Primer probe set and kit for mycoplasma pneumoniae nucleic acid detection and application of primer probe set and kit in extraction-free direct mycoplasma pneumoniae detection method

Abstract

The invention discloses a primer probe set and a kit for mycoplasma pneumoniae nucleic acid detection and application of the primer probe set and the kit in a method for directly detecting mycoplasma pneumoniae without extraction, and belongs to the technical field of molecular biology detection. Comprising an upstream primer MP-F as shown in SEQ ID NO: 1, a downstream primer MP-R as shown in SEQ ID NO: 2 and a probe MP-P as shown in SEQ ID NO: 3. The mycoplasma pneumoniae type I and the mycoplasma pneumoniae type II can be efficiently and specifically detected, a fluorescent quantitative PCR detection method can be adopted, PCR detection can be directly carried out without nucleic acid extraction, the detection cost is reduced, the test operation is simplified, the detection time is shortened, meanwhile, high specificity and accuracy are guaranteed, the sensitivity is improved, and the detection cost is reduced. The kit can be used for detecting mycoplasma pneumoniae nucleic acid in a human throat swab.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological detection, and specifically relates to a primer probe group and a kit for detecting Mycoplasma pneumoniae nucleic acid, and an application thereof in a method for directly detecting Mycoplasma pneumoniae without extraction. Background Art

[0002] Mycoplasma pneumoniae pneumonia is a polar lung infection caused by Mycoplasma pneumoniae (MP), which is mainly caused by interstitial lesions. Sometimes it is complicated by bronchopneumonia, which is called primary atypical pneumonia. It is mainly transmitted through droplets and can occur all year round. It is generally believed that MP infection is higher in the cold season in the northern region, while it is more common in the summer and autumn in the southern region, and it is most common in children and adolescents. The infection can occur in the upper and lower respiratory tracts and lungs, and can also affect the extrapulmonary system. In the early stage, non-specific symptoms such as fever, abnormal breathing, cough, headache, and sore throat appear, which is difficult to diagnose. Severe cases can cause multiple organ damage and threaten the life safety of children. Mycoplasma pneumoniae belongs to the class of Mollicutes, the family of Mycoplasma, and the genus Mycoplasma. It is a prokaryotic organism that has been discovered so far that has the ability to survive in vitro without relying on living cells and can replicate itself. Mycoplasma pneumoniae is 1 to 2 μm long and 0.1 to 0.2 μm wide. Due to its small size, it can pass through bacterial filters. Its genome is a circular double-stranded DNA with a relative molecular mass of 5×108 and a total length of 816394bp. Currently, the main laboratory diagnostic methods include virus isolation and culture, serological testing, and nucleic acid amplification technology.

[0003] Mycoplasma pneumoniae is the main pathogen of community-acquired pneumonia in children and adolescents, and its infection rate has been increasing year by year in pediatrics. In 2013, the World Health Organization (WHO) announced the top ten deadly diseases in the world, pneumonia was among them, and about 3.5 million people died of pneumonia each year. In endemic periodic epidemics, pneumonia caused by Mycoplasma pneumoniae accounted for 4% to 8%. During the pandemic, community-acquired bacterial pneumonia caused by Mycoplasma pneumoniae accounted for 20% to 40% in the general population, and up to 70% in densely populated areas. Therefore, understanding the epidemiological characteristics of Mycoplasma pneumoniae is of great significance for prevention and clinical diagnosis.

