Application of targeted Schwann cell lactic acid transport in preparation of medicine for treating gastric cancer and research on treatment method

Abstract

According to the invention, case samples are analyzed through immunofluorescence and immunohistochemistry, and the clinical correlation of co-localization of lactic acid and Schwann cells and lactic dehydrogenase and subtypes thereof in gastric cancer samples is determined clinically; the invention finds that the Schwann cell conditioned medium can promote gastric cancer lactylation, proliferation and migration by secreting lactic acid; shRNA is adopted to inhibit lactic acid transport of Schwann cells, so that gastric cancer lactylation, proliferation and migration can be inhibited; the invention discovers that the Schwann cell conditioned medium promotes the expression of gastric cancer cell lactic acid transporters MCT1 and MCT4; through RNA sequencing and western blot, it is found that the Schwann cell conditioned medium promotes gastric cancer lactylation and finally promotes GluT1 expression. The invention researches the influence of Schwann cells on the growth of gastric cancer cells, and finds that lactic acid secreted by the Schwann cells can obviously promote the lactic acid acidification of the gastric cancer H3K9 site, and further promotes the proliferation and migration of the gastric cancer cells by increasing the expression of gastric cancer GluT1, which may indicate the key mechanism of the relationship between the cancer cells and tricarboxylic acid cycle.

Description

Technical Field

[0001] The present invention relates to application of targeting Schwann cells to promote lactic acidification in treating gastric cancer and research on treatment methods. Background Art

[0002] Gastric cancer is one of the most common malignant tumors of the digestive system in my country and the third most common cancer in my country. Gastric cancer originates from the gastric mucosal epithelium and gradually invades the entire stomach through the proliferation and migration of cancer cells. Because its symptoms are similar to those of chronic gastritis and there are no obvious signs and symptoms in the early stage, it is easy to be misdiagnosed and missed, causing patients to miss the best treatment time. Although chemotherapy, targeted therapy, immunotherapy and other treatment methods are used clinically to treat or inhibit the progression of gastric cancer, surgical treatment is the only possible way to cure gastric cancer clinically. And although the application of gastroscopy and pathological tissue biopsy has improved the screening accuracy of early gastric cancer, the early screening rate of gastric cancer is still low. Therefore, in order to improve the early screening rate and survival rate of gastric cancer patients, it is necessary to find new targets and molecular mechanisms to transform them into effective treatment methods.

[0003] Lactate is an important regulator of systemic metabolic coordination. Its production mainly depends on glycolysis. When hypoxia inhibits the tricarboxylic acid cycle, the glycolysis pathway is activated to compensate for the lack of ATP production. In the 1920s, Otto Warburg discovered that tumors consume more glucose than surrounding normal tissues and proposed the phenomenon of aerobic glycolysis. He found that even in the presence of oxygen, glucose prefers to produce lactate through glycolysis. The enhancement of lactate dehydrogenase A and pyruvate and the increase in lactate production in gastric cancer also prove this. Zhao et al. used high-performance liquid chromatography-tandem mass spectrometry to detect the human MCF-7 cell line and found that the mass shift on the lysine residues of three lysine hydrolyzed peptides was the same as the mass shift of a lactic acid group added to the ε-amino group of lysine, thus proving the existence of lactylation modification. Many subsequent studies have demonstrated that lactylation modification can promote the progression of ocular melanoma by directly upregulating oncogene expression, and can also lead to tumor immunosuppression and immune escape by maintaining tumor-associated macrophage homeostasis or inhibiting the function of immune cells in the tumor microenvironment. However, it is still unclear what type of cells secrete lactate and whether lactylation is involved in regulating the progression of gastric cancer.

[0004] Schwann cells are the main glial cells in the peripheral nervous system. Their main function is to wrap axons and produce myelin so that nerve impulses can be quickly transmitted. The promoting role of Schwann cells in cancer has also received widespread attention. It has been shown to participate in the progression of solid cancers such as lung cancer, pancreatic cancer, colon cancer, and oral cancer by regulating cancer cell proliferation, migration, spread, neural invasion, and epithelial-mesenchymal transition. In lung cancer, Schwann cells promote epithelial-mesenchymal transition and movement of lung cancer cell lines through the CXCL5 / CXCR2 / PI3K / AKT / GSK-3b / Snail-Twist pathway. In colon cancer, the neurotrophic factor NGF secreted by Schwann cells activates the TrkA / ERK / ELK 1 / ZEB 1 signaling pathway in colon cancer cells, further enhancing the expression of miR-21-5p to promote the proliferation and migration of colon cancer cells. However, as a cell with high glycolytic activity, whether it promotes lactate metabolism and lactic acidification in gastric cancer through lactate metabolism and lactate shuttle has not been reported in the literature.

