Glycosyl transferase mutant and method for catalytically synthesizing rebaudioside M2 by using glycosyl transferase mutant

Abstract

The invention relates to the technical field of biocatalytic synthesis. The invention particularly relates to a glycosyl transferase mutant and a method for catalytically synthesizing rebaudioside M2 by using the glycosyl transferase mutant. The invention relates to a glycosyl transferase mutant, which is characterized in that the glycosyl transferase mutant is A1) or A2): A1) is a protein which is obtained by substitution of amino acid residues on an amino acid sequence as shown in SEQ ID NO.20, has more than 90% of identity with an original protein and has the same function with the original protein; a2) a fusion protein obtained by connecting a tag to the N end and / or C end of A1).

Description

Technical Field

[0001] The present invention relates to the technical field of biocatalytic synthesis, and specifically to a glycosyltransferase mutant and a method for catalyzing the synthesis of rebaudioside M2. Background Art

[0002] People, especially diabetics, have a growing demand for natural sugar substitutes without calories. Stevioside is a natural, calorie-free ingredient extracted from stevia leaves, and has been approved as a safe food additive in the United States, Europe, Asia and other countries. In 2014, China approved the use of stevioside in food, beverages, nutritional supplements and other products in food additives. Therefore, SGs have received widespread attention and attention.

[0003] Rebaudioside D is a stevioside with great application prospects. Its sweetness is 200-300 times higher than that of sucrose, but its short-term bitter taste affects its application and promotion in the market. Rebaudioside M2 ​​is a product that adds a glucose group to the C-6' position of the first glucose group connected to the C19 position of rebaudioside D. Compared with rebaudioside D, its sweetness is increased and its bitterness is eliminated. Therefore, rebaudioside M2 ​​has better sugar properties and more ideal taste than rebaudioside D.

[0004] At present, rebaudioside M2 ​​is a monoglycosylated derivative of rebaudioside D, which is obtained by bioconversion. NtUGT from tobacco (Nicotiana tomentosiformis) can catalyze the C-6' glycosylation reaction of the first glucose group attached to the C19 position of stevioside compounds, so the high-value sweetener rebaudioside M2 ​​can be obtained by catalyzing rebaudioside D with NtUGT.

[0005] NtUGT is a "Leloir" type glycosyltransferase, belonging to the GT1 family. It usually uses UDPG as a glycosyl donor to synthesize glycoside compounds. It can be obtained in large quantities by heterologous expression in Escherichia coli or Saccharomyces cerevisiae, and is used to catalyze the synthesis of rebaudioside M2 ​​from rebaudioside D. With the continuous improvement of UDPG production methods, it can be synthesized in large quantities by enzymatic methods such as SuSy. On this basis, the SuSy-UGT cascade reaction system is used, and SuSy is used to provide a glycosyl donor for NtUGT to achieve the recycling of UDPG, which greatly reduces the application cost. For the NtUGT-SuSy cascade system, SuSy provides the required glycosyl donor for the smooth progress of the glycosylation reaction. When the UDPG regeneration rate is not a limitation (for example, by increasing the sucrose concentration), the key to the efficiency of synthesizing rebaudioside M2 ​​lies in NtUGT. NtUGT from tobacco has poor thermal stability, and the enzyme is generally inactivated after 10 hours of catalysis, which limits the efficient application of glycosyltransferases. Summary of the invention

[0006] Therefore, the technical problem to be solved by the present invention is to overcome the defect of poor thermal stability of NtUGT in the prior art, thereby providing a glycosyltransferase mutant with high yield and strong thermal stability for catalyzing the synthesis of rebaudioside M2.

[0007] The present application provides a glycosyltransferase mutant, wherein the glycosyltransferase mutant is as follows A1) or A2):

[0008] A1) is a protein having more than 90% identity with the original protein and having the same function as the original protein obtained by replacing the amino acid residues in the amino acid sequence shown in SEQ ID NO. 20;

[0009] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1).

