Nucleic acid aptamer-based covalent lysosome targeting chimera and application thereof in protein degradation and immunotherapy

Abstract

The invention discloses a covalent lysosome targeting chimera based on a nucleic acid aptamer and application of the covalent lysosome targeting chimera in protein degradation and immunotherapy, and belongs to the technical field of biology. The invention designs a covalent lysosome targeting chimera with click chemical reaction activity, and the simple and efficient covalent lysosome targeting chimera is used for realizing efficient protein degradation at the levels of cells and living bodies. When the tool is used for targeted degradation of immunotherapy biomarkers, immunogenic apoptosis of tumor cells can be caused, so that killing of an immune system to tumors is more efficiently activated. Meanwhile, the covalent lysosome targeting chimera overcomes the problem of immune-related side effects confronted by existing antibodies and polysaccharide peptide drugs, and can effectively avoid the potential occurrence risk of the immune-related side effects while efficiently degrading the target protein.

Description

Technical Field

[0001] The invention relates to a covalent lysosome targeting chimera based on nucleic acid aptamers and application thereof in protein degradation and immunotherapy, belonging to the field of biotechnology. Background Art

[0002] In recent years, as scientists have deepened their understanding of protein homeostasis maintenance and protein degradation pathways in the body, a protein degradation targeting chimera (PROTAC) structure based on the principle of "ubiquitin-mediated protein degradation" has been created. In short, PROTAC molecules simultaneously bind to the target protein and ubiquitin ligase (E3), and then through the synergistic action of a series of ubiquitin activating enzymes (E1) and ubiquitin conjugating enzymes (E2), the target protein is labeled with ubiquitin, so that it is considered to be a defective or damaged protein and then degraded in the 26S proteasome. Because the ubiquitination process occurs in the cytoplasm, PROTAC technology is currently basically used to achieve targeted degradation of cytoplasmic proteins. In order to further achieve specific degradation of cell membrane proteins, American chemist Professor Carolyn Bertozzi pioneered the development of lysosome-targeted chimeras in 2020 to pull cell membrane proteins to lysosomes for degradation. This lysosome-targeted chimera targets the target protein through an antibody at one end and targets the cation-independent mannose 6-phosphate receptor (CI-M6PR) at the other end through an oligosaccharide peptide group. During the lysosomal shuttling process of CI-M6PR, the target protein can be "hijacked" into the lysosome to achieve its complete degradation. In order to further achieve the tissue targeting of the lysosome-targeted chimera, the Bertozzi group used the asialoglycoprotein receptor (ASGPR) specifically expressed by hepatocytes, and designed a liver-specific lysosome-targeted chimera by coupling poly-N-acetylgalactosamine (GalNAc) that can target ASGPR with an antibody that recognizes the target protein. At the same time, the Weiping Tang group also reported on the study of GalNAc-LYTAC, which is used to degrade extracellular proteins of liver cells. In theory, the lysosome-targeted chimera technology can mediate the degradation of any target protein on the cell surface through ligand design, including traditional undruggable targets, thus breaking through the development ideas of traditional drugs and having exciting application prospects.

[0003] Since the lysosomal shuttling receptors (CI-M6PR and ASGPR) targeted by the above-mentioned lysosomal targeting chimera molecules are chemically synthesized non-natural polyglycopeptide molecules, their synthesis and modification steps are complicated, costly, and may produce strong immunogenicity in vivo, lysosomal targeting chimeras based on nucleic acid aptamers have recently begun to gain attention. Compared with polypeptide molecules, nucleic acid aptamers have lower immunogenicity, are easy to chemically synthesize and modify, have higher chemical stability and higher affinity. For example, Zhi Zhu's research group modified GalNAc at the end of the platelet-derived growth factor (PDGF) nucleic acid aptamer through solid-phase chemical synthesis, and constructed a nucleic acid aptamer-based lysosomal targeting chimera, which is used to bring PDGF into the lysosome to achieve its complete degradation in the liver.