[0005] Gastric cancer is a common digestive tract malignancy in my country. Currently, early screening is difficult, there is no gold standard therapy, the prognosis is poor in the late stage, and the postoperative residual gastric cancer and recurrence rate are high. Schwann cells, as cells with high glycolytic activity, play an important role in neural development, nerve regeneration after injury, pathological neuralgia, immune regulation, tumor progression, etc., but whether they play a role in gastric cancer lactic acidification and its specific mechanism have not been reported. ① The present invention determines the clinical correlation of lactic acidification, Schwann cells and lactate dehydrogenase and its subtypes co-localization in gastric cancer samples at the clinical level through clinical case sample analysis. ② The present invention deeply explores the role and mechanism of Schwann cells in promoting gastric cancer lactic acidification at the cellular level, and clarifies the possibility of Schwann cell lactate transport as a target to inhibit gastric cancer progression at the molecular level, laying the foundation for clinical application. From the perspective of neural cancer network, the present invention clarifies the mechanism of action of Schwann cells in promoting gastric cancer progression by gastric cancer lactic acidification, and provides a new target for the treatment of gastric cancer. Summary of the invention

[0006] The first objective of the present invention is to address the deficiencies of the prior art and to provide a method for treating gastric cancer by using Schwann cells to inhibit gastric cancer lactation through lactate shuttle as a target-specific drug or treatment method.

[0007] Preferably, gastric cancer lactylation promotes the growth of gastric cancer by regulating GluT1.

[0008] The second objective of the present invention is to provide the application of Schwann cell lactate shuttle in inhibiting gastric cancer lactation as a target-specific drug or therapeutic method for preventing and treating gastric cancer.

[0009] The third object of the present invention is to provide a drug or treatment method for treating or preventing gastric cancer, including Schwann cell lactate shuttle inhibition of gastric cancer lactic acidification as target specificity.

[0010] Preferably, the dosage form of the drug is any medically approved dosage form.

[0011] Preferably, a pharmaceutically acceptable carrier is also included.

[0012] The invention analyzes case samples by immunofluorescence and immunohistochemistry, and clinically determines the clinical correlation of lactic acidification, co-localization of Schwann cells and lactate dehydrogenase and its subtypes in gastric cancer samples; the invention places Schwann cells and gastric cancer cells in an incubator for culture; collects the supernatant after culturing Schwann cells with a fixed cell number in a complete culture medium to prepare a Schwann cell conditioned medium (SCM); adds Schwann cell conditioned medium or basal culture medium to the gastric cancer cell culture medium, cultures for a certain period of time, and determines the lactic acid change of gastric cancer by western blot and immunofluorescence; detects the lactic acid concentration of Schwann cell conditioned medium, and uses a basal culture medium containing a corresponding concentration of lactic acid to detect the effect of lactic acid on the proliferation of gastric cancer cells by CCK8, PH3 immunofluorescence, and cell cloning; uses cell scratch and transwell experiments to detect the effect of lactic acid on the migration of gastric cancer cells; and uses western blot to detect the effect of Schwann cell conditioned medium on lactic acid transport and downstream signal changes in gastric cancer.

[0013] The present invention studies the effect of Schwann cells on the growth of gastric cancer by promoting the lactic acidification of gastric cancer cells. The study found that Schwann cell conditioned medium can significantly promote the lactic acidification of gastric cancer cells and then promote the proliferation and migration of gastric cancer cells. In addition, it was found that gastric cancer lactic acidification promotes the progression of gastric cancer by regulating GluT1 in gastric cancer cells, which may indicate the key mechanism of the relationship between cancer cells and the tricarboxylic acid cycle. Therefore, the present invention can not only provide a new target for the treatment of gastric cancer, but also provide a new idea for the development of anti-tumor drugs.