[0004] The current nucleic acid detection methods for Mycoplasma pneumoniae are all designed with primer probe sets for the cell adhesion protein (P1) gene of Mycoplasma pneumoniae (MP) strains. The P1 gene is 9673bp in length, including several single-copy regions and several multi-copy regions. The primer probe sets designed for different copy regions will affect their amplification efficiency and detection efficiency, thereby affecting the sensitivity and coverage of the test results. For example: Chinese patent CN114107529A discloses a Mycoplasma pneumoniae nucleic acid detection kit, which includes a specific primer and probe combination of the Mycoplasma pneumoniae P1 gene, a primer and probe combination of a human internal reference gene, and through a dual real-time fluorescent PCR reaction, the specificity and accuracy of the test results are guaranteed to a great extent, and both Mycoplasma pneumoniae type I and type II can be detected, and the detection coverage is wide. At the same time, based on the premise of effective amplification of the human internal reference gene, false negative results can be effectively avoided, which not only guarantees the specificity of the detection, but also guarantees the accuracy of the detection. However, by performing BLAST analysis on the primers in NCBI, it can be seen that the primer probe group is designed for the single copy region of the P1 gene, and its sensitivity for low-concentration detection samples needs to be improved.

[0005] Chinese patent CN109735640A discloses a primer set and a kit for rapid detection of Mycoplasma pneumoniae, including upstream and downstream primers and probes for detecting the P1 gene sequence of the Mycoplasma pneumoniae genome. By performing BLAST analysis on the primers in NCBI, it can be seen that although the primer set is designed for the multi-copy region of the P1 gene, the selected multi-copy gene has mutations, which will affect the amplification efficiency of the primer set and also affect the coverage. Therefore, in this patent, it is recorded that FAM and BHQ1 are marked inside the sequence. If there is a mutation in the sample target sequence, the annealing of the fluorescent probe and the target sequence and the generation and release of the fluorescent signal can be guaranteed, thereby increasing the sensitivity and specificity of the detection. At the same time, this patent does not record whether both Mycoplasma pneumoniae type I and type II can be detected, and the breadth of detection coverage remains to be verified. Summary of the invention

[0006] The purpose of the present invention is to provide a primer probe set for detecting nucleic acid of Mycoplasma pneumoniae, which is a specific primer probe set designed for the P1 gene of Mycoplasma pneumoniae, and can efficiently and specifically detect Mycoplasma pneumoniae type I and type II. At the same time, the present invention also provides a kit containing the specific primer probe set, and the application of the primer probe set and the kit in the method of directly detecting Mycoplasma pneumoniae without extraction, adopting the fluorescent quantitative PCR inspection method, PCR detection can be directly performed without nucleic acid extraction, while reducing the detection cost, simplifying the experimental operation, shortening the detection time, ensuring high specificity and accuracy, and improving the sensitivity, which can be used for Mycoplasma pneumoniae nucleic acid detection in human pharyngeal swabs.

[0007] The present invention is achieved through the following technical solutions: A primer probe set for detecting Mycoplasma pneumoniae nucleic acid, wherein the primer probe set is designed in the multi-copy region of the Mycoplasma pneumoniae P1 gene, and comprises an upstream primer MP-F as shown in SEQ ID NO: 1, a downstream primer MP-R as shown in SEQ ID NO: 2, and a probe MP-P as shown in SEQ ID NO: 3.

[0008] The primer probe set of the present invention is used to directly detect the Mycoplasma pneumoniae P1 gene, and its sequence information is specifically as follows: MP-F:TCTTTACGCGTTACGTATTC; MP-R: AGTGTGGAATTCTCTGGCA; MP-P: TTCACTGGTATAACCGGTTTGTTAAG.

[0009] It also includes an internal standard primer probe set QS, which includes an upstream primer IAC-F as shown in SEQ ID NO:4, a downstream primer IAC-R as shown in SEQ ID NO:5, and a probe IAC-P as shown in SEQ ID NO:6.

[0010] The internal standard primer probe set QS of the present invention is used to monitor the entire PCR amplification reaction, and its sequence information is specifically: IAC-F:ACTTCCCTTGCCTACATTGTT; IAC-R: TGATGCGGTTATGAGTACGA; IAC-P: CCATCGACCAGAGGCTGTTCACC.

[0011] In the present invention, the internal standard primer probe is used to detect the QS gene, which has no correlation with the human genome and respiratory pathogen genes. The detection of this gene is used to verify whether the entire amplification system is normal. If the test result is negative, it means that there is a problem in the amplification process, that is, the negative result of the Mycoplasma pneumoniae test may also be a false negative result.