[0004] However, the above-mentioned lysosome-targeting chimera molecular tools mainly recognize and bind to target proteins through non-covalent bonds. Although they can have good target protein recognition specificity and affinity in vitro, when this technology is applied to the body for disease treatment, the binding efficiency of the lysosome-targeting chimera with the target protein is very likely to be affected in the extremely complex environment in the body, thereby weakening the degradation efficiency and actual application effect of the lysosome-targeting chimera, making it difficult to achieve the clinical application of LYTAC. Summary of the invention

[0005] To solve the above problems, the first object of the present invention is to provide a covalent lysosomal targeting chimera based on nucleic acid aptamers, whose molecular structure includes three parts: a first sequence, a second sequence modified by a first group, and a third sequence connecting the first sequence and the second sequence; wherein the first sequence includes a nucleic acid aptamer targeting a lysosomal shuttle receptor, the second sequence includes a nucleic acid aptamer targeting a target protein, and the first group is a group used for covalent connection.

[0006] Furthermore, the lysosomal shuttling receptor includes a cation-independent mannose 6-phosphate receptor (CI-M6PR), an asialoglycoprotein receptor (ASGPR) or a scavenger receptor.

[0007] Furthermore, the first sequence is shown as SEQ ID NO. 1. Specifically:

[0008] GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC.

[0009] Furthermore, the second sequence is shown in SEQ ID NO.2-4. Specifically:

[0010] SEQ ID NO.2 (nucleotide sequence of nucleic acid aptamer targeting PD-L1):

[0011] ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT;

[0012] SEQ ID NO.3 (nucleotide sequence of nucleic acid aptamer targeting EpCAM):

[0013] CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG;

[0014] SEQ ID NO.4 (nucleotide sequence of a nucleic acid aptamer targeting nucleolin):

[0015] GGTGGTGGTGGTTGTGGTGGTGGTGG.

[0016] Furthermore, the third sequence is an oligonucleotide chain with 3-20 bases.

[0017] Furthermore, the third sequence = 3-9T, 3-9A, 3-9G, 3-9C, etc.

[0018] Furthermore, after the first group is modified onto the nucleic acid aptamer targeting the target protein, the first group is covalently coupled to the target protein containing the second group.

[0019] Furthermore, the first group includes but is not limited to a dibenzocyclooctyne group (DBCO), a trans-cyclooctene group (TCO), a bicyclo[6.1.0]nonyne group (BCN), and the like.

[0020] Furthermore, the target protein includes a target cell membrane surface glycoprotein.

[0021] Furthermore, the target proteins include but are not limited to PD-L1, epithelial cell adhesion molecule (EpCAM), nucleolin, mucin 1 (MUC1), human epidermal growth factor receptor 2 (HER2), protein tyrosine kinase 7 (PTK7), mesenchymal epidermal transition factor (c-Met), vascular endothelial growth factor (VEGF), etc.

[0022] The second object of the present invention is to provide a protein degrading agent, which comprises: (1) a first preparation containing the above-mentioned covalent lysosomal targeting chimera, and (2) a second preparation containing a group (second group) that can be covalently linked to the first group, and the preparation is used for in vitro treatment or in vivo injection.

[0023] Furthermore, the second group includes but is not limited to an azide group and the like.

[0024] Furthermore, the protein degrading agent may be an in vitro protein degrading agent or an in vivo protein degrading agent.

[0025] Furthermore, when used for in vitro degradation, the target cell is treated with a second agent so that the target protein on the target cell is connected to the second group. In an embodiment of the present invention, tetraacylated N-azidoacetylmannosamine (also known as Ac4ManNAz) is selected as the second agent for in vitro treatment to express glycoproteins on the surface of the target cell containing an azide group. After Ac4ManNAz is added to the culture medium and the target cells are cultured for a period of time, the glycoproteins on the surface of the target cells can be incorporated with an azide group for click chemistry reaction with the first agent and covalent coupling on the surface of the tumor cells.

[0026] Furthermore, when used for in vivo degradation, the second preparation is injected into the body to incorporate the second group into the target protein. Specifically, at the in vivo level, Ac4ManNAz can be introduced into the body by methods including but not limited to intraperitoneal injection and intravenous injection, so that the azide group is incorporated into the target protein in the body.

[0027] The target protein includes a target cell membrane surface glycoprotein.

[0028] The third object of the present invention is to provide the use of the above covalent lysosome targeting chimera in the preparation of protein degradation agents.