[0010] Preferably, the glycosyltransferase mutant is a protein obtained by replacing one or more of the following amino acid residues in the amino acid sequence shown in SEQ ID NO.20:

[0011] B1) The amino acid at position 10 was mutated from alanine (A) to valine (V);

[0012] B2) amino acid 51 was mutated from glutamine (Q) to lysine (K);

[0013] B3) amino acid 72 mutated from phenylalanine (F) to leucine (L);

[0014] B4) the amino acid at position 87 was mutated from leucine (L) to proline (P);

[0015] B5) The amino acid at position 123 was mutated from leucine (L) to proline (P);

[0016] B6) The amino acid at position 157 was mutated from leucine (L) to proline (P);

[0017] B7) The amino acid at position 219 was mutated from asparagine (N) to aspartic acid (D);

[0018] B8) The amino acid at position 380 was mutated from glycine (G) to leucine (L);

[0019] B9) The amino acid at position 400 was mutated from serine (S) to arginine (R).

[0020] Preferably, the amino acid sequence of the glycosyltransferase mutant is the amino acid sequence obtained by subjecting SEQ ID NO. 20 to all the above mutations except B9).

[0021] The present invention provides a biomaterial, which is any one of the following C1) to C5):

[0022] C1) a nucleic acid molecule encoding the protein;

[0023] C2) an expression cassette containing the nucleic acid molecule described in C1);

[0024] C3) a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2);

[0025] C4) a recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3);

[0026] C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2).

[0027] The nucleic acid molecule encoding the protein is SEQ ID NO.19, and any one or more of the following mutations occur:

[0028] Replace CAG at positions 150-152 of SEQ ID NO.19 with AAG;

[0029] Replace TTC at positions 216-218 of SEQ ID NO.19 with CTT;

[0030] Replace CTG at positions 391-393 of SEQ ID NO.19 with CCT;

[0031] Replace TTG at positions 471-473 of SEQ ID NO.19 with CCT;

[0032] Replace AAC at positions 657-659 of SEQ ID NO.19 with GAC;

[0033] Replace GCT at positions 28-30 of SEQ ID NO.19 with GTT ;

[0034] Replace CTG at positions 259-261 of SEQ ID NO.19 with CCT ;

[0035] Replace GGT at positions 1138-1140 of SEQ ID NO.19 with TTA ;

[0036] Preferably, the nucleotide sequence of the nucleic acid molecule encoding the protein is shown as SEQ ID No.23.

[0037] The present invention also provides a method for synthesizing rebaudioside M2 ​​by using a glycosyltransferase mutant, comprising the following steps:

[0038] 1) constructing a recombinant strain containing a dual-enzyme co-expression system: constructing the coding gene of the above-mentioned glycosyltransferase mutant and the sucrose synthase gene into an expression vector to obtain a recombinant plasmid, and transforming the recombinant plasmid into a host bacterium to obtain a recombinant strain containing a dual-enzyme co-expression system;

[0039] 2) inducing the recombinant strain to express the glycosyltransferase mutant and sucrose synthase;

[0040] 3) Using the two enzymes in step 2) and rebaudioside D and sucrose as raw materials to produce rebaudioside M2.

[0041]

[0042] Preferably, the expression vector is pRSFDuet-1.

[0043] Preferably, the final concentration of the inducer used in the induction expression in step 2) is 0.02-1 g / L, and the induction time is 4-50 h.

[0044] Preferably, step 2) includes the steps of collecting bacteria, disrupting the bacteria and collecting the supernatant by centrifugation to obtain crude enzyme.

[0045] Preferably, in step 3), the concentration of rebaudioside D is 1-500 g / L; the concentration of sucrose is 1-1500 g / L; and the amount of crude enzyme added is 1-100 g / L.

[0046] Preferably, the host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

[0047] Preferably, the rebaudioside D is synthesized by catalysis of glycosyltransferase using rebaudioside A as a substrate.

[0048] The present invention is based on glycosyltransferase NtUGT, performs site-directed mutation on the active center residues, and obtains the best glycosyltransferase mutant NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L by comparing the relative activity and half-life of the mutant strains. The glycosyltransferase mutant is cascaded with sucrose synthase, stevioside is used as a substrate, and an appropriate amount of sucrose is added to catalyze the synthesis of rebaudioside M2. The mutant is simple to prepare, and efficient catalytic synthesis of rebaudioside M2 ​​is achieved. Under the same conditions, the activity of the mutant is 5.7 times that of the original enzyme, the half-life is about 2.9 times, and the yield of rebaudioside M2 ​​is significantly improved compared with the original enzyme. The catalytic effect of the reaction system based on the mutant strain NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L was better than that of the unmutated system. The concentration of rebaudioside M2 ​​was 36.7 g / L after 36 hours of reaction, and the yield reached more than 95%.