[0012] As an optional method, in the above primer probe set, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group, and the probes for different target genes are respectively labeled with different fluorescent groups. It is convenient to use different fluorescent channels for detection. Furthermore, the fluorescent group can be selected from FAM and VIC; the quenching group is selected from BHQ1, and the excitation and emission bands of the group are relatively separated and can be detected separately in one system.

[0013] As an alternative, the probe MG-P of the present invention is labeled with FAM, and the probe IAC-P is labeled with VIC.

[0014] A kit for detecting nucleic acid of Mycoplasma pneumoniae comprises the above-mentioned primer probe set for directly detecting the P1 gene of Mycoplasma pneumoniae and an internal standard primer probe set QS for monitoring the entire PCR amplification reaction.

[0015] The kit also includes a PCR Mix for PCR amplification detection, which contains a genetically modified antibody-based hot-start Taq enzyme (D-Taq DNA polymerase), UDG enzyme, dNTP (deoxyribonucleoside triphosphate), magnesium ions, sodium chloride and Tris (tris(hydroxymethyl)aminomethane).

[0016] Furthermore, the kit also includes a negative control and a positive control.

[0017] As an optional method, the negative control is a pseudovirus containing an internal standard QS gene fragment. The pseudovirus does not include Mycoplasma pneumoniae and other respiratory infection pathogens, human genome sequences or similar sequences. It can be used to independently perform quality control on each amplification reaction to check whether the quality control kit itself and the experimental operation are normal, so as to exclude false negatives caused by kit failure or individual sample sampling and operation errors.

[0018] As an alternative, the positive control is a pseudovirus containing a fragment of the Mycoplasma pneumoniae detection gene.

[0019] For example, the use of the above-mentioned primer probe set or kit in a method for direct detection of Mycoplasma pneumoniae without extraction, using an oral pharyngeal swab as a test sample, the test sample does not need to be extracted and purified for nucleic acid, and the Mycoplasma pneumoniae nucleic acid concentration in the test sample can be detected by a fluorescent quantitative PCR detection method.

[0020] The fluorescent quantitative PCR (Flurogenic Quantitative Polymerase Chain Reaction, FQ-PCR) detection method referred to in the present invention is also called real-time quantitative PCR (real-time quantitative PCR, RT-qPCR) or quantitative PCR (qPCR). It is a quantitative test technology launched by Applied Biosystems of the United States. It uses fluorescent dyes or fluorescently labeled specific probes to mark and track PCR products to monitor the reaction in real time, obtain amplification curves, analyze the products using corresponding software, and calculate the initial concentration of the nucleic acid template of the sample to be tested.

[0021] The Ct (Cycle-threshold) value can be obtained according to the fluorescence quantitative PCR amplification curve as follows: a. Description of the characteristics of the amplification curve: The amplification curve is generally S-shaped and can be divided into a baseline phase, an exponential growth phase, a linear growth phase, and a plateau phase.

[0022] b. Baseline setting: According to the experimental situation, select a region with relatively stable fluorescence background value as the baseline setting range. It is recommended to select 5 to 22 cycles for the baseline.

[0023] c. Threshold setting: A value of ΔRn (corrected reporter fluorescence intensity), automatically determined by the software or manually set, used to determine the Ct value in experimental analysis. The threshold setting should be higher than the baseline and controlled within the exponential growth phase of the amplification curve, generally exceeding the highest point of the negative control amplification curve.

[0024] d. Ct value (Cycle-threshold): The intersection of the threshold line and the amplification curve determines the Ct value.

[0025] As an optional method, the above-mentioned method for directly detecting Mycoplasma pneumoniae without extraction specifically comprises the following steps: (1) Sample processing; (2) Preparation of reagents; (3) Add sample; (4) PCR amplification; (5) Result analysis

[0026] As an optional method, step (1) is specifically as follows: add 1 mL of physiological saline (enzyme-free sterile water) to the swab sample, let it stand for 5 minutes to allow the swab head to be fully soaked, vortex and shake for 2 minutes to allow the pathogens and cells on the swab to fully fall off into the liquid, and use it as the sample to be tested after instant centrifugation. If the sample is not tested immediately after processing, it can be stored at -70°C for future use to avoid repeated freezing and thawing.