[0029] The fourth object of the present invention is to provide the use of the above-mentioned covalent lysosome targeting chimera or protein degrader in the preparation of immunotherapy drugs.

[0030] Furthermore, the target protein is an immunotherapy biomarker.

[0031] Furthermore, the immunotherapy biomarker may be a marker highly expressed on the surface of tumor cells, such as immune checkpoint molecule PD-L1, epithelial cell adhesion molecule (EpCAM), nucleolin, mucin 1 (MUC1), human epidermal growth factor receptor 2 (HER2), protein tyrosine kinase 7 (PTK7), mesenchymal epidermal transition factor (c-Met), vascular endothelial growth factor (VEGF). For example, in one embodiment of the present invention, through the lysosomal shuttling activity of CI-M6PR, the protein degrader can promote the degradation of PD-L1 in lysosomes, and the protein degrader is used to achieve efficient PD-L1 degradation at the cellular and in vivo levels, thereby effectively blocking the PD-L1 / PD-1 signal axis and activating the immune system to kill tumors.

[0032] Beneficial effects of the present invention:

[0033] (1) The preparation method of the covalent lysosomal targeting chimera of the present invention based on the preparation and modification of nucleic acid aptamers is simpler and has the prospect of industrial synthesis; at the same time, nucleic acid aptamers have lower immunogenicity in vivo than antibodies, which can reduce the occurrence of immune-related side effects and have higher safety.

[0034] (2) In addition to using nucleic acid aptamers to target target proteins, the protein degrader of the present invention can also achieve efficient enrichment of covalent lysosomal targeting chimeras on the surface of tumor cells through click reactions, thereby improving the degradation efficiency of target proteins. Click reactions have the advantages of mild conditions, high selectivity, high reaction efficiency, stable binding, etc., and the effect is stable, which is conducive to the application of the protein degrader in the pharmaceutical and biotechnology industries.

[0035] (3) The present invention unexpectedly discovered that after the protein degrader efficiently degrades the glycoprotein on the surface of tumor cells, it can directly cause the immunogenic apoptosis of tumor cells, enhance the immunogenicity of tumor cells, and further directly cause antigen presentation and immune cell activation, thereby activating the anti-tumor immune response and achieving the effect of immunotherapy.

[0036] (4) The protein degradation agent of the present invention can effectively block the immune checkpoint signaling pathway after efficiently degrading immune checkpoint molecules at the in vivo level, thereby enhancing the expression of T lymphocytes, especially CD8 + The infiltration of T lymphocytes in tumor tissue relieves immunosuppression, thereby enabling immune cells to recognize and kill tumor cells. Combining the immunogenic apoptosis of tumor cells and the killing effect of immune cells, a better tumor suppression effect can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a schematic diagram of the working principle of protein degraders degrading PD-L1 on the surface of tumor cells;

[0038] Figure 2 It is a confocal fluorescence image of different samples in Example B combined with N3-B16F10 tumor cells and endocytosis;

[0039] Figure 3 are representative graphs and statistical graphs of flow cytometry data of different samples inducing PD-L1 degradation in Example C1;

[0040] Figure 4 is a Western blot of different samples in Example C2 that induce PD-L1 degradation;

[0041] Figure 5 is a Western blot of different samples in Example C3 that induce PD-L1 degradation;

[0042] Figure 6 is a statistical graph of the apoptosis ratio of N3-B16F10 tumor cells induced by different samples in Example D;

[0043] Figure 7 It is a confocal fluorescence image for verifying the effect of different samples on the expression of calreticulin on the surface of N3-B16F10 tumor cells in Example D;

[0044] Figure 8 (a) is a schematic diagram describing the mouse tumor treatment process in Example E1; Figure 8 Middle (b) is a graph showing the tumor growth curve of B16F10 tumor-bearing mice after injection of different samples;

[0045] Fig. 9 is a Western blot of the expression of PD-L1 in tumor tissues of B16F10 tumor-bearing mice after injection of different samples for treatment in Example E2;

[0046] Fig.10 is a statistical diagram of the percentage of mature DC cells in the lymph nodes of B16F10 tumor-bearing mice after injection of different samples in Example E2;