[0014] Preferably, the gastric cancer samples are classified into well differentiated adenocarcinoma (WDA), moderately differentiated adenocarcinoma (MDA), and poorly differentiated adenocarcinoma (PDA) according to the degree of pathological differentiation;

[0015] Preferably, the Schwann cells are rat Schwann cell line RSC96, and the gastric cancer cell lines are human gastric adenocarcinoma cell line AGS and human undifferentiated gastric cancer cell line HGC;

[0016] Preferably, in step (1), the CO2 concentration in the incubator is 5%, the culture temperature is 37°C, and the complete cell culture medium contains 10% Fetal Bovine Serum (FBS) and 1%

[0017] Penicillin-Streptomycin (PS)-containing DMEM, the basal medium is DMEM containing 2% FBS and 1% PS, and the Schwann cell conditioned medium is Schwann cell supernatant containing 2% FBS and 1% PS.

[0018] Therefore, the present invention has the following beneficial effects:

[0019] (1) Treating gastric cancer cells by inhibiting the secretion of lactic acid from Schwann cells or directly inhibiting the lactic acidification of gastric cancer cells. The treatment conditions are mild and the time required is short.

[0020] (2) Easy to operate, with high success rate and good effect;

[0021] (3) It not only provides a new target for the treatment of gastric cancer, but also provides new ideas for the development of anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The clinical correlation between lactic acidification and lactate metabolism and gastric cancer. A is the immunofluorescence of lactic acidification in human gastric cancer tissues with different degrees of differentiation (high differentiation, moderate differentiation, and poor differentiation); B is the immunohistochemistry of lactate dehydrogenase distribution in human gastric cancer samples with different degrees of differentiation; C and D are the co-staining immunofluorescence of lactate dehydrogenase and Schwann cell markers in human gastric cancer samples with different degrees of differentiation.

[0023] Figure 2 The effect of Schwann cell conditioned medium on gastric cancer cell lactic acidification. Figure A is a schematic diagram of the experimental process; Figure BD is Western Blot and immunofluorescence detection of gastric cancer cell H3K9la site lactic acidification after AGS and HGC cells were treated with Schwann cell conditioned medium for 24 hours (n≥3). Data are mean ± standard error, **P<0.01, ****P<0.0001.

[0024] Figure 3The effect of lactic acid and lactic acid on the proliferation and migration of gastric cancer cells. Figure A is a schematic diagram of the experimental process; Figure B is the lactic acid concentration in Schwann cell conditioned medium detected by lactic acid concentration detection kit (n≥3); Figure CF is the lactic acid of H3K9 site detected by Western Blot and immunofluorescence after 15mM and 25mM lactic acid were added to the culture medium for 24h (n≥3); Figure GI is the cell proliferation detected by cck8 and clone formation assay after HGC cells were treated with 15mM and 25mM lactic acid in the culture medium and the statistical results (n≥3); Figure J and K are the cell migration detected by transwell assay after HGC cells were treated with 15mM and 25mM lactic acid in the culture medium and the statistical results (n≥3). Data are mean ± standard error, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0025] Figure 4 The effect of inhibiting Schwann cell lactate transport on lactic acidification, proliferation and migration of gastric cancer cells. Among them: Figure A is a schematic diagram of the experimental process; Figure BC is the western blot verification of the inhibition of monocarboxylate transporter (MCT, the main lactate transporter) MCT1 and MCT4 in Schwann cells (n≥3); Figure DG is the changes in the expression level of H3K9 lactic acid in gastric cancer detected by western Blot and immunofluorescence after HGC was treated with PLKO Schwann cell conditioned medium, shMCT1 Schwann cell conditioned medium, and shMCT4 Schwann cell conditioned medium for 24 hours (n≥3); Figure HJ is the changes in proliferation detected by cck8 and clone formation after HGC was treated with PLKO Schwann cell conditioned medium, shMCT1 Schwann cell conditioned medium, and shMCT4 Schwann cell conditioned medium (n≥3); Figures K and L are the changes in migration detected by scratch after HGC was treated with PLKO Schwann cell conditioned medium, shMCT1 Schwann cell conditioned medium, and shMCT4 Schwann cell conditioned medium (n≥3). Data are mean ± standard error, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0026] Figure 5 Effect of Schwann cell conditioned medium on monocarboxylate transporters in gastric cancer cells. After AGS and HGC cells were treated with Schwann cell conditioned medium for 24 hours, the expression of MCT1 and MCT4 proteins was detected by Western Blot and immunofluorescence (n≥3). Data are mean ± standard error, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0027] Figure 6 Effect of Schwann cell conditioned medium on the glucose transporter GluT1 in gastric cancer cells. Figures AC are the results of sequencing analysis of gastric cancer cells after culture with control or Schwann cell conditioned medium; Figures D and E are the expression of GluT1 protein detected by Western Blot after HGC cells were treated with Schwann cell conditioned medium for 24 hours; Figures F and G are the expression of GluT1 protein detected by Western Blot after HGC cells were treated with lactic acid for 24 hours; Figures H and I are the expression of GluT1 protein detected by Western Blot after HGC cells were treated with PLKO Schwann cell conditioned medium, shMCT1 Schwann cell conditioned medium, and shMCT4 Schwann cell conditioned medium for 24 hours; Figure J is a statistical graph of the results of CCK8 detection of HGC cell viability after treatment with control, BAY-876 (GluT1 inhibitor), Schwann cell conditioned culture, and BAY-876 + Schwann cell conditioned medium; Figures K and L are display graphs and statistical graphs of HGC cell migration detected by scratch after treatment with control, BAY-876 (GluT1 inhibitor), Schwann cell conditioned culture, and BAY-876 + Schwann cell conditioned medium. Data are mean ± standard error, *P < 0.05. DETAILED DESCRIPTION