[0027] As an optional method, step (2) is specifically as follows: thaw the primer-probe set mixture in the kit at room temperature, shake and mix, and centrifuge briefly for use; thaw the nucleic acid amplification reaction solution at room temperature, shake and mix, and centrifuge briefly for use; prepare the reaction solution according to the number of samples to be tested in accordance with Table 1 below, and set a negative control and a positive control for each test. When the number of samples to be tested is n, the number of reaction systems to be prepared is N = the number of samples to be tested (n) + positive control (1) + negative control (1) + 1.

[0028] Table 1 Reaction system preparation table ; After mixing the prepared amplification reaction system, dispense it into PCR reaction tubes at a rate of 20 μl / reaction for later use.

[0029] As an optional method, step (3) is specifically as follows: add 5 μl of negative control, sample to be tested and positive control to the aliquoted system, respectively, and the total reaction volume is 25 μl. Cover the PCR reaction tube tightly, centrifuge briefly at low speed and set aside.

[0030] As an optional method, step (4) is specifically as follows: put the PCR tubes into the sample slot of the real-time fluorescence quantitative PCR instrument in order, and set the sample types such as the sample to be tested, negative control, positive control, etc. in order, and set the sample name at the same time. Select the corresponding fluorescence channel to detect the target gene.

[0031] As an optional method, step (5) is specifically as follows: automatically save the results after the reaction is completed, analyze the amplification curves of the detection target and the internal standard respectively. According to the analyzed image, adjust the Start value, End value and Threshold value of the Baseline (taking ABI 7500 as an example, the user can adjust it according to the actual situation. The Start value can be set between 3 and 15, and the End value can be set between 5 and 20 to ensure that the baseline area of ​​all amplification curves is flat; the threshold line height of various fluorescence channels is set to △Rn=6000), click Analyze for analysis, and then record the qualitative results in the Plate window.

[0032] As an optional manner, the above method may further include step (6) quality control: judging the effectiveness of the experiment based on the Ct value and amplification curve shape corresponding to the detection results of each fluorescent channel.

[0033] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) The primer probe set for detecting the Mycoplasma pneumoniae P1 gene proposed in the present invention is selected in the conservative region of the gene, and there is no problem of gene mutation. It can improve the primer amplification efficiency and has a wide detection coverage. It can detect both Mycoplasma pneumoniae type I and type II. At the same time, the primer probe set avoids the formation of hairpin structure, primer internal dimer, primer inter-dimer and mismatch as much as possible, and can avoid non-specific binding with other viruses or human genes.

[0034] (2) The primer probe set of the present invention is simultaneously selected in the multi-copy region of the Mycoplasma pneumoniae P1 gene, which can improve the detection sensitivity and achieve accurate detection of low-concentration samples.

[0035] (3) Existing PCR detection methods all require nucleic acid extraction from clinical samples. This method improves on this by directly performing PCR amplification detection without the need for extraction, thereby reducing detection costs, shortening test time, simplifying operation steps, and ensuring specificity and accuracy while improving sensitivity.

[0036] (4) The present invention can use human pharyngeal swabs as test samples, and can directly perform PCR amplification detection without nucleic acid extraction, thereby realizing direct detection of the Mycoplasma pneumoniae nucleic acid concentration in human pharyngeal swabs. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The amplification curves of Example 1, Comparative Example 1 and Comparative Example 2 for Mycoplasma pneumoniae.

[0038] Figure 2 is the internal standard amplification curve.

[0039] Figure 3 This is the amplification curve of Mycoplasma pneumoniae and internal standard in the dual system (sample No. W-014-2).

