Bimodal polymyxin drug resistance gene MCR-1 detection platform

Abstract

The invention discloses a bimodal polymyxin drug-resistant gene MCR-1 detection platform, relates to the field of food safety and analytical chemistry, and in particular relates to an on-site rapid detection method of the polymyxin drug-resistant gene MCR-1 in a food sample, primer groups aiming at the polymyxin drug-resistant gene MCR-1 are respectively as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, and a sixth primer with the 5'end labeled by biotin; the CRISPR / dCas9 system comprises dCas9 protein and sgRNA, and the sequence of the sgRNA is marked as SEQ ID NO.7; the sequence of the gold-platinum nanoprobe is marked as SEQ ID NO.8; the LAMP technology is adopted to amplify the polymyxin drug-resistant gene MCR-1 in the sample to be detected, an LAMP product contains multiple sections of reverse circulation repetitive sequences, and each double strand can be combined with more gold-platinum nanoparticles, so that sensitive detection of the food-borne pathogenic bacteria containing the polymyxin drug-resistant gene MCR-1 in the food sample is realized, the sensitivity is relatively high, the detection time is short, the detection time is short, and the cost is low. The operation is simple, the stability is high, and the whole detection process can be completed in a short time.

Description

Technical Field

[0001] The present invention relates to the technical field of food safety and analytical chemistry, and in particular to a dual-modal polymyxin resistance gene MCR-1 detection platform. Background Art

[0002] Pathogenic bacteria have always been one of the main causes of human diseases and have posed a huge threat to global public health. A large part of these pathogens cause diseases by using food as a carrier, also known as foodborne pathogens. Foodborne diseases caused by foodborne pathogens not only cause serious harm to human health, but also have a huge impact on the global economy. More seriously, the increased drug resistance caused by the abuse of antibiotics has further exacerbated the threat of foodborne pathogens to public health. Among them, the plasmid-mediated polymyxin resistance genes (MCR-1, 2, 3, 4, 5, 6 and 7) found in carbapenem-resistant Enterobacteriaceae, especially MCR-1, as one of the several extremely harmful drug resistance genes, are mainly present in common foodborne pathogens such as Salmonella and Escherichia coli, causing hundreds of thousands of deaths each year. Based on this, the development of a method that can sensitively, quickly and accurately detect the polymyxin resistance gene MCR-1 in food samples is of great significance for preventing the spread of foodborne pathogens and maintaining people's health.

[0003] There are many methods for detecting drug-resistant genes. Conventional drug resistance tests are mainly based on microbial methods, but the detection process of this method is too complicated and the detection cycle is too long. In clinical practice, the detection cycle of this method may exceed the treatment window of critically ill patients, and the lack of information on the infected bacteria may also lead to improper medication, causing patients to miss the best opportunity for treatment. Therefore, researchers have sought several alternative methods. Immunological methods have high sensitivity, but are easily interfered by antibody specificity and matrix background. The polymerase chain reaction (PCR) based on molecular biology can provide rapid detection results, but it requires high professionalism from technicians and requires expensive PCR instruments, which are difficult to use in some resource-scarce areas. Since these methods are all based on laboratory analysis, there is an urgent need to develop methods for rapid on-site detection of the polymyxin resistance gene MCR-1.

[0004] CRISPR / Cas is an adaptive immune system derived from archaea. After the virus invades, the CRISPR / Cas system can silence the expression of exogenous genes by cutting under the guidance of RNA. Researchers have discovered its great application potential in the field of molecular diagnosis and have developed a large number of detection methods based on this. A variant of Cas9 is called dCas9. This variant loses its shearing enzyme activity due to mutations in the RuvC1 and HNH domains, thus retaining only the ability to target the target sequence through sgRNA and PAM sequences. dCas9 loses its cutting activity, so it can precisely regulate any gene without damaging DNA. Using dCas9 to perform secondary recognition of pre-amplified targets is an effective strategy to improve detection specificity. In addition, improving the sensitivity and accuracy of rapid detection methods is also a problem that needs to be solved. In recent years, the rapidly developing nanozymes have gradually been favored by researchers due to their excellent properties. Compared with natural enzymes, nanozymes have the same catalytic activity, high stability, low cost, easy synthesis and modification, etc., and have great potential in biosensing and other aspects. Studies have shown that nanozymes can catalyze certain organic dyes into molecules with SERS activity, which has great prospects in SERS-based biosensing. In addition, nanozymes have a large surface area and provide many active sites, which significantly increase the number of interacting signal molecules to improve detection sensitivity. The targeting ability of the CRISPR / Cas system and the excellent catalytic activity and high stability of nanozymes provide a basis for the development of a simple, stable, and highly sensitive rapid detection method.