[0047] Fig.11 is a statistical graph showing the proportion of (a) CD3-positive cells and (b) CD3 CD4 double-positive cells or CD3 CD8 double-positive cells in the total number of tumor cell samples in the tumor tissue of B16F10 tumor-bearing mice after injection of different samples for treatment in Example E2;

[0048] Fig.12 is a statistical graph of interferon-γ concentration in tumor tissue of B16F10 tumor-bearing mice after injection of different samples for treatment in Example E2;

[0049] Fig.13 is a statistical graph of granzyme concentrations in tumor tissues of B16F10 tumor-bearing mice after injection of different samples for treatment in Example E2;

[0050] Fig.14 (a) is a schematic diagram describing the mouse tumor treatment process in Example E3; Fig.14 Middle (b) is a graph showing the tumor growth curve of B16F10 tumor-bearing mice after injection of different samples;

[0051] Fig.15 is a Western blot image of different samples inducing EpCAM degradation in Example F1;

[0052] Fig.16 This is a Western blot showing the degradation of nucleolin induced by different samples in Example F2. DETAILED DESCRIPTION

[0053] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0054] Definition of terms:

[0055] Noun or abbreviation Definition or description PROTAC proteolysis-targeting chimera LYTAC lysosome-targeting chimera DBCO-LYTAC LYTAC sequences modified with DBCO groups CI-M6PR Cation-independent mannose 6-phosphate receptor DBCO Dibenzocyclooctyne <![CDATA[Ac4ManNAz]]> Tetraacylated N-azidoacetylmannosamine ASGPR Asialoglycoprotein receptor GalNAc N-Acetylgalactosamine PD-L1 Programmed death ligand 1 PD-1 Programmed death receptor 1 PDGF Platelet-derived growth factor EpCAM epithelial cell adhesion molecule aptamer Aptamer IFN-γ Interferon-gamma BSA BSA SSB Single-chain binding protein FAM Carboxyfluorescein DPBS Dulbecco's Phosphate Buffered Saline Annexin V Annexin V PI Propidium iodide IgG IgG ELISA ELISA Graz B Granzyme B GAPDH Glyceraldehyde-3-phosphate dehydrogenase MG-132 Description: MG-132 is a proteasome inhibitor Hoechst Description: Nuclear dye, source: Thermo Fisher Scientific, Cat#62249

[0056] Example A. Design and construction of covalent lysosomal targeting chimeras

[0057] The 5' end of the near-covalent lysosomal targeting chimera is a nucleic acid aptamer region that recognizes PD-L1, and the 3' end is a nucleic acid aptamer region that recognizes CI-M6PR. The DBCO group is modified at the 5' end.

[0058] Specific sequence used: (base sequence from 5' to 3')

[0059] DBCO-LYTAC (3T-Linker):

[0060] (DBCO)-TTT-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT-TTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGG AC

[0061] DBCO-LYTAC (6T-linker):

[0062] (DBCO)-TTT-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCAC TGCCCGT-TTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTA GGAC

[0063] DBCO-LYTAC (9T-Linker):

[0064] (DBCO)-TTT-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCAC TGCCCGT-TTTTTTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGT TTAGGAC

[0065] DBCO-LYTAC 2 (6T-Linker):

[0066] (DBCO)-TTT-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGG GGGTTGGCCTG-TTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATC GTTTAGGAC

[0067] DBCO-LYTAC 3 (6T-linker):

[0068] (DBCO)-TTT-GGTGGTGGTGGTTGTGGTGGTGGTGG-TTTTTT-GGGC GCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC

[0069] LYTAC (6T-linker):

[0070] ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT-TTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC

[0071] LYTAC 2 (6T-linker):

[0072] CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCC TG-TTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGACLYTAC 3 (6T-linker):

[0073] GGTGGTGGTGGTTGTGGTGGTGGTGG-TTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC

[0074] DBCO-PDL1 apt:

[0075] (DBCO)-TTT-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT

[0076] PDL1 apt:

[0077] ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT

[0078] DBCO-EpCAM apt:

[0079] (DBCO)-TTT-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG

[0080] DBCO-AS1411 apt:

[0081] (DBCO)-TTT-GGTGGTGGTGGTTGTGGTGGTGGTGG

[0082] Example B. Covalent coupling of protein degraders on the cell surface and internalization demonstration experiments