[0040] Figure 4 This is the amplification curve of Mycoplasma pneumoniae and internal standard in the dual system (sample No. W-015-1).

[0041] Figure 5 This is the amplification curve of Mycoplasma pneumoniae and internal standard in the dual system (sample No. W-018-1).

[0042] Figure 6 This is the amplification curve of Mycoplasma pneumoniae and internal standard in the dual system (sample No. W-022-4).

[0043] Figure 7 This is the amplification curve of Mycoplasma pneumoniae and internal standard in the dual system (sample No. W-028-2).

[0044] Figure 8 This is the amplification curve of Mycoplasma pneumoniae and internal standard in the dual system (sample No. W-032-5).

[0045] Fig. 9 This is the amplification curve of the Mycoplasma pneumoniae nucleic acid detection kit for direct detection of samples.

[0046] Fig.10 This is the amplification curve after the sample is extracted by the existing extraction kit. DETAILED DESCRIPTION

[0047] The invention objectives, technical solutions and beneficial effects of the present invention are further described in detail below.

[0048] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the claimed invention, and unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0049] The present invention is a specific primer and probe designed for the repetitive sequence region of the Mycoplasma pneumoniae P1 gene, covering its two genotypes, namely Mycoplasma pneumoniae type I and Mycoplasma pneumoniae type II, and screening and optimizing nucleic acid amplification reaction liquid. Through real-time fluorescence quantitative PCR technology, the concentration of Mycoplasma pneumoniae nucleic acid DNA in human pharyngeal swabs can be directly detected in vitro by qualitative detection.

[0050] The technical points of the present invention can be summarized as follows: (1) Specific primers and probes are designed for the repetitive sequence region of the P1 gene. Therefore, they can improve the efficiency of primer amplification, have a wide detection coverage (both Mycoplasma pneumoniae type I and type II can be detected), have high detection sensitivity, and can achieve accurate detection of low-concentration samples.

[0051] (2) The kit containing the specific primers and probes can be used for in vitro qualitative direct detection of Mycoplasma pneumoniae nucleic acid DNA in human pharyngeal swabs, thereby ensuring specificity and accuracy while improving sensitivity.

[0052] (3) The use of real-time fluorescence quantitative PCR technology can reduce detection costs, shorten test time, and simplify operation steps.

[0053] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto.

[0054] 1) Sample type: The samples tested in the following examples are from human pharyngeal swabs.

[0055] 2) Sample collection: Collect samples according to the reproductive tract specimen collection method in the "Guidelines for Clinical Nursing Practice".

[0056] 3) Sample storage and transportation: Samples to be tested can be processed immediately. Samples tested within 24 hours can be stored at 4°C. Samples that cannot be tested within 24 hours should be stored at -70°C or below (if -70°C storage conditions are not available, samples to be tested can be stored at -20°C for 30 days, and nucleic acid samples can be stored at -20±5°C for 30 days). Repeated freezing and thawing should be avoided. Samples should be transported in iced ice bottles or sealed foam boxes.

[0057] It should be noted that the conserved gene region described in the present invention refers to a gene molecular sequence region with high similarity or identity; the multi-copy region refers to a region with multiple identical or highly similar gene sequences; the single-copy region refers to a sequence region with only one gene; and the repetitive sequence region refers to a sequence region that appears repeatedly in the genome.