[0005] Although researchers have developed a large number of biosensors for rapid on-site detection of pathogens, most of these methods are single-signal outputs, which are easily affected by system errors and environmental factors and produce large analytical errors. The dual-modal detection method can output two signals at the same time, and the two signals correct each other, which improves the accuracy of the test results. Therefore, the dual-modal detection method is more capable of meeting the purpose of rapid and accurate on-site detection. The current pathogen detection market urgently needs such a method to prevent the spread of the polymyxin resistance gene MCR-1 and maintain people's health. Summary of the invention

[0006] The object of the present invention is to provide a dual-modal polymyxin resistance gene MCR-1 detection platform to solve the problems raised in the above background technology.

[0007] To achieve the above object, the present invention provides the following technical solution: a dual-modal polymyxin resistance gene MCR-1 detection platform, the method comprising the following steps:

[0008] S1: Mix the food sample containing the polymyxin resistance gene MCR-1 with the rapid extraction solution and heat and lyse for 5-8 minutes to obtain a solution containing the polymyxin resistance gene MCR-1;

[0009] S2: Using a primer set targeting the polymyxin resistance gene MCR-1, LAMP amplification was performed at a constant temperature for a period of time to obtain a biotin-modified LAMP double-stranded product;

[0010] S3: Mix appropriate amounts of streptavidin magnetic beads, dCas9 protein, sgRNA, gold platinum nanoprobes and LAMP double-stranded products, and incubate for a period of time. Use magnetic adsorption technology to enrich the streptavidin magnetic beads-dCas9 / sgRNA-LAMP double-stranded product-gold platinum nanoprobe complex, remove the supernatant and resuspend;

[0011] S4: Add 3,3',5,5'-tetramethylbenzidine and H 2 O 2 After a few minutes of reaction, the colorimetric results can be observed by naked eyes for qualitative analysis, and then the content of polymyxin resistance gene MCR-1 in food samples can be quantitatively analyzed by UV spectroscopy and SERS spectroscopy.

[0012] Preferably, the rapid extract comprises magnesium chloride, EDTA, Tris-HCl, triethanolamine dodecyl sulfate, potassium chloride and methyl salicylate, the mass volume fraction of triethanolamine dodecyl sulfate is 5%-10%, and the concentration of potassium chloride is 1.0-5.0 mol / L.

[0013] Preferably, the primer set includes a first primer, a second primer, a third primer, a fourth primer, a fifth primer and a sixth primer, and the sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and a sixth primer labeled with biotin at the 5' end, the sixth primer is modified by bio, and the sequence of the sixth primer is shown in SEQ ID NO.6.

[0014] Preferably, the concentration of the primer set for LAMP amplification is 10-1000nmol / L, the constant temperature for LAMP amplification is 60-65°C, the time for LAMP amplification is 25-45min, the concentration of streptavidin magnetic beads is 2-20mg / mL, the concentration of dCas9 protein is 50-500nmol / L, the sequence of sgRNA is marked as SEQ ID NO.7, and the concentration of sgRNA is 40-400nmol / L.

[0015] Preferably, the gold-platinum nanoparticles in the gold-platinum nanoprobe are 20-50 nm, the sequence of the gold-platinum nanoprobe is marked as SEQ ID NO.8, the gold-platinum nanoprobe is modified with SH, and the preparation method of the gold-platinum nanoparticles includes: adding 40 μL of ascorbic acid to 2 mL of gold nanoparticles with a particle size of 20-40 nM, vortexing to mix, then adding 1-5 μL of chloroplatinic acid, stirring at room temperature for 0.5-2 h, and storing at 4°C for later use.