[0028] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments of the specification. The following description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those familiar with the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without having to go through creative work. Therefore, the present invention is not limited to the following embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0029] Example 1: Clinical correlation between lactic acidification and lactate metabolism and gastric cancer

[0030] 1) In order to detect whether lactic acidification is correlated with clinical malignancy, immunofluorescence experiments were used to detect the expression of H3K9la in gastric cancer samples with different degrees of differentiation. The specific operation is as follows: After paraffin sections were dewaxed with xylene and gradient alcohol, antigen retrieval procedures were performed in 10mM sodium citrate buffer (pH 6.0) using a water bath for 30min. After permeabilization with 0.3% Triton X-100 in PBS containing 5% bovine serum albumin (BSA) at room temperature for 1h, the sections were incubated with H3K9la primary antibodies prepared with 5% BSA at 4°C overnight. Wash three times in PBS and then incubate with secondary antibodies at room temperature for 1 hour. After washing three more times in PBS, they were sealed and images were acquired using a fluorescence microscope (Olympus VS200). The results of H3K9la immunohistochemistry and immunofluorescence preliminary experiments showed that lactic acidification of the H3K9la site was enhanced in cancer tissues, and as the degree of differentiation became lower (the worse the prognosis), the degree of lactic acidification of gastric cancer tissues increased;

[0031] 2) To examine whether lactic acidification is associated with Schwann cell lactate metabolism, the distribution of lactate dehydrogenase in gastric cancer tissues with different differentiation was detected by immunohistochemistry: After paraffin sections were dewaxed with xylene and gradient alcohol, antigen retrieval procedures were performed in 10 mM sodium citrate buffer (pH 6.0) using a water bath for 30 min. After permeabilization with 0.3% Triton X-100 in PBS containing 5% bovine serum albumin (BSA) at room temperature for 1 h, the sections were incubated with the primary antibody H3K9la prepared in 5% BSA at 4°C overnight. Washed three times in PBS, and then incubated with the secondary antibody at room temperature for 1 h. The REAL EnVision detection kit (HRP-linked, Dako) was used to visualize the location of the antigen, and the nuclei were counterstained with hematoxylin and then dehydrated and mounted. The distribution of Schwann cells was photographed and analyzed using an Olympus VS200 white light microscope. The results showed that the immunohistochemical results of LDH, LDHA and LDHB showed that the expression of LDH and LDHB gradually increased with the decrease of differentiation degree, and this increase mainly existed in the tumor stroma. Although LDHA increased in tumor tissue compared with adjacent tissues, it had no significant correlation with the degree of differentiation.