[0058] Example 1: Preparation of Reagents The following sequences were synthesized using a DNA synthesizer via the solid phase phosphoramidite triester method: Primer probe set A for Mycoplasma pneumoniae: contains MP-F, MP-R, and MP-P. For sequence information, see SEQ ID NO: 1 to SEQ ID NO: 3; Internal standard primer probe set QS: contains IAC-F, IAC-R, IAC-P, sequence information see SEQ ID NO: 4 to SEQ ID NO: 6; The probe MP-P was labeled with FAM, and the probe IAC-P was labeled with VIC; Positive control: pseudovirus containing the gene sequence of Mycoplasma pneumoniae; Negative control: pseudo-disease containing internal standard gene sequence; Reaction Buffer: containing antibody method hot-start Taq enzyme (D-Taq DNA polymerase), UDG enzyme, dNTP, magnesium ions, sodium chloride, and Tris: purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0059] Comparative Example 1: This comparative example designs a primer probe set B for Mycoplasma pneumoniae for the single copy region of the Mycoplasma pneumoniae P1 gene, as follows: Upstream primer F1: CTTTAAACCTGATCAAGATACCCAA, sequence information see SEQ ID NO: 7; Downstream primer R1: CAACACGTAATCAGGTCACT, sequence information see SEQ ID NO: 8; Probe P1: ACAACAACGTTCAGGTCAATCCGAAT, sequence information see SEQ ID NO: 9.

[0060] The internal standard primer probe set, fluorescent marker and other reagents used in this comparative example are the same as those in Example 1.

[0061] Comparative Example 2: This comparative example designs a primer probe set C for Mycoplasma pneumoniae for the multi-copy region of the Mycoplasma pneumoniae P1 gene, as follows: Upstream primer F2: ATTGAYCGCGTTGATCACT, sequence information see SEQ ID NO: 10; Downstream primer R2: TTTCAGTCCCACAAACCGT, sequence information see SEQ ID NO: 11; Probe P2: CGCCCAGTTGAAGAACGCCCAA, sequence information see SEQ ID NO: 12.

[0062] The internal standard primer probe set, fluorescent marker and other reagents used in this comparative example are the same as those in Example 1.

[0063] Example 2: Primer-probe single-plex verification The primers and probes of Mycoplasma pneumoniae and the internal standard gene in Example 1, Comparative Example 1 and Comparative Example 2 were respectively prepared with PCR reaction solution to prepare amplification reaction solution (the final concentration of each upstream and downstream primer was 50-500nM, and the final concentration of the probe was 25-250nM). Mycoplasma pneumoniae and the internal standard pseudovirus were respectively added as templates to the nucleic acid amplification reaction solution, and the final volume was 25μl. The PCR tube was placed in a real-time fluorescence quantitative PCR instrument, and PCR amplification was performed according to the following program: 50℃ 2min, 95℃ 2min, 95℃ 15sec, 55℃ 34sec, 45cycles. The experimental results are shown in FIG. Figure 1 , Figure 2 And as shown in Table 2.

[0064] Table 2 Amplification results of Mycoplasma pneumoniae and internal standard ; Depend on Figure 1 , Figure 2 As can be seen from Table 2, when Example 1, Comparative Example 1, Comparative Example 2 and the internal standard solution amplified Mycoplasma pneumoniae and the internal standard pseudovirus, the amplification curves were all "S-shaped", and the 10-fold gradient dilution Ct values ​​were evenly spaced; and there were no significant differences in the linearity, fluorescence increment and Ct value of Example 1, Comparative Example 1 and Comparative Example 2, and they can all be combined with the internal standard solution to perform double sample verification. At the same time, the primer probe single verification of Example 1, Comparative Example 1 and Comparative Example 2 can show that when amplifying Mycoplasma pneumoniae pseudovirus, there are no significant differences in Example 1, Comparative Example 1 and Comparative Example 2, and they can be combined with the internal standard solution to perform double and use clinical samples for verification.

[0065] Example 3: Dual Primer Probe Set Mixing The two primer probes in Example 1, Comparative Example 1 and Comparative Example 2 were respectively combined into corresponding double systems to amplify different concentrations of Mycoplasma pneumoniae. The results are as follows: Figures 3 to 8 , as shown in Table 3.

[0066] Table 3 Duplex system amplification results ; Depend on Figures 3 to 8 As shown in Table 3, the Ct value of the amplification curve of Example 1 for detecting 6 Mycoplasma pneumoniae samples is the smallest, the Ct value of the amplification curve of Comparative Example 2 differs from that of Example 1 by 0.22 to 1.74, and the Ct value of Comparative Example 1 differs from that of Example 1 by 1.2 to 2.79. At the same time, the experiment of amplifying Mycoplasma pneumoniae samples by the dual system composed of primers and probes in Example 1, Comparative Example 1 and Comparative Example 2 shows that when detecting Mycoplasma pneumoniae samples, Example 1 is significantly better than Comparative Example 2 and Comparative Example 1, so Example 1 is selected as the scheme of this kit for Mycoplasma pneumoniae nucleic acid detection.