[0016] Preferably, the method for preparing the gold-platinum nanoprobe comprises the following steps:

[0017] A1: Mix 10 μL of 10 μM gold-platinum nanoprobe, 2 μL of 1 mM TCEP solution and 1 μL of 500 mM acetate buffer solution, the pH of the acetate buffer solution is 5.2, and incubate in a dark environment for 0.5-1 h. At the same time, add 1 mL of gold-platinum nanoparticles to a 2.0 mL centrifuge tube, centrifuge at 8500 rpm for 10 min, remove the supernatant, add 100 μL of ultrapure water to resuspend and set aside;

[0018] A2: Add the activated gold-platinum nanoprobe to 100 μL of 10-fold concentrated gold-platinum nanoparticles in step A1, and incubate for 1 hour to allow the two to fully couple;

[0019] A3: Add 2 μL of 10% bovine serum albumin solution and incubate at room temperature for 1 h to block the sites on the gold-platinum nanoparticles that are not coupled to the probe;

[0020] A4: Excess gold-platinum nanoprobes and impurity ions were removed by centrifugation at 8500 rpm for 10 min. The obtained gold-platinum nanoprobes were dispersed with 100 μL of resuspension solution, centrifuged under the same conditions, and dispersed again with 50 μL of resuspension solution. The resuspension solution included 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, 10% sucrose, and the pH was 8.0.

[0021] Preferably, the volume of the gold-platinum nanoprobe is 3-10 μL, the volume of the LAMP double-stranded product is 2-10 μL, and the incubation time is 2-10 min.

[0022] Preferably, the concentration of 3,3',5,5'-tetramethylbenzidine is 1.0-10 mmol / L, H 2 O 2 The concentration is 0.5-10%, the reaction time is 1-3 min, and the SERS spectrum measurement conditions are 785 nm and 100 mW.

[0023] Preferably, the dual-modal detection platform is used for on-site rapid quantitative detection of food samples contaminated with polymyxin-resistant bacteria.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The present invention utilizes a specific functional primer set for the polymyxin resistance gene MCR-1. When the polymyxin resistance gene MCR-1 is present in the food sample to be tested, the corresponding biotin-modified LAMP double-stranded product is obtained by LAMP amplification, which can be captured by streptavidin magnetic beads, and then the specific site is recognized by the CRISPR / dCas9 system to unwind it. The exposed sequence can be combined with the pre-designed gold platinum nanoprobe to form a streptavidin magnetic bead-dCas9 / sgRNA-LAMP double-stranded product-gold platinum nanoprobe complex. The complex is then enriched by magnetic adsorption technology, and the supernatant is removed and the magnetic beads are collected and added with 3,3',5,5'-tetramethylbenzidine and H 2 O 2 A colorimetric signal is generated within a few minutes, and the test food sample can be qualitatively analyzed by naked eye observation to determine whether it is infected by polymyxin-resistant bacteria. Subsequently, a portable Raman instrument is used to measure the Raman spectrum for quantitative analysis of the polymyxin resistance gene MCR-1 contained in the sample.

[0026] 2. The detection method of the present invention adopts LAMP technology to amplify the polymyxin resistance gene MCR-1 contained in the food sample to be tested. Since the product contains multiple continuous repetitive sequences, more gold-platinum nanoparticles can be bound to the double-stranded strands of each LAMP product, thereby realizing sensitive detection of foodborne pathogens containing the polymyxin resistance gene MCR-1 in the food sample, with high sensitivity, good repeatability, simple operation, short detection time, strong applicability and high stability.

[0027] 3. Compared with traditional nucleic acid amplification technology, the loop-mediated isothermal amplification technology used in the present invention has more obvious advantages, such as mild conditions and short time. The target in the food sample can be amplified in a short time and at a high multiple in the field environment through a portable heating device; a loop primer set is used in the amplification process to improve the amplification efficiency; the dCas9 system is used to specifically identify the LAMP product, avoiding the interference of reaction by-products.

[0028] 4. Compared with the traditional rapid detection method, the detection method of the present invention can output two signals at the same time, avoiding the influence of environmental factors and causing large errors. The dual signals can correct each other, ensuring the accuracy of the detection results while performing quantitative analysis.

