INDEL10842-R:

[0052] 5'-TCCTCGAACTCGCCGTTC-3 (SEQ ID NO. 11).

[0053] In order to detect the PCR amplification product using a fluorescence reader, a FAM fluorescent group was combined with the 5' end of the upstream primer ZmGAD-INDEL10842-T, and a HEX fluorescent group was combined with the 5' end of the upstream primer ZmGAD-INDEL10842-C.

[0054] 2. Identification of SNP1 genotype

[0055] The genotypes of 273 natural population materials were identified using molecular markers at the SNP site (ZmGAD-INDEL10842). The specific steps include:

[0056] (1) PCR amplification

[0057] (i) PCR amplification was performed on the DNA of the tested corn variety to obtain PCR products. The PCR amplification system was as follows: 1 μL DNA template, 0.15 μL allele-specific primer 1, 0.15 μL allele-specific primer 2, 0.4 μL marker-specific primer, 5 μL 2× PARMS premix, 3.3 μL ddHO 2 O; amplify using a common amplification procedure, as follows:

[0058] (ii) PCR amplification reaction conditions are as follows: denaturation at 94°C for 20 min; 10 cycles: denaturation at 94°C for 20 s, annealing at 65°C for 1 min; 32 cycles: denaturation at 94°C for 20 s, annealing at 57°C for 1 min; end of amplification.

[0059] (2) Genotyping

[0060] After PCR is completed, the fluorescence signal is read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder is used to parse and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results are output according to different colors.

[0061] The results showed that the ZmGAD-INDEL10842 site-specific primer was connected to a FAM fluorescent group. On the genotyping chart, if the fluorescent signal detected is blue, it indicates that the base at the Indel site is a deletion (--) type; if the fluorescent signal is green, it indicates that the base at the Indel site is an insertion (CT) type; and red indicates a heterozygous type ( Figure 3 ).

[0062] (3) Typing results

[0063] The GABA content, L-glutamate abundance, ZmGAD relative expression level, and root length in the roots of maize plants with different ZmGAD gene types were measured and data were visualized using Prism software. The GABA content of the Indel site base insertion type was reduced by about 45.00% compared with the Indel site base deletion type, and the relative expression level of ZmGAD was significantly reduced by about 82.45%. This indicates that the base insertion in the Indel site base insertion type may lead to a significant decrease in the expression of the ZmGAD gene, thereby reducing the synthesis of GABA. Despite this, the L-glutamate abundance of the Indel site base insertion type increased by about 24.19%, which means that despite the limited GABA synthesis, the accumulation of L-glutamate as a precursor is increasing, suggesting that the Indel site base insertion type may be less efficient in converting L-glutamate into GABA. In addition, the root length of the Indel site base insertion type was reduced by about 12.16%, further indicating the importance of ZmGAD in root growth. Therefore, the Indel site base deletion type significantly increased GABA content and promoted root growth by high expression of ZmGAD, while low expression of the Indel site base insertion type weakened this function, revealing the key role of ZmGAD in the response of maize roots to abiotic stress. Indel site base insertion type Indel site base deletion type

[0064] The above results show that the base deletion type at the Indel site is an excellent genotype of the gene ZmGAD related to the GABA content in the maize root system, and the molecular marker ZmGAD-INDEL10842 is of great significance for accelerating the breeding of new maize varieties with stress resistance. Indel molecular markers play an important role in genetic research, breeding improvement and resistance analysis of crops such as maize. By detecting insertion or deletion variations, Indel markers can effectively evaluate genetic diversity, help identify differences between different genotypes, and reveal the process of crop evolution and domestication. At the same time, Indel markers are widely used in gene mapping and marker-assisted selection (MAS), which accelerates the screening and breeding process of disease resistance and stress resistance traits. In addition, the application of Indel markers in population structure analysis and variety identification makes the management and protection of germplasm resources more precise and ensures the maintenance of genetic diversity. In functional gene research, Indel variation helps to reveal the relationship between genes and phenotypes, especially in the regulation of key traits such as GABA metabolism. The application of Indel markers in genome editing technology provides new possibilities for the precise and targeted improvement of crops. Therefore, Indel markers, as a key molecular tool, have promoted the improvement of corn breeding efficiency and the development of resistance improvement, laying a solid foundation for the sustainable development of modern agriculture.