[0049] The present invention improves the thermal stability of glycosyltransferase NtUGT by mutation. 35℃ The extension is about three times and the catalytic activity is increased by about 10 times, thereby improving the efficiency of catalytic production of rebaudioside M2.

[0050] Beneficial effects:

[0051] The present invention improves the enzymatic activity of glycosyltransferase NtUGT by site-directed mutagenesis, and utilizes the mutant to realize efficient catalytic synthesis of rebaudioside M2. The synthesis method has mild conditions, simple operation, short time, high catalytic efficiency, high yield, and good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0053] Figure 1 It is the NtUGT protein structure simulation and the spatial position of the mutant amino acids. DETAILED DESCRIPTION

[0054] LB medium: NaCl 10 g / L, yeast powder 5 g / L, peptone 10 g / L, agar 20 g / L.

[0055] Example 1 Construction of recombinant bacteria expressing glycosyltransferase NtUGT mutant

[0056] Select the dual gene expression vector pRSFDuet-1 (Han Guangwei. Co-expression and immunogenicity study of α, β_1, β_2, ε toxin proteins of Clostridium perfringens [D]. Chinese Academy of Agricultural Sciences, 2014. This vector was disclosed). The nucleotide sequence of glycosyltransferase NtUGT (SEQ ID NO.19) from Stevia was inserted into the NdeI / XhoI site of the vector, and the nucleotide sequence of sucrose synthase AtSUS (SEQ ID NO.22) from Arabidopsis was inserted into the site NcoI / EcoRI to obtain the pRSFDuet-1-NtUGT-AtSUS recombinant plasmid. The recombinant plasmid was introduced into Escherichia coli BL21 (DE3) to form a dual enzyme co-expression recombinant bacterium BL21-pRSFDuet-1-NtUGT-AtSUS (hereinafter referred to as NtUGT strain). The amino acid sequence of glycosyltransferase NtUGT is SEQID NO.20, and the amino acid sequence of sucrose synthase AtSUS is SEQ ID NO.21. The recombinant plasmid of the mutant is a nucleotide sequence of glycosyltransferase NtUGT replaced by a nucleotide sequence encoding a mutant protein, including the following single point mutants NtUGT_A10V, NtUGT_F72L, NtUGT_L87P, NtUGT_L123P, NtUGT_L157P, NtUGT_Q51K, NtUGT_S400R, NtUGT_N219D, and NtUGT_G380L.

[0057] The NtUGT_A10V protein mutant is a protein in which the amino acid at position 10 of SEQ ID NO.20 is mutated from alanine (A) to valine (V); the nucleic acid molecule encoding the mutant protein is a protein in which the amino acid at position 28-30 of SEQ ID NO.19 is replaced by GCT. GTT ;

[0058] The NtUGT_L87P protein mutant is a protein in which the amino acid at position 87 of SEQ ID NO.20 is mutated from leucine (L) to proline (P); the nucleic acid molecule encoding the mutant protein is a protein in which the CTG at positions 259-261 of SEQ ID NO.19 is replaced by CCT ;

[0059] The NtUGT_G380L protein mutant is a protein in which the amino acid at position 380 of SEQ ID NO.20 is mutated from glycine (G) to leucine (L); the nucleic acid molecule encoding the mutant protein is a protein in which the GGT at positions 1138-1140 of SEQ ID NO.19 is replaced by TTA ;

[0060] The NtUGT_Q51K protein mutant is a protein in which the amino acid at position 51 of SEQ ID NO.20 is mutated from glutamine (Q) to lysine (K); the nucleic acid molecule encoding the mutant protein is a protein in which the CAG at positions 150-152 of SEQ ID NO.19 is replaced by AAG

[0061] The NtUGT_F72L protein mutant is a mutant of SEQ ID NO. 20 in which the amino acid at position 72 is mutated from phenylalanine (F) to leucine (L). The nucleic acid molecule encoding the mutant protein is a nucleic acid molecule in which TTC at positions 216-218 of SEQ ID NO. 19 is replaced by CTT.