[0083] B16F10 cells (mouse skin melanoma cells) were treated with 50 μM Ac4ManNAz for 72 hours, and then treated with 50 ng / mL IFN-γ for 24 hours to stimulate the expression of azide-labeled PD-L1 protein. After gentle washing with DPBS 3 times, 1 μM DBCO-LYTAC (labeled with a fluorescent group FAM) was added and incubated at different temperatures for 1 hour, and then the unbound nucleic acid aptamer was removed with DPBS, and then the non-covalently bound nucleic acid aptamer was eluted with 1 μM single-stranded binding protein. Finally, 1 μg / mL Hoechst was used to stain the cell nucleus. After staining, the binding of fluorescently labeled nucleic acid aptamers to cells was observed by laser scanning confocal microscopy. In this embodiment, the same concentration of DBCO-PDL1 apt was used as a control to compare the covalent binding of DBCO-LYTAC and DBCO-PDL1 apt to the azide-labeled B16F10 cell surface PD-L1 protein.

[0084] Experimental groups:

[0085] Example B1: DBCO-PDL1 apt (concentration of 1 μM, incubation at 4°C)

[0086] Example B2: DBCO-LYTAC (6T-linker) (concentration of 1 μM, incubation at 4° C.)

[0087] Example B3: DBCO-PDL1 apt (concentration of 1 μM, incubation at 37° C.)

[0088] Example B4: DBCO-LYTAC (6T-linker) (concentration of 1 μM, incubation at 37° C.)

[0089] Figure 2Confocal microscopy images show that since the fluidity of the cell membrane is almost inhibited at 4°C, the shuttling activity of CI-M6PR to lysosomes is also considered to be almost inhibited. In both Examples B1 and B2, it was observed that the FAM-labeled aptamers tended to bind to the cell surface, indicating the effectiveness of their covalent coupling on the cell surface. When the cell incubation temperature was adjusted to 37°C, the membrane fluidity was restored, and the Figure 2 It can be seen that the signal of FAM-labeled DBCO-LYTAC in Example B4 is mainly located inside the cell, while the signal of DBCO-PDL1 apt in Example B3 is still mostly located on the cell surface, indicating that the CI-M6PR binding sequence in DBCO-LYTAC can effectively mediate the internalization of the protein degrader and its entry into the cell by targeting the lysosomal shuttle receptor, which is a prerequisite for further inducing the degradation of PD-L1 in the lysosome.

[0090] Example C. Study on the degradation and mechanism of PD-L1 on cell surface by protein degraders

[0091] Example C1: Verification that protein degraders can degrade cell surface PD-L1

[0092] After B16F10 cells were treated with 50 μM Ac4ManNAz for 72 hours, they were treated with 50 ng / mL IFN-γ for 24 hours to stimulate the expression of azide-tagged PD-L1 protein. Subsequently, DPBS was gently washed three times, and 1 μM DBCO-LYTAC was added to the cell culture medium. The cells were cultured at 37°C for 12 hours, and the degradation of PD-L1 was verified by flow cytometry.

[0093] Experimental groups:

[0094] Example C1.1: blank control group;

[0095] Example C1.2: DBCO-PDL1 apt (concentration of 1 μM);

[0096] Example C1.3: DBCO-LYTAC (3T-linker) (concentration of 1 μM);

[0097] Example C1.4: DBCO-LYTAC (6T-linker) (concentration 1 μM);

[0098] Example C1.5: DBCO-LYTAC (9T-Linker) (concentration of 1 μM);

[0099] In order to enable the CI-M6PR aptamer and the PDL1 aptamer to recognize the target molecule without interfering with each other, it is necessary to introduce a flexible single-stranded DNA as a linker sequence before them. Here we designed three linker sequences of 3T, 6T, and 9T, and explored the effect of different numbers of linker sequences on the amount of PD-L1 degradation by protein degraders. Less than 3T may lead to excessive steric hindrance between the two aptamers, restraining each other and affecting their recognition of the target protein. More than 9T is not particularly necessary from an economic perspective.