[0029] 5. The detection method of the present invention does not require expensive instruments, but only requires an ordinary water bath to amplify the target to be detected, so as to achieve rapid, quantitative and accurate detection of polymyxin-resistant bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1This is a schematic diagram of the present invention using a dual-modal detection platform to screen and detect polymyxin-resistant bacteria infection in actual food samples. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] See also Figure 1 The present invention provides a technical solution: a dual-modal polymyxin resistance gene MCR-1 detection platform, the method comprising the following steps:

[0033] S1: Mix the food sample containing the polymyxin resistance gene MCR-1 with the rapid extraction solution and heat and lyse for 5-8 minutes to obtain a solution containing the polymyxin resistance gene MCR-1;

[0034] S2: Using a primer set targeting the polymyxin resistance gene MCR-1, LAMP amplification was performed at a constant temperature for a period of time to obtain a biotin-modified LAMP double-stranded product;

[0035] S3: Mix appropriate amounts of streptavidin magnetic beads, dCas9 protein, sgRNA, gold platinum nanoprobes and LAMP double-stranded products, and incubate for a period of time. Use magnetic adsorption technology to enrich the streptavidin magnetic beads-dCas9 / sgRNA-LAMP double-stranded product-gold platinum nanoprobe complex, remove the supernatant and resuspend;

[0036] S4: Add 3,3',5,5'-tetramethylbenzidine and H 2 O 2 After a few minutes of reaction, the colorimetric results can be observed by naked eyes for qualitative analysis, and then the content of polymyxin resistance gene MCR-1 in food samples can be quantitatively analyzed by UV spectroscopy and SERS spectroscopy.

[0037] Furthermore, the rapid extract solution contains magnesium chloride, EDTA, Tris-HCl, triethanolamine dodecyl sulfate, potassium chloride and methyl salicylate, the mass volume fraction of triethanolamine dodecyl sulfate is 5%-10%, and the concentration of potassium chloride is 1.0-5.0 mol / L.

[0038] The primer set includes a first primer, a second primer, a third primer, a fourth primer, a fifth primer and a sixth primer. The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and a sixth primer labeled with biotin at the 5' end, the sixth primer is modified by bio, and the sequence of the sixth primer is shown in SEQ ID NO.6.

[0039] The specific sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are shown in the sequence table; the present invention is based on the combination of the above-mentioned inner primer, outer primer and loop primer, which realizes the effective amplification of the polymyxin resistance gene MCR-1 and the biotin modification of the amplification product, and is a key design for dual-modal detection of the polymyxin resistance gene MCR-1 based on nucleic acid amplification.

[0040] Furthermore, the primer set concentration of LAMP amplification is 10-1000nmol / L, the constant temperature of LAMP amplification is 60-65°C, the time of LAMP amplification is 25-45min, the concentration of streptavidin magnetic beads is 2-20mg / mL, the concentration of dCas9 protein is 50-500nmol / L, and the concentration of sgRNA is 40-400nmol / L.

[0041] The sequence of sgRNA is marked as SEQ ID NO.7.

[0042] The gold-platinum nanoparticles in the gold-platinum nanoprobe are 20-50 nm in size. The sequence of the gold-platinum nanoprobe is marked as SEQ ID NO.8. The gold-platinum nanoprobe is modified with SH. The specific sequence representation is shown in the sequence below.

[0043] The preparation method of gold-platinum nanoparticles comprises: adding 40 μL of ascorbic acid to 2 mL of gold nanoparticles with a particle size of 20-40 nM, vortexing and mixing, adding 1-5 μL of chloroplatinic acid, stirring at room temperature for 0.5-2 h, and storing at 4° C. for later use.

[0044] The preparation method of the gold-platinum nanoprobe comprises the following steps:

[0045] A1: Mix 10 μL of 10 μM gold-platinum nanoprobe, 2 μL of 1 mM TCEP solution and 1 μL of 500 mM acetate buffer solution, the pH of the acetate buffer solution is 5.2, and incubate in a dark environment for 0.5-1 h. At the same time, add 1 mL of gold-platinum nanoparticles to a 2.0 mL centrifuge tube, centrifuge at 8500 rpm for 10 min, remove the supernatant, add 100 μL of ultrapure water to resuspend and set aside;

[0046] A2: Add the activated gold-platinum nanoprobe to 100 μL of 10-fold concentrated gold-platinum nanoparticles in step A1, and incubate for 1 hour to allow the two to fully couple;

[0047] A3: Add 2 μL of 10% bovine serum albumin solution and incubate at room temperature for 1 h to block the sites on the gold-platinum nanoparticles that are not coupled to the probe;

[0048] A4: Excess gold-platinum nanoprobes and impurity ions were removed by centrifugation at 8500 rpm for 10 min. The obtained gold-platinum nanoprobes were dispersed with 100 μL of resuspension solution, centrifuged under the same conditions, and dispersed again with 50 μL of resuspension solution. The resuspension solution included 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, 10% sucrose, and the pH was 8.0.