[0062] The NtUGT_L123P protein mutant is a protein in which the amino acid at position 123 of SEQ ID NO. 20 is mutated from leucine (L) to proline (P). The nucleic acid molecule encoding the mutant protein is a protein in which CTG at positions 391-393 of SEQ ID NO. 19 is replaced by CCT.

[0063] The NtUGT_L157P protein mutant is a protein in which the amino acid at position 157 of SEQ ID NO. 20 is mutated from leucine (L) to proline (P). The nucleic acid molecule encoding the mutant protein is a protein in which TTG at positions 471-473 of SEQ ID NO. 19 is replaced by CCT.

[0064] The NtUGT_S400R protein mutant is a mutant of SEQ ID NO. 20 in which the amino acid at position 400 is mutated from serine (S) to arginine (R). The nucleic acid molecule encoding the mutant protein is a nucleic acid molecule in which TCC at positions 1200-1202 of SEQ ID NO. 19 is replaced by CGT.

[0065] The NtUGT_N219D protein mutant is a mutant of SEQ ID NO. 20 in which the amino acid at position 219 is mutated from asparagine (N) to aspartic acid (D). The nucleic acid molecule encoding the mutant protein is a nucleic acid molecule in which the AAC at positions 657-659 of SEQ ID NO. 19 is replaced by GAC.

[0066] It also includes NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L protein mutants, specifically, all the above mutations except S400R occur simultaneously, that is, the amino acid sequence shown in SEQ ID NO.20 is mutated as follows: the 10th amino acid is mutated from alanine (A) to valine (V), the 51st amino acid is mutated from glutamine (Q) to lysine (K), the 72nd amino acid is mutated from phenylalanine (F) to leucine (L), the 87th amino acid is mutated from leucine (L) to proline (P), the 123rd amino acid is mutated from leucine (L) to proline (P), the 157th amino acid is mutated from leucine (L) to proline (P), the 219th amino acid is mutated from asparagine (N) to aspartic acid (D), and the 380th amino acid is mutated from glycine (G) to leucine (L). The nucleotide sequence of the nucleic acid molecule encoding the mutant protein is shown in SEQ ID No. 23. Adding S400R by multiple point mutations did not increase the catalytic effect of the mutant.

[0067] The specific preparation method of the glycosyltransferase mutant recombinant expression strain comprises the following steps:

[0068] 1. PCR amplification of site-directed mutant encoding genes: Using PCR amplification technology, the plasmid of the non-mutated strain BL21-pRSFDuet-1-NtUGT-AtSUS was used as a template DNA for rapid mutation (underlined mutant bases)

[0069] The primers for site-directed mutagenesis of A10V are: Forward primer: 5'-AG GTT TTCTTGTTCCCGTGGCTGGCGTATGGT-3'(SEQ ID No.1)

[0070] Reverse primer: 5'-CGGGAACAAGAA AAC CTTTAGTTTTGTGTGTTCAGTATCCATA--TG-3'(SEQ IDNo.2)

[0071] The primers for site-directed mutagenesis of Q51K are:

[0072] Forward primer: 5'-C AAG AAACGTATTCCGCAAAGCTACAGCAGCA-3'(SEQ ID No.3)

[0073] Reverse primer: 5'-GCGGAATACGTTT CTT GATGAAGCTAAGGTTGATCGGAG-3'(SEQ ID No.4)

[0074] The primers for site-directed mutagenesis of F72L are:

[0075] Forward primer: 5'-AG CTT CCGCAACTGCCACCGCATTACCATACC-3'(SEQ ID No.5)

[0076] Reverse primer: 5'-TGGCAGTTGCGG AAG CTCCGGCAGGATCAGCT-3'(SEQ ID No.6)

[0077] The primers for L87P site-directed mutagenesis are:

[0078] Forward primer: 5'-G CCT CACCTGAACAGCACGCTGCACAAAGCGT-3'(SEQ ID No.7)

[0079] Reverse primer: 5'-TGCTGTTCAGGTG AGG CGGCAGACCGTTGGTG-3'(SEQ ID No.8)

[0080] The primers for L123P site-directed mutagenesis are:

[0081] Forward primer: 5'-TATGCAA CCT TGGACCTTTGGCGTCGCTAGTT-3'(SEQ ID No.9)

[0082] Reverse primer: 5'-AGGTCCA AGG TTGCATAACGTCGTAGATGATCAGA-3'(SEQ ID No.10)