[0065] SEQ ID NO.1: (wherein, the first exon region is 1-86, the second exon region is 87-291, the third exon region is 292-492, the fourth exon region is 493-707, the fifth exon region is 708-961, the sixth exon region is 962-1014, and the seventh exon region is 1015-1482)

[0066]

[0067] SEQ ID NO.2:

[0068] MVLSHGVGGSDESVHSTFASRYVRTSLPRYRMPEQSIPKEAAYQIINDELMLDGNPRLNLASFVTTWMEPECDKLIQASVNKNYVDMDEYPVTTELQNRCVNMIAHLFNAPLGDAETAVGVGTVGSSEAIMLAGLAFKRRWQNKMKAAGKPCDKPNIVTGANVQVCWEKFARYFEVELKEVKLSDGYYVMDPQKAVDMVDENTICVAAILGSTLNGEFEDVKLLNDLLTKKNAETGWDTPIHVDAASGGFIAPFLYPELEWDFRLPLVKSINVSGHKYGLVYAGIGWCIWRTKVDLPEELIFHINYLGADQPTFTLNFSKGSSQVIAQYYQLIRLGFEGYKNIMENCQENATVLKQGLEKTGKFNIVSKDNGVPLVAFSLKDSSRHSEFEISDFLRRFGWIVPAYTMPPDAQHVTVLRVVIREDFSRTLAERLVLDIEKVLHELDALPARVPSGDLAALAAAESSEREMEKQRQVISLWKRAVLAKKKTNGVC*.

Claims

1. Application of maize ZmGAD gene in regulating maize root growth, characterized in that: The nucleotide sequence of the maize ZmGAD gene is shown in SEQ ID NO.1; or is generated by adding, replacing or deleting one or several bases from the nucleotide sequence shown in SEQ ID NO.1, and encodes a nucleotide sequence that controls the maize ZmGAD protein.

2. The use according to claim 1, characterized in that: The maize ZmGAD gene is as follows (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID No. 2; (b) A protein derived from SEQ ID No. 2 by substitution and / or addition and / or deletion of one or more amino acid residues in the sequence shown in SEQ ID No.

2.

3. The use according to claim 1, characterized in that: The method for regulating the growth of corn root system includes regulating the root length, L-glutamic acid content and GABA content of the corn root.

4. A method for promoting root growth of corn, characterized in that: The CDS sequence of the maize ZmGAD gene is constructed into a plant expression vector and transformed into a target plant to obtain a positive overexpression transgenic maize; the transgenic maize has a higher yield than the target plant, and the nucleotide sequence of the maize ZmGAD gene is shown in SEQ ID NO.

1.

5. The method for promoting root growth of corn according to claim 4, characterized in that: The method for promoting the growth of corn root system comprises increasing the root length and GABA content of corn and reducing the L-glutamic acid content of the root.

6. A molecular marker associated with GABA content in maize roots, characterized in that: The sequence of the molecular marker is shown in SEQ ID NO.

1. The polymorphism at position 628 of SEQ ID NO.1 is deletion or CT. The insertion / deletion is located in the 4th exon region of the ZmGAD gene.

7. The molecular marker associated with GABA content in maize roots according to claim 6, characterized in that: In the Indel site of the molecular marker, the GABA content in the corn root system of the base-deficient type is higher than that of the inserted type base.

8. The molecular marker primers related to the GABA content in corn roots according to claim 6, characterized in that: The sequences of the primers are as follows: ZmGAD-INDEL10842-Fg: 5'-GAAGGTGACCAAGTTCATGCTTCGCGGCCATCCTCG-3'; ZmGAD-INDEL10842-Ft: 5'-GAAGGTCGGAGTCAACGGATTTGTGGCGGCCATCCTCT-3'; ZmGAD-INDEL10842-R: 5'-TCCTCGAACTCGCCGTTC-3.

9. Use of the molecular marker related to the GABA content in maize roots according to claim 6 or 7 or the primer according to claim 8 in identifying the GABA content in maize roots and cultivating maize varieties with developed root systems.

10. A method for cultivating corn varieties with developed root systems, characterized in that: The following steps are involved: The DNA of the tested corn variety is subjected to PCR amplification to obtain a PCR product, the primers described in claim 8 are used as amplification primers, and after the amplification is completed, the fluorescent signal is read to obtain the genotype result; and corn plants with genotype deletion are selected for breeding.

Images