[0049] In some embodiments, the detection method specifically includes: using a rapid extraction solution to extract the genomic DNA of the sample to be tested, using a functional primer set specific to the polymyxin resistance gene MCR-1 to perform LAMP amplification to obtain a biotin-modified LAMP product; mixing an appropriate amount of streptavidin magnetic beads, dCas9 protein, sgRNA, gold platinum nanoprobe and LAMP double-stranded product in a loading buffer solution, and incubating for a period of time, using magnetic adsorption technology to enrich the streptavidin magnetic beads-dCas9 / sgRNA-LAMP double-stranded product-gold platinum nanoprobe complex, removing the supernatant and resuspending, adding 3,3',5,5'-tetramethylbenzidine and H 2 O 2 After a few minutes of reaction, the colorimetric results can be observed by naked eyes for qualitative analysis, and then the content of polymyxin resistance gene MCR-1 in food samples can be quantitatively analyzed by UV spectroscopy and SERS spectroscopy.

[0050] Among them, the specific scheme of the one-step rapid extraction method is: take 1-5μL of food sample and mix it with 45-50μL of rapid extraction solution, incubate at 80℃ for 2-5min to obtain a solution containing the polymyxin resistance gene MCR-1.

[0051] Furthermore, the volume of the gold platinum nanoprobe is 3-10 μL, the volume of the LAMP double-stranded product is 2-10 μL, the incubation time is 2-10 min, the concentration of 3,3',5,5'-tetramethylbenzidine is 1.0-10 mmol / L, the concentration of H2O2 is 0.5-10%, the reaction time is 1-3 min, and the SERS spectral measurement conditions are 785 nm, 100 mW.

[0052] In summary, the implementation steps of the detection method of the present invention are:

[0053] 1. Preparation of gold-platinum nanoparticles;

[0054] 2. Coupling of gold-platinum nanoprobes;

[0055] 3. Extraction and LAMP amplification of polymyxin resistance gene MCR-1 in food samples;

[0056] 4. Visual detection;

[0057] 5. UV-SERS dual quantitative analysis.

[0058] The present invention uses a functional primer set specific to the polymyxin resistance gene MCR-1, utilizes the dCas9 system to specifically identify and unwind the LAMP product, and according to the different contents of the target polymyxin resistance gene MCR-1 in the sample to be tested, the content of the amplified product is different, the number of gold platinum nanoparticles captured by streptavidin is different, the reaction rate of catalyzing 3,3',5,5'-tetramethylbenzidine is different, the color depth and the ultraviolet and SERS signals generated are different, so as to establish the relationship between the height of the ultraviolet-SERS signal and the corresponding polymyxin resistance gene MCR-1 content, thereby achieving the purpose of sensitive detection of polymyxin-resistant bacteria in food samples.

[0059] Embodiment 1

[0060] The dual-modal detection platform for detecting the polymyxin resistance gene MCR-1 in egg samples provided in this embodiment comprises the following steps:

[0061] 1. Preparation of gold-platinum nanoparticles: Add 40 μL of ascorbic acid to 2 mL of gold nanoparticles with a particle size of 30 nM and vortex to mix. Then add 3 μL of chloroplatinic acid and stir at room temperature for 2 h. Store at 4°C for later use.

[0062] 2. Coupling of gold platinum nanoprobes: 10 μL of 10 μM gold platinum nanoprobes, 2 μL of 1 mM TCEP solution and 1 μL of 500 mM acetic acid buffer were mixed, the pH of the acetic acid buffer was 5.2, and the mixture was incubated in a dark environment for 1 hour. At the same time, 1 mL of gold platinum nanoparticles was added to a 2.0 mL centrifuge tube, and the mixture was centrifuged at 8500 rpm for 10 minutes, and the supernatant was removed and resuspended in 100 μL of ultrapure water for later use; the activated gold platinum nanoprobes were added to 100 μL of 10-fold concentrated gold platinum nanoparticles, and the mixture was incubated for 1 hour to allow the two to be fully coupled; 2 μL of 10% BSA (bovine serum albumin) solution was added and incubated at room temperature for 1 hour to block the sites of uncoupled probes on the gold platinum nanoparticles; the excess gold platinum nanoprobes were removed by centrifugation at 8500 rpm for 10 minutes, and the obtained gold platinum nanoprobes were resuspended with 100 μL of a resuspension solution, which included 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, 10% sucrose, and pH 8.0, after dispersion, centrifuge under the same conditions and disperse again with 50 μL of resuspension solution.