[0083] The primers for L157P site-directed mutagenesis were:

[0084] Forward primer: 5'-AC CCT GAAGTTGAGTACCCGTTTCCGGCACTT-3'(SEQ ID No.11)

[0085] Reverse primer: 5'-GTACTCAACTTC AGG GTTTTTGTAGAGATGAACGAAATAGCTG-3'(SEQ IDNo.12)

[0086] The primers for site-directed mutagenesis of N219D are:

[0087] Forward primer: 5'-TATG GACTATTTGGCTGAAATCATCGAAAACTCGC-3'(SEQ ID No.13)

[0088] Reverse primer: 5'-CAGCCAAATA GTC CATATATTTGCCCTCCAACTCACG-3'(SEQ ID No.14)

[0089] The primers for site-directed mutagenesis of G380L are:

[0090] Forward primer: 5'-TAGAGATT TTA GTGGCCCTGGAGGTCGTGCGTGAT-3'(SEQ ID No.15)

[0091] Reverse primer: 5'-AGGGCCACTAA AAT CTCTACCAGCAACTTGGCGTT-3'(SEQ ID No.16)

[0092] The primers for site-directed mutagenesis of S400R are:

[0093] Forward primer: GATCGCC CGT GTGATTAAGGACGTGACCTCTGG(SEQ ID No.17)

[0094] Reverse primer: TAATCAC ACG GGCGATCTCTTCACGGTGCAGG(SEQ ID No.18)

[0095] 2. The PCR target plasmid amplification reaction system is: 2 μL each of 10 μM forward primer and reverse primer; 1 μL dNTP Mix; 25 μL 2×Max Buffer; 1 μL template plasmid; 1 μL 2U / 50 μL Super-Fidelity DNA polymerase, add sterile water ddH2O to make up to 50 μL.

[0096] The reaction conditions for PCR target plasmid amplification were as follows: 95°C pre-denaturation for 30 s; 30 cycles (95°C denaturation for 15 s; 65°C annealing for 15 s; 72°C extension for 7 min); 72°C complete extension for 5 min; and finally, insulation at 16°C. The PCR amplification products were detected by agarose gel nucleic acid electrophoresis.

[0097] 3. Add 1 μL of DpnI endonuclease to the PCR amplification product that has been confirmed to have mutated, then place the reaction system at 37°C for 1-2 hours, transfer to E. coli BL21 (DE3) competent cells, place on ice for 30 minutes, heat shock at 42°C for 45-90 seconds, place on ice for 2 minutes, add 600 μL of LB medium, shake at 37°C at 200rpm for 45 minutes, take all the bacterial solution and evenly spread it on the LB plate containing kanamycin resistance, and culture at 37°C overnight. Pick 2 single colonies on the plate, inoculate them into LB liquid culture medium, and store the bacterial solution in glycerol tubes after 9 hours and sequence. Spread the bacterial solution glycerol tube with the correct sequencing result on the LB plate containing kanamycin resistance, shake the tube to activate the extracted plasmid, and introduce the recombinant plasmid into E. coli BL21 (DE3).

[0098] 4. The following strains were obtained using the above method: NtUGT_F72L, NtUGT_L123P, NtUGT_L157P, NtUGT_Q51K, NtUGT_S400R, and NtUGT_N219D.

[0099] 5. The method for obtaining the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L multi-point mutant strain is as follows:

[0100] (1) The plasmid of the mutated NtUGT_Q51K strain is determined to be the template plasmid of the target plasmid amplification reaction system in step 2 above, and the primers are primers for site-directed mutation of A10V. Steps 2 and 3 above are repeated to obtain the NtUGT_A10V / Q51K plasmid.

[0101] (2) To determine that the mutated NtUGT_A10V / Q51K plasmid is the template for the target plasmid amplification reaction system in step 2 above, the primers are primers for site-directed mutation of F72L, and the above steps 2 and 3 are repeated to obtain the NtUGT_A10V / Q51K / F72L plasmid.

[0102] (3) To determine that the mutated NtUGT_A10V / Q51K / F72L plasmid is the template for the target plasmid amplification reaction system in step 2 above, the primers are primers for site-directed mutagenesis of L87P, and the above steps 2 and 3 are repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P plasmid.