[0032] 3) In order to further detect whether lactic acidification is related to Schwann cell lactate metabolism, lactate dehydrogenase (LDH) and Schwann cell markers were co-stained by immunofluorescence to detect the correlation between lactic acidification and Schwann cell lactate metabolism and their correlation with the malignancy of gastric cancer: after dewaxing, antigen repair, blocking, and permeabilization, the sections were incubated with 5% BSA-prepared lactate dehydrogenase and Schwann cell marker primary antibodies at 4°C overnight. Washed three times in PBS, and then incubated with secondary antibodies at room temperature for 1 hour. After washing three more times in PBS, they were sealed and images were acquired using a fluorescence microscope (Olympus VS200). The results showed that the immunofluorescence results of Schwann cell markers showed that the expression of Schwann cell markers in tumor tissues was significantly stronger than that in adjacent tissues; the immunofluorescence results of Schwann cell and non-myelinating Schwann cell markers co-stained with LDH and LDHB showed that as the degree of differentiation decreased, the co-expression of the two increased significantly; In summary, we found that the malignancy of gastric cancer may be related to lactic acidification and the lactic acid production of Schwann cells.

[0033] Example 2: Effect of Schwann cell conditioned medium on lactylation of H3K9la site in gastric cancer cells

[0034] 1) Western blot experiment to detect the effect of Schwann cell conditioned medium on H3K9la of gastric cancer cells: Gastric cancer cells were treated with Schwann cell conditioned medium for 24 hours, the culture medium was discarded, and the cells were washed with pre-cooled 1x PBS. An appropriate amount of RIPA lysis buffer containing protease inhibitors was added, and the adherent cells were scraped off with a cell scraper and collected into a pre-cooled 1.5 ml EP tube. The cells were ultrasonicated for 2s and stopped for 3s at 20% power for 1 minute, and lysed on ice for 15 minutes. The cells were centrifuged at 4°C, 14000g, and the supernatant was collected. The protein was quantified using the BCA method, 5x protein loading buffer was added for sample preparation, SDS-PAGE was run, PVDF membrane was transferred under 20% methanol conditions, and 5% skim milk was used for blocking at room temperature for 1 hour. The membrane was cut according to the molecular weight, and the H3K9la primary antibody was incubated at 4°C overnight. After washing with 1xTBST, the HRP secondary antibody conjugated to the corresponding species was incubated, and 1x After washing with TBST, the samples were incubated with ECL luminescent solution and chemiluminescent signals were collected. The signal strength reflected the protein content, and the grayscale of the bands was calculated using Image J for statistical analysis of the differences.

[0035] 2) Immunofluorescence staining to detect the effect of Schwann cell conditioned medium on H3K9la of gastric cancer cells: AGS and HGC cells were evenly spread on sterile and poly-lysine-coated cell slides at an appropriate density, and cell suspension (10,000 cells / well) was inoculated. After the cells were attached and grown for 24 hours, they were treated with Schwann cell conditioned medium or basal medium for 24 hours, fixed with 4% PFA for 15 minutes, and then washed with PBS for 3 times, each time for 5 minutes. After permeabilization with 0.1% Triton X100 and blocking with 5% BSA, the primary antibody H3K9la diluted in 5% BSA was incubated at 4°C overnight, washed with 1xPBS, incubated with fluorescent secondary antibody, and stained with DAPI for nuclei. The confocal microscope was used to take pictures, and the ratio of H3K9la positive signal cells to nuclear positive cells was counted. The experiment was repeated three times, and the lactic acidification was statistically analyzed;

[0036] like Figure 2 Compared with the control group, the lactic acidation of the H3K9 site in gastric cancer cells treated with Schwann cell conditioned medium was significantly enhanced.

[0037] Example 3: Effects of lactic acid released by Schwann cells on lactic acidification, proliferation and migration of gastric cancer cells

[0038] In order to detect the effect of lactic acid released by Schwann cells on gastric cancer cells, the lactic acid concentration of Schwann cell conditioned medium was detected by lactic acid detection kit and gastric cancer cells were cultured with basal medium of corresponding concentration. The lactic acidification of H3K9 in gastric cancer cells was detected by western blot and immunofluorescence. CCK8, clone formation and transwell experiments were used to detect whether there was any effect on proliferation and migration. The specific operations are as follows:

[0039] 1) After collecting the supernatant of Schwann cell conditioned medium, the lactate concentration was detected using a lactate content detection kit (Solebio). The operation method was referred to the instruction manual and statistical analysis was performed;