[0100] Figure 3 Flow cytometry data showed that when a longer linker sequence (6T and 9T) was introduced between the two aptamers, about 72% of PD-L1 was effectively cleared, while the introduction of a shorter linker sequence (3T) resulted in about 29% of cell surface PD-L1 being effectively cleared. This indicates that when the covalent lysosome targeting chimera contains a longer linker sequence (6-9T), the molecular flexibility increases, which can induce more PD-L1 degradation. This result shows that the protein degrader described in the present invention can significantly reduce the level of PD-L1 content on the cell surface. The reduction in PD-L1 content helps immune cells (mainly T cells) to identify and kill tumor cells, thereby achieving better anti-tumor effects. In addition, increasing the length of the linker sequence can increase the flexibility of the covalent lysosome targeting chimera, further improve the effect of identifying the target protein, and thus improve the clearance efficiency of the protein degrader for PD-L1. Selecting 6T and 9T oligonucleotide chains as linker sequences to construct protein degraders has the beneficial technical effect of significantly reducing the level of PD-L1 content on the cell surface. When 6T is the linker sequence, cost, production efficiency and effectiveness of protein degraders can be taken into account, thereby achieving effective PD-L1 / PD-1 signaling pathway blocking and inducing immunogenic apoptosis of tumor cells.

[0101] Example C2: Study on the degradation efficiency of protein degraders

[0102] Experimental groups:

[0103] Example C2.1: blank control group;

[0104] Example C2.2: PDL1 apt (concentration: 1 μM);

[0105] Example C2.3: DBCO-PDL1 apt (concentration: 1 μM);

[0106] Example C2.4: LYTAC (6T-linker) (concentration: 1 μM);

[0107] Example C2.5: DBCO-LYTAC (6T-linker) (concentration: 1 μM);

[0108] To further confirm these results, we then compared the efficiency of PD-L1 degradation by non-covalent blocking (Example C2.2), covalent blocking (Example C2.3), non-covalent degradation (Example C2.4) and covalent degradation (Example C2.5). 5 After 12 hours, the content of PD-L1 on the cell surface was detected by Western blotting. The results are as follows Figure 4 As shown, there is almost no PD-L1 degradation in Example C2.2 and Example C2.3, while Example C2.5 contains 38% PD-L1, that is, 62% PD-L1 is degraded, and Example C2.4 still has 71% PD-L1 remaining, indicating that only 29% PD-L1 is degraded. The data show that the covalent effect formed by the click chemistry reaction between DBCO-LYTAC and the azide-modified PD-L1 on the surface of tumor cells plays an important role in promoting PD-L1 degradation, which means that the protein degrader of the present invention has a significant effect of improving the degradation efficiency of PD-L1.

[0109] Example C3: Study on the degradation mechanism of protein degraders

[0110] Experimental groups:

[0111] Example C3.1: blank control group;

[0112] Example C3.2: DBCO-LYTAC (6T-linker) (concentration: 1 μM);

[0113] Example C3.3: DBCO-LYTAC (6T-linker) (concentration: 1 μM) + chloroquine (concentration: 100 μM)

[0114] Example C3.4: DBCO-LYTAC (6T-linker) (concentration: 1 μM) + MG132 (concentration: 5 μM)

[0115] To investigate whether PD-L1 degradation occurs through lysosomes, 100nM FAM-labeled PD-L1 aptamer was used to locate PD-L1 protein, 50nM lysosomal red fluorescent probe was used to locate lysosomes, and 1μg / mL Hoechst was used to locate the cell nucleus by immunofluorescence staining, and then visualized by fluorescence co-localization under a laser scanning confocal microscope. In addition, lysosomal inhibitor chloroquine or proteasome inhibitor MG132 was added to the cell culture medium to incubate B16F10 cells, and then Western blotting was used to detect PD-L1 degradation in B16F10 cells to verify the lysosomal degradation pathway. The results are shown in Figure 5As shown, compared with Example C3.1, Example C3.2 degraded about 68% of PD-L1, and the amount of PD-L1 degradation in Example C3.3 was significantly less than that in C3.2, indicating that after the lysosome was inhibited, the degradation of PD-L1 was also significantly inhibited, but the degradation of PD-L1 in Example C3.4 was not significantly different from that in Example C3.2, that is, the protease inhibition pathway did not affect the process of PD-L1 degradation by the protein degrader described in the present invention, indicating that the degradation of PD-L1 is achieved through the lysosomal pathway, proving the effectiveness of the nucleic acid aptamer of the lysosomal shuttle receptor and the feasibility of the protein degrader.