[0103] (4) To determine that the mutated NtUGT_A10V / Q51K / F72L / L87P plasmid is the template for the target plasmid amplification reaction system in the above step 2, the primer is a primer for site-directed mutagenesis of L123P, and the above steps 2 and 3 are repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P plasmid.

[0104] (5) To determine that the mutated NtUGT_A10V / Q51K / F72L / L87P / L123P plasmid is the template for the target plasmid amplification reaction system in step 2 above, the primer is a primer for site-directed mutagenesis of L157P, and the above steps 2 and 3 are repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P plasmid.

[0105] (6) To determine that the mutated NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P plasmid is the template for the target plasmid amplification reaction system in step 2 above, the primers are primers for site-directed mutation of N219D, and the above steps 2 and 3 are repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D plasmid.

[0106] (7) To determine that the mutated NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D plasmid is the template for the target plasmid amplification reaction system in the above step 2, the primers are primers for site-directed mutation of G380L, and the above steps 2 and 3 are repeated to obtain NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L.

[0107] AMBER21 software was used to predict and analyze the relevant parameters of the mutation site, and the results are shown in Table 1. Aphafold2 and Rosetta software were used to simulate the NtUGT protein structure and predict the spatial position of the mutant amino acid.

[0108] Table 1. Prediction parameter analysis of mutation sites

[0109]

[0110] Example 2 Fermentation induction of mutant enzymes

[0111] The single-point mutant NtUGT_Q51K recombinant strain and the multi-point mutant NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L recombinant strain of glycosyltransferase NtUGT were spread on LB solid plates containing 50μg / L kanamycin, and placed in a 37°C incubator for constant temperature culture for 12 hours. The next day, a single colony was selected from the plate and placed in a shaking tube containing 5mL LB liquid culture medium (containing 50μg / L kanamycin), and cultured in a shaking incubator at 37°C and 200rpm for 12 hours as seed liquid. The seed liquid was transferred to 100mL TB culture medium (containing 50μg / L kanamycin) at a 1% (v:v) inoculation amount. Place in a shaking incubator at 37°C, 200rpm, and shake culture. After 2 hours, adjust the temperature to 25°C and continue to culture for 20-22 hours.

[0112] Collect the fermentation liquid and centrifuge it at 4°C, 7000rpm, 6min, discard the supernatant to get the bacterial mud, and rinse it twice with potassium phosphate buffer. Then add an appropriate amount of potassium phosphate buffer, place it in an ice-water mixture, and use an ultrasonic disruptor to ultrasonically disrupt the bacteria, with the parameters set to Ф6, 300W, 30min. Then centrifuge it in a refrigerated centrifuge, with the parameters set to 4°C, 8000rpm, 30min, and take the supernatant as the crude enzyme solution, which is stored in a 4°C refrigerator for later use.

[0113] Detection of enzyme activity and half-life of wild-type and mutant enzymes

[0114] The method for determining the activity of glycosyltransferase is as follows: 1mM substrate rebaudioside D, 2mM UDPG, 0.5mg crude enzyme were added to 3mL of enzyme catalytic reaction system, and then supplemented with 100mM, pH 7.2 potassium phosphate buffer. The reaction conditions were 30℃, 200rpm. The sampling time was 0min, 20min, and 30min. Sample treatment: 500μL sample was taken, inactivated in a water bath at 95℃ for 5min, and then tested by HPLC.

[0115] Definition of enzyme activity (U): The amount of enzyme required to convert 1 μmol of product in 1 minute is 1 unit of enzyme activity. The relative activity of other mutant enzymes is calculated by taking the wild-type enzyme activity as 100%.

[0116] The half-life detection method is: incubate the wild enzyme and the mutant enzyme for different time periods in a 37°C water bath, measure the enzyme activity, draw a half-life curve and calculate the half-life time. The enzyme activity detection scheme is the same as above.

[0117] The enzyme activity test showed that the single-point mutant NtUGT_Q51K had an activity increase of 559% compared with the wild-type enzyme, while the half-life was only extended by 0.3 h. The multi-point mutant NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L not only had an activity of 570% of the wild-type enzyme, but also had a half-life extended by 8.6 h, and its ability to catalyze rebaudioside D was far superior to that of the wild-type enzyme. The specific data are shown in Table 2.

[0118] Table 2. Relative enzyme activities and half-lives of mutants

[0119]

[0120] Note: The enzyme activities of other mutants are lower than that of the wild-type strain and are not listed here.