[0040] 2) Western blot and immunofluorescence detection of changes in gastric cancer cell lactic acid at 15 and 25 mM lactic acid concentrations: After HGC cells were treated with basal medium containing 15 and 25 mM lactic acid for 24 h, the expression of lactic acid was detected by Western blot and immunofluorescence, respectively;

[0041] 3) CCK8 experiment was used to detect the promoting effect of lactic acid on gastric cancer cell proliferation: HGC cells were grown in DMEM, 10% FBS and double antibody culture medium environment, and trypsin was used to digest when the density reached the appropriate density. The cells were resuspended in the culture medium and counted using a hemacytometer. The cells were plated on a 96-well plate with 3000 cells per well. After the cells adhered for 24 hours, the culture medium was replaced with basal culture medium or basal culture medium containing 15 and 25 mM lactic acid, respectively, with 100 μl per well. CCK8 was used to measure the cell viability of 0h, 24h, and 48h after adding lactic acid. 10 μl of CCK8 was added to each well, and the plate was read at 450nm after two hours of reaction. Five replicate wells were set at each time point at each concentration, and the experiment was repeated 3 times. The growth curve was calculated based on the results and statistical analysis was performed. The results showed that lactic acid promoted the cell viability of gastric cancer cell lines at 24h and 48h.

[0042] 4) The promoting effect of lactic acid on gastric cancer cell proliferation was detected by clone formation experiment: cell suspension (500 cells / well) was inoculated in 6-well plates, basal culture medium or basal culture medium containing 15, 25 mM lactic acid was added, and cultured in an incubator for 7 days (37°C, 5% CO2), fixed with PFA, stained with crystal violet, photographed, and counted.

[0043] 5) Detection of the effect of lactic acid on gastric cancer cell migration by transwell assay A transwell chamber adapted to a 24-well plate was used, basal culture medium or 200 μl serum-free culture medium containing 15 or 25 mM lactic acid was added to the upper chamber, containing 20,000 HGC cells, and 10% FBS was added to the lower chamber. After 24 hours, 4% PFA was used for fixation and crystal violet staining. Three wells were repeated in each experimental group and control group, and the experiment was repeated three times. The number of cells crossing the wells was counted and statistically analyzed.

[0044] like Figure 3 As shown, lactate secreted by Schwann cells can promote lactylation of H3K9 sites, proliferation and migration of gastric cancer cells.

[0045] Example 4: Inhibition of Schwann cell lactate transport inhibits lactic acidification, proliferation and migration of gastric cancer cells

[0046] In order to further detect whether lactic acid secreted by Schwann cells has an effect on gastric cancer cells, shRNA, Western Blot and immunofluorescence staining were used to detect the effect of inhibiting Schwann cell lactate transport on gastric cancer cells.

[0047] The specific operations are as follows:

[0048] 1) Establishment of shMCT1 or shMCT4 Schwann cells: Design and synthesize the corresponding MCT1shRNA and MCT4 shRNA sequences according to the target gene sequence. Use restriction endonucleases EcoRI and AgeI to insert the MCT1shRNA and MCT4 shRNA sequences into the PLKO.1 vector. When the cell density reaches 70% to 80%, 24 to 72 hours later, the successfully constructed recombinant expression vector is transferred into RSC96 cells using Lipofectamine 3000 transfection reagent and screened by Puro gradient until all cells emit fluorescence. The cell lines that successfully knocked down the gene verified by western blot were used for subsequent experiments;

[0049] ShMCT1 GACGAGACCAGCACTGATGT Sh MCT4 CGTGTGTGCTGCACTCATGA

[0050] 2) Detection of lactic acidification changes in gastric cancer cells treated with shMCT1 or shMCT4 Schwann cell conditioned medium by western blot and immunofluorescence: After HGC cells were treated with PLKO, shMCT1 or shMCT4 Schwann cell conditioned medium for 24 h, the expression of lactic acidification was detected by Western blot and immunofluorescence, respectively;

[0051] 3) Detect whether inhibiting the secretion of lactic acid from Schwann cells has an effect on the proliferation of gastric cancer: The effect of inhibiting the secretion of lactic acid from Schwann cells on the proliferation of HGC cells was determined by CCK8 and clone formation experiments: HGC cells were grown in a culture medium containing DMEM, 10% FBS and double antibodies, and digested with trypsin when the density reached an appropriate level. After resuspending in the culture medium, the cells were counted using a hemocytometer and plated. After 24 hours of cell attachment, the cells were cultured with PLKO, shMCT1 or shMCT4 Schwann cell conditioned medium, which was used for CCK8 and clone formation experiments, respectively;