[0063] 3. Extraction and LAMP amplification of polymyxin resistance gene MCR-1 in egg samples to be tested:

[0064] The polymyxin resistance gene MCR-1 was extracted using a one-step rapid extraction method. 2 μL of the egg white and yolk sample was mixed with 50 μL of rapid extraction solution and incubated at 80°C for 3 minutes to obtain a solution containing the polymyxin resistance gene MCR-1.

[0065] The specific process of LAMP reaction is: add 2.5μL 10×Bst Buffer, 2.5μL MgSO4 (10mM), 0.4μL dNTPs (25mM), 1μL Bst DNA polymerase (8U / μL), 4μL betaine (5M), 0.8μL each of 10μM FIP and BIP, 0.2μL each of 10μM F3 and B3, 0.4μL each of 10μM LF and biotin-LB, 1μL DNA template, add water to the total system of 25μL, and react at 61°C for 30min.

[0066] 4. Visual detection

[0067] The LAMP product in step 3 of this embodiment is incubated with streptavidin magnetic beads, dCas9 protein, sgRNA, and gold platinum nanoprobes to form a complex that is collected by magnetic adsorption technology and then directly added with 3,3',5,5'-tetramethylbenzidine and H 2 O 2 The catalytic reaction was carried out at room temperature for 2 minutes, and the colorimetric signal was observed by naked eyes for qualitative analysis.

[0068] 5. Double quantitative analysis

[0069] The reaction product in step 4 of this embodiment is quantitatively analyzed by ultraviolet spectroscopy and SERS spectroscopy using a portable Raman instrument.

[0070] Embodiment 2

[0071] The dual-modal detection platform for detecting the polymyxin resistance gene MCR-1 in egg samples provided in this embodiment comprises the following steps:

[0072] 1. Preparation of gold-platinum nanoparticles: Add 40 μL of ascorbic acid to 2 mL of gold nanoparticles with a particle size of 30 nM and vortex to mix. Then add 3 μL of chloroplatinic acid and stir at room temperature for 2 h. Store at 4°C for later use.

[0073] 2. Coupling of gold platinum nanoprobes: 10 μL of 10 μM gold platinum nanoprobes, 2 μL of 1 mM TCEP solution and 1 μL of 500 mM acetic acid buffer were mixed, the pH of the acetic acid buffer was 5.2, and the mixture was incubated in a dark environment for 1 hour. At the same time, 1 mL of gold platinum nanoparticles was added to a 2.0 mL centrifuge tube, and the mixture was centrifuged at 8500 rpm for 10 minutes, and the supernatant was removed and resuspended in 100 μL of ultrapure water for later use; the activated gold platinum nanoprobes were added to 100 μL of 10-fold concentrated gold platinum nanoparticles, and the mixture was incubated for 1 hour to allow the two to be fully coupled; 2 μL of 10% BSA (bovine serum albumin) solution was added and incubated at room temperature for 1 hour to block the sites of uncoupled probes on the gold platinum nanoparticles; the excess gold platinum nanoprobes were removed by centrifugation at 8500 rpm for 10 minutes, and the obtained gold platinum nanoprobes were resuspended with 100 μL of a resuspension solution, which included 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, 10% sucrose, and pH 8.0, after dispersion, centrifuge under the same conditions and disperse again with 50 μL of resuspension solution.

[0074] 3. Extraction and LAMP amplification of polymyxin resistance gene MCR-1 in egg samples to be tested:

[0075] The polymyxin resistance gene MCR-1 was extracted using a one-step rapid extraction method. 3 μL of a sample mixed with egg white and yolk was mixed with 50 μL of a rapid extraction solution and incubated at 80°C for 3 min to obtain a solution containing the polymyxin resistance gene MCR-1.

[0076] The specific process of LAMP reaction is as follows: 2.5 μL 10× Bst Buffer, 2.5 μL MgSO 4(10mM), 0.4μL dNTPs (25mM), 1μL Bst DNA polymerase (8U / μL), 4μL betaine (5M), 10μM FIP, 0.8μL each of BIP, 10μM F3, 0.2μL each of B3, 10μM LF, 0.4μL each of biotin-LB, 1μL DNA template, add water to the total system of 25μL, and react at 61°C for 30min.