[0121] Example 3 Comparison of the synthesis of rebaudioside M2 ​​by the unmutated strain and the mutant strain

[0122] The unmutated strain and the mutant bacteria were used to catalyze the substrate rebaudioside D to synthesize rebaudioside M2 ​​under the same catalytic reaction conditions. Samples were taken after 36 hours and the samples were processed and then analyzed by HPLC.

[0123] The catalytic reaction system is: rebaudioside D, sucrose, crude enzyme 10 mg / mL, 100 mM potassium phosphate buffer at pH 7.2, and the mass ratio of rebaudioside D to sucrose is 1:5. The catalytic reaction conditions are 37°C and 200 rpm. When the substrate addition amount in the catalytic reaction system is 100 g / L rebaudioside D and 500 g / L sucrose, Table 3 is obtained.

[0124] The results are shown in Table 3. Within 36 hours of reaction, the mutant strain had the highest catalytic synthesis yield of rebaudioside M2 ​​compared with the non-mutated strain, and the concentration of the final product rebaudioside M2 ​​reached 116.7 g / L, achieving efficient catalytic synthesis of rebaudioside M2.

[0125] Table 3. Comparison of the concentration of RM2 synthesized by mutants and control group

[0126]

Claims

1. A glycosyltransferase mutant, characterized in that: The glycosyltransferase mutant is the following A1) or A2): A1) is a protein having more than 90% identity with the original protein and having the same function as the original protein obtained by replacing the amino acid residues in the amino acid sequence shown in SEQ ID NO. 20; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1).

2. The glycosyltransferase mutant according to claim 1, characterized in that The glycosyltransferase mutant is a protein obtained by replacing the amino acid sequence shown in SEQ ID NO.20 with one or more of the following amino acid residues: B1) The amino acid at position 10 was mutated from alanine (A) to valine (V); B2) amino acid 51 was mutated from glutamine (Q) to lysine (K); B3) amino acid 72 mutated from phenylalanine (F) to leucine (L); B4) the amino acid at position 87 was mutated from leucine (L) to proline (P); B5) The amino acid at position 123 was mutated from leucine (L) to proline (P); B6) The amino acid at position 157 was mutated from leucine (L) to proline (P); B7) The amino acid at position 219 was mutated from asparagine (N) to aspartic acid (D); B8) The amino acid at position 380 was mutated from glycine (G) to leucine (L); B9) The 400th amino acid was mutated from serine (S) to arginine (R).

3. Biomaterial, characterized in that The biological material is any one of the following C1) to C5): C1) A nucleic acid molecule encoding the protein according to claim 1 or 2; C2) an expression cassette containing the nucleic acid molecule described in C1); C3) a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) a recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2).

4. A method for synthesizing rebaudioside M2 ​​using a glycosyltransferase mutant, characterized in that: The steps include: 1) constructing a recombinant strain containing a dual-enzyme co-expression system: constructing the coding gene of the glycosyltransferase mutant described in any one of claims 1 to 4 and the sucrose synthase gene into an expression vector to obtain a recombinant plasmid, and transforming the recombinant plasmid into a host bacterium to obtain a recombinant strain containing a dual-enzyme co-expression system; 2) inducing the recombinant strain to express the glycosyltransferase mutant and sucrose synthase; 3) using the two enzymes in step 2) to generate rebaudioside M2 ​​using rebaudioside D and sucrose as raw materials; 5. The method according to claim 4, characterized in that The expression vector is pRSFDuet-1.

6. The method according to claim 4, characterized in that The final concentration of the inducer used in the induction expression in step 2) is 0.02-1 g / L, and the induction time is 4-50 h.

7. The method according to claim 4, characterized in that Step 2) includes the steps of collecting bacterial cells, breaking the bacteria and collecting the supernatant by centrifugation to obtain crude enzyme.

8. The method according to claim 7, characterized in that In step 3), the concentration of rebaudioside D is 1-500 g / L; the concentration of sucrose is 1-1500 g / L; and the amount of crude enzyme added is 1-100 g / L.

9. The method according to claim 4, characterized in that The host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

10. The method according to any one of claims 4 to 9, characterized in that: The rebaudioside D is synthesized by catalysis of glycosyltransferase using rebaudioside A as a substrate.

Images