[0067] Example 4: Mycoplasma pneumoniae nucleic acid detection kit Prepare the relevant reagents of the nucleic acid detection kit according to Table 4 below.

[0068] Table 4 Reagent configuration table ; The specific steps for testing using the above nucleic acid detection kit are as follows: (1) Sample processing (conducted in the sample processing area) Add 1 mL of saline (enzyme-free sterile water) to the swab sample, let it stand for 2 minutes to allow the swab head to be fully soaked, vortex it thoroughly to allow the pathogens and cells on the swab to fall off into the liquid, and then centrifuge it instantly as the sample to be tested.

[0069] (2) Reagent preparation (performed in the reagent preparation area) Take out the nucleic acid amplification reaction solution and primer probe mixture from the kit, thaw at room temperature, shake and mix, and centrifuge briefly for later use. Prepare the reaction solution according to the number of samples to be tested according to Table 5 below. It is recommended to set up negative and positive controls for each test. When the number of samples to be tested is n, the number of reaction systems to be prepared is N = number of samples to be tested (n) + positive control (1) + negative control (1) + 1.

[0070] Table 5 Reaction system preparation table ; After mixing the prepared reaction system, dispense 20 μl into PCR reaction tubes and transfer to the sample processing area.

[0071] (3) Sample addition (performed in the sample processing area) Add 5 μl of negative control, sample to be tested and positive control to the aliquoted reaction system, and the total reaction volume is 25 μl. Cover the reaction tube tightly, centrifuge at low speed, and transfer to the detection area.

[0072] (4) PCR amplification (performed in the amplification and analysis area) The PCR amplification procedure is as follows: 50℃ 2min, 95℃ 2min, 95℃ 15sec, 55℃ 34sec 45cycles, Place the PCR tubes in the sample slot of the thermal amplification instrument in order, and set the sample types such as positive control, negative control, and sample to be tested in turn, and set the sample names at the same time. Select the FAM channel to detect Mycoplasma pneumoniae and the VIC channel to detect the internal standard gene. In the ABI 7500 instrument, both "Quencher Dye" and "Passive Reference" are set to None.

[0073] (5) Results analysis After the reaction is completed, the results are automatically saved, and the amplification curves of the detection target and the internal standard are analyzed separately. According to the analyzed image, adjust the Start value, End value and Threshold value of the Baseline (taking ABI 7500 as an example, the user can adjust it according to the actual situation. The Start value can be set between 3 and 15, and the End value can be set between 5 and 20 to ensure that the baseline area of ​​all amplification curves is flat; the threshold line height of the four fluorescence channels is set to △Rn=6000), click Analyze for analysis, and then record the qualitative results in the Plate window.

[0074] (6) Quality control (determination of experimental effectiveness) Each reference substance in the kit must meet the requirements of Table 6 below, otherwise the experiment will be considered invalid.

[0075] Table 6 Requirements for reference substances in the test kit ; Positive judgment value: Through research, it was determined that the Ct reference value of this kit for detecting the target gene is 40.

[0076] The test results based on the above nucleic acid detection kit are explained as shown in Table 7 below.

[0077] Table 7 Interpretation of test results of the kit ; Example 5: Clinical sample testing The Mycoplasma pneumoniae nucleic acid detection kit of Example 4 was used to perform direct detection and nucleic acid extraction detection (using the viral genome DNA / RNA extraction kit of Tiangen Biotechnology (Beijing) Co., Ltd.) on 18 collected Mycoplasma pneumoniae clinical samples for comparative verification. The test results are as follows: Fig. 9 , Fig.10 and as shown in Table 8.