[0077] 4. Visual detection

[0078] The LAMP product in step 3 of this embodiment is incubated with streptavidin magnetic beads, dCas9 protein, sgRNA, and gold platinum nanoprobes to form a complex that is collected by magnetic adsorption technology and then directly added with 3,3',5,5'-tetramethylbenzidine and H 2 O 2 The catalytic reaction was carried out at room temperature for 2 minutes, and the colorimetric signal was observed by naked eyes for qualitative analysis.

[0079] 5. Double quantitative analysis

[0080] The reaction product in step 4 of this embodiment is quantitatively analyzed by ultraviolet spectroscopy and SERS spectroscopy using a portable Raman instrument.

[0081] In summary, according to the above two embodiments, the present invention obtains the corresponding biotin-modified LAMP double-stranded product through LAMP amplification when the polymyxin resistance gene MCR-1 is present, uses the dCas9 system to recognize and unwind the LAMP double-stranded product and bind it to the gold-platinum nanoprobe to obtain its complex, and then uses streptavidin magnetic beads to capture the gold-platinum nanoparticles in the complex, thereby participating in the catalytic addition of 3,3',5,5'-tetramethylbenzidine.

[0082] Different amounts of the polymyxin resistance gene MCR-1 result in different amounts of the produced complexes, resulting in different UV and SERS signal values. A relationship between the different UV and SERS signal values ​​and the polymyxin resistance gene MCR-1 content is established. The two signals are quantified simultaneously and calibrated with each other to achieve the purpose of sensitive screening of polymyxin-resistant bacteria and dual qualitative detection.

[0083] The nucleotide sequence from the 5' end to the 3' end of the first primer, i.e., SEQ ID NO. 1, is specifically: CGATGGGATAGGTTTGGCTAAGCTTGTGTTGCCGTTTTCTTGAC;

[0084] The nucleotide sequence from the 5' end to the 3' end of the second primer, i.e., SEQ ID NO. 2, is specifically: GCTGACGATCGCTGTCGAAGCTTGCACATAGCGATACGATGAT;

[0085] The nucleotide sequence from the 5' end to the 3' end of the third primer, i.e., SEQ ID NO. 3, is specifically: GATGCAGCATACTTCTGTG;

[0086] The nucleotide sequence from the 5' end to the 3' end of the fourth primer, i.e., SEQ ID NO. 4, is specifically: ACCGTGCCATAAGTGTC;

[0087] The nucleotide sequence from the 5' end to the 3' end of the fifth primer, i.e., SEQ ID NO.5, is specifically: AGGTAAGATTGGCGGTCG;

[0088] The nucleotide sequence from the 5' end to the 3' end of the sixth primer modified by bio, i.e., SEQ ID NO.6, is specifically: bio-CTACTGATCACCACGCTGTT;

[0089] The nucleotide sequence from the 5' end to the 3' end of the sgRNA, i.e., SEQ ID NO. 7, is specifically: GGAAGCCGAGATTGTCCGCGATGTTTTAGAGCTAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU;

[0090] The nucleotide sequence from the 5' end to the 3' end of the sh-modified gold-platinum nanoprobe SEQ ID NO.8 is specifically: sh-TTTTTTTTTTTTTTTTTTTTATCGCGGACAATCTCGGCTT;

[0091] This method has good specificity, high sensitivity, good repeatability, simple operation, strong adaptability, and high accuracy. It can detect polymyxin-resistant bacteria with a concentration of 1 CFU / mL. Moreover, this method does not require special and expensive instruments. Only an ordinary water bath and a portable Raman instrument are needed to achieve rapid and accurate quantitative detection of the polymyxin resistance gene MCR-1. It is suitable for carrying out related rapid detection work in areas with scarce detection resources.