[0052] 4) The effect of inhibiting Schwann cell lactate secretion on HGC cell migration was determined by scratch test: 12-well plates were used, and 150,000 HGC cells were plated in each well. After the cells were observed to be full, a 1mL pipette tip was used to evenly draw horizontal lines along the lid of the 6-well plate (upper and lower, left and right of the center line of the well), and the scratches were made perpendicular to the horizontal lines on the back as much as possible. The pipette tip should be vertical and not tilted. After washing the fragmented cells with PBS, the basal culture medium or Schwann cell conditioned culture medium was replaced with culture medium, and the scratch healing status was photographed at 0 and 24 hours. The control group and the experimental group were repeated for 3 wells each time, and the experiment was repeated 3 times. The scar healing rate was calculated and statistically analyzed using Image J;

[0053] like Figure 4As shown, through shRNA, western blot, immunofluorescence, CCK8, clone formation, and scratch experiments, it can be found that inhibiting Schwann cell lactate transport can inhibit the promoted lactic acidization, proliferation, and migration of gastric cancer.

[0054] Example 5: Effect of Schwann cells on lactate transporters in gastric cancer cells

[0055] In order to further detect the effect of Schwann cells on lactate transport in gastric cancer cells, western blot and immunofluorescence were used for detection. The specific operation is as follows:

[0056] After gastric cancer cells were cultured with Schwann cell conditioned medium for 24 hours, Western blot and immunofluorescence were used to detect the changes in the expression of lactic acidification in gastric cancer cells. The results showed that Schwann cell conditioned medium promoted the expression of MCT1 and MCT4 in gastric cancer cells.

[0057] Example 6: Effect of Schwann cells on glucose transporters in gastric cancer cells

[0058] In order to detect the further effect of Schwann cells on the lactic acidification of gastric cancer cells, sequencing and western blot were performed. The specific operations are as follows:

[0059] 1) RNA sequencing revealed that compared with the control group, the expression of 2357 genes in the Schwann cell conditioned medium-treated group changed, of which 1501 genes were upregulated. We noticed that SLC2A1 encoding glucose transporter 1 (GluT1) was significantly upregulated.

[0060] 2) Western blot was used to detect gastric cancer cells treated with Schwann cell conditioned medium for 24 hours, gastric cancer cells treated with lactic acid for 24 hours, and gastric cancer cells treated with shMCT1 or shMC4 Schwann cell conditioned medium for 24 hours. The results showed that the expression level of GluT1 was significantly increased after treatment with SCM and lactic acid, and was significantly decreased after treatment with shMCT1 or shMC4 Schwann cell conditioned medium.

[0061] 3) After treating gastric cancer cells with the GluT1 inhibitor BAY-876, the proliferation of gastric cancer cells was detected by CCK8, and the migration was detected by scratch assay. The results showed that the growth-promoting effect of Schwann cell conditioned medium was partially inhibited after the inhibitor was used.

[0062] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0063] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiments according to the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention. In summary, the present invention finds that Schwann cells promote gastric cancer lactic acidification by secreting lactic acid, thereby promoting gastric cancer proliferation and migration and its specific mechanism, providing a new possible target for the treatment of gastric cancer, which can provide new ideas for the treatment of gastric cancer.

Claims

1. The application of Schwann cells secreting lactic acid to promote gastric cancer lactation as a target in the preparation of drugs or treatment methods for treating gastric cancer.

2. The use according to claim 1, characterized in that Schwann cells participate in promoting gastric cancer lactic acidification by releasing lactic acid, increasing the expression of GluT1 in gastric cancer cells and thus promoting the progression of gastric cancer.

3. Application of Schwann cells secreting lactic acid to promote gastric cancer lactation as a target in the preparation of drugs or treatment methods for preventing and treating gastric cancer.

4. A drug or method for treating or preventing gastric cancer, characterized in that Including targeting Schwann cells.

5. A drug or method for treating or preventing gastric cancer according to claim 1, characterized in that The dosage form of the drug is any dosage form recognized medically.

6. A drug or method for treating or preventing gastric cancer according to claim 1, characterized in that Also included are pharmaceutically acceptable carriers.

Images