[0078] Table 8 Results of direct and post-extraction testing of 18 clinical samples of Mycoplasma pneumoniae ; according to Fig. 9 , Fig.10As shown in the test results of Table 8 above, it can be seen that the test results of 18 clinical oropharyngeal swab samples of Mycoplasma pneumoniae were consistent without extraction and after extraction with the viral DNA / RNA extraction kit of Tiangen Biotechnology (Beijing) Co., Ltd., among which the difference in the Ct values ​​of the amplification curves of 8 Mycoplasma pneumoniae positive samples was within 1, and the Ct value of the amplification result of 1 clinical positive Mycoplasma pneumoniae sample without extraction was 1 less than the Ct value of the amplification result after extraction with Tiangen extraction reagent, and the test results of the remaining 9 negative samples were all negative, and the internal standard amplification curves were not inhibited. Therefore, clinical oropharyngeal swab samples of Mycoplasma pneumoniae can be directly tested on the machine without extraction.

[0079] Example 6: Comparison with reagents from other manufacturers The nucleic acid detection kit and method of Example 2 were used to detect 60 clinical samples respectively, together with the Mycoplasma pneumoniae nucleic acid detection kit (PCR-fluorescent probe method) (with its own extraction reagent) that has been registered and approved for marketing. The test results are shown in Table 9 below.

[0080] Table 9 Clinical sample testing results

[0081] Using the Mycoplasma pneumoniae reagents of other manufacturers that have been approved for marketing as reference reagents, the negative compliance rate, positive compliance rate and total compliance rate of the reagent of the present invention were evaluated. The results are shown in Table 10 below.

[0082] Table 10 Compliance analysis results ; Positive compliance rate = 20 / (20+0) ×100%=100%; Negative compliance rate = 40 / (0+40) ×100%=100%; Total compliance rate = (20+40) / (20+0+ 0+40)×100%=100%; From the analysis of the experimental results, it can be seen that the Mycoplasma pneumoniae nucleic acid detection kit (PCR fluorescent probe method) of the present invention and the Mycoplasma pneumoniae nucleic acid detection kit (PCR-fluorescent probe method) that has been approved for marketing have a positive and negative consistency rate of 100% in detecting 60 clinical samples, proving that the Mycoplasma pneumoniae nucleic acid detection reagent of the present invention has good accuracy in directly detecting clinical samples without extraction, and the method is feasible.

[0083] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any simple modification or equivalent change made to the above embodiment based on the technical essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A primer probe set for detecting Mycoplasma pneumoniae nucleic acid, characterized in that: The primer probe set is designed in the multi-copy region of the Mycoplasma pneumoniae P1 gene, including an upstream primer MP-F as shown in SEQ ID NO: 1, a downstream primer MP-R as shown in SEQ ID NO: 2, and a probe MP-P as shown in SEQ ID NO:

3.

2. The primer probe set for detecting Mycoplasma pneumoniae nucleic acid according to claim 1, characterized in that: It also includes an internal standard primer probe set QS, which includes an upstream primer IAC-F as shown in SEQ ID NO:4, a downstream primer IAC-R as shown in SEQ ID NO:5, and a probe IAC-P as shown in SEQ ID NO:

6.

3. A kit for detecting Mycoplasma pneumoniae nucleic acid, characterized in that: It comprises the primer probe set as claimed in claim 1, and the internal standard primer probe set QS as claimed in claim 2.

4. The kit for detecting Mycoplasma pneumoniae nucleic acid according to claim 3, characterized in that: Also included are Taq enzyme, UDG enzyme, dNTPs, magnesium ions, sodium chloride and Tris.

5. Use of the primer probe set or kit according to any one of claims 1 to 4 in a method for direct detection of Mycoplasma pneumoniae without extraction, characterized in that: Human pharyngeal swabs were used as test samples, and the fluorescence quantitative PCR detection method was used to detect the concentration of Mycoplasma pneumoniae nucleic acid in the test samples.

Images