[0092] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Dual-modal polymyxin resistance gene MCR-1 detection platform, characterized by: The method comprises the following steps: S1: Mix the food sample containing the polymyxin resistance gene MCR-1 with the rapid extraction solution and heat and lyse for 5-8 minutes to obtain a solution containing the polymyxin resistance gene MCR-1; S2: Using a primer set targeting the polymyxin resistance gene MCR-1, LAMP amplification was performed at a constant temperature for a period of time to obtain a biotin-modified LAMP double-stranded product; S3: Mix appropriate amounts of streptavidin magnetic beads, dCas9 protein, sgRNA, gold platinum nanoprobes and LAMP double-stranded products, and incubate for a period of time. Use magnetic adsorption technology to enrich the streptavidin magnetic beads-dCas9 / sgRNA-LAMP double-stranded product-gold platinum nanoprobe complex, remove the supernatant and resuspend, and repeat this step 3-5 times; S4: After adding 3,3',5,5'-tetramethylbenzidine and reacting with H2O2 for several minutes, the colorimetric results are observed with the naked eye for qualitative analysis, and then the content of the polymyxin resistance gene MCR-1 in the food sample can be quantitatively analyzed by UV spectroscopy and SERS spectroscopy.

2. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: The rapid extract contains magnesium chloride, EDTA, Tris-HCl, triethanolamine dodecyl sulfate, potassium chloride and methyl salicylate, the mass volume fraction of triethanolamine dodecyl sulfate is 5%-10%, and the concentration of potassium chloride is 1.0-5.0 mol / L.

3. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: The primer set includes a first primer, a second primer, a third primer, a fourth primer, a fifth primer and a sixth primer. The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and a sixth primer labeled with biotin at the 5' end, the sixth primer is modified by bio, and the sequence of the sixth primer is shown in SEQ ID NO.

6.

4. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: The primer set concentration of the LAMP amplification is 10-1000nmol / L, the constant temperature of the LAMP amplification is 60-65°C, the time of the LAMP amplification is 25-45min, the concentration of the streptavidin magnetic beads is 2-20mg / mL, the concentration of the dCas9 protein is 50-500nmol / L, the sequence of the sgRNA is marked as SEQ ID NO.7, and the concentration of the sgRNA is 40-400nmol / L.

5. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: The gold-platinum nanoparticles in the gold-platinum nanoprobe are 20-50 nm, the sequence of the gold-platinum nanoprobe is marked as SEQ ID NO.8, and the gold-platinum nanoprobe is modified with SH. The preparation method of the gold-platinum nanoparticles includes: adding 40 μL of ascorbic acid to 2 mL of gold nanoparticles with a particle size of 20-40 nM, vortexing and mixing, then adding 1-5 μL of chloroplatinic acid, stirring at room temperature for 0.5-2 h, and storing at 4°C for later use.

6. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 5, characterized in that: The preparation method of the gold-platinum nanoprobe comprises the following steps: A1: Mix 10 μL of 10 μM gold-platinum nanoprobe, 2 μL of 1 mM TCEP solution and 1 μL of 500 mM acetate buffer solution, the pH of the acetate buffer solution is 5.2, and incubate in a dark environment for 0.5-1 h. At the same time, add 1 mL of gold-platinum nanoparticles to a 2.0 mL centrifuge tube, centrifuge at 8500 rpm for 10 min, remove the supernatant, add 100 μL of ultrapure water to resuspend and set aside; A2: Add the activated gold-platinum nanoprobe to 100 μL of 10-fold concentrated gold-platinum nanoparticles in step A1, and incubate for 1 hour to allow the two to fully couple; A3: Add 2 μL of 10% bovine serum albumin solution and incubate at room temperature for 1 h to block the sites on the gold-platinum nanoparticles that are not coupled to the probe; A4: Excess gold-platinum nanoprobes and impurity ions were removed by centrifugation at 8500 rpm for 10 min. The obtained gold-platinum nanoprobes were dispersed with 100 μL of resuspension solution, centrifuged under the same conditions, and dispersed again with 50 μL of resuspension solution. The resuspension solution included 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, 10% sucrose, and the pH was 8.

0.

7. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: The volume of the gold-platinum nanoprobe is 3-10 μL, the volume of the LAMP double-stranded product is 2-10 μL, and the incubation time is 2-10 min.

8. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: The concentration of the 3,3',5,5'-tetramethylbenzidine is 1.0-10 mmol / L, the concentration of H2O2 is 0.5-10%, the reaction time is 1-3 min, and the SERS spectrum measurement conditions are 785 nm and 100 mW.

9. The dual-modal polymyxin resistance gene MCR-1 detection platform according to claim 1, characterized in that: This dual-modal detection platform is used for on-site rapid quantitative detection of food samples contaminated with polymyxin-resistant bacteria.

Images