[0116] Example D. Study on the promotion of immunogenic apoptosis of tumor cells by protein degraders

[0117] Because the intracellular domain of PD-L1 plays an important role in triggering intercellular signaling pathways and promoting tumor proliferation, we compared the effects of PD-L1 degradation and PD-L1 blockade on the immunogenic apoptosis of tumor cells.

[0118] Experimental groups:

[0119] Example D1: blank control group;

[0120] Example D2: DBCO-PDL1 apt (concentration: 1 μM);

[0121] Example D3: DBCO-LYTAC (6T-linker) (concentration: 1 μM);

[0122] Annexin V / PI staining was used to demonstrate that PD-L1 degradation induced tumor cell apoptosis. B16F10 cells pretreated with 50 μM Ac4ManNAz and 50 ng / mL IFN-γ were incubated with different samples at 37 °C for 24 h and then collected in 96-well V-bottom plates (1 × 10 5 Next, the cells were dispersed in staining buffer and incubated with 1 μL of Annexin V-FITC. Then 10 μL of propidium iodide was added and incubated for 20 minutes in the dark. Afterwards, the cells were immediately analyzed by flow cytometry. Figure 6 The results showed that compared with Example D1, the percentage of apoptotic cells in Example D3 increased sharply from 3% to 60%, while most cells in Example D2 were still in good condition, indicating that protein degraders can directly cause tumor cell apoptosis (i.e., immunogenic apoptosis), while DBCO-PDL1 apt cannot achieve the effect of cell apoptosis by simply blocking PD-L1.

[0123] Further, in order to study the exposure of CRT on the surface of tumor cells, cells treated with different samples for 24 hours were first incubated in 0.5% BSA for 30 minutes, then incubated with the primary antibody of CRT at 4°C for 24 hours, and then incubated with the secondary antibody Alexa Fluor 488-goat anti-rabbit IgG (H&L) at room temperature for 2 hours. Then, the cells were fixed with 4% paraformaldehyde and the cell nuclei were stained with Hoechst. Finally, laser scanning confocal microscopy was used for observation. Figure 7 The results showed that the exposure of cell surface reticular protein increased in Example D3, indicating that the degradation of PD-L1 by protein degraders will increase the immunogenicity of tumor cells, thereby achieving the effect of immunogenic apoptosis of tumor cells. This result shows that protein degraders can block immune escape by degrading PD-L1 on the surface of tumors, and can also cause immunogenic apoptosis of tumor cells and release antigens, thereby increasing the response efficiency and strength of immune cells, which helps to greatly improve the effect of anti-tumor immunotherapy.

[0124] Example E. Study on the tumor treatment effect of protein degraders

[0125] Example E1. Study on the therapeutic effect of protein degraders on immune checkpoint degradation

[0126] Mouse Melanoma Model Treatment Protocol:

[0127] like Figure 8 As shown in a, B16F10 tumor cells were subcutaneously inoculated in the right hind leg of C57BL / 6 mice (6-8 weeks old), and the mice were randomly divided into five groups after inoculation. From the second day, Ac4ManNAz (30 mg / kg) was intraperitoneally injected into the mice (Examples E1.2, E1.3 and E1.5) for 5 consecutive days to make the mice express azide-labeled PD-L1. When the tumor reached about 25 mm 3 After starting treatment:

[0128] Example E1.1: blank control group;

[0129] Example E1.2: Ac4ManNAz;

[0130] Example E1.3: DBCO-PDL1 apt+Ac4ManNAz (DBCO-PDL1 apt was administered intravenously at a dose of 100 nmol / kg, once every 2 days, for a total of 4 times);

[0131] Example E1.4: DBCO-LYTAC (6T-linker) (administered intravenously starting on the same day as DBCO-PDL1 apt, at a dose of 100 nmol / kg, once every 2 days, for a total of 4 times);

[0132] Example E1.5: DBCO-LYTAC (6T-linker) + Ac4ManNAz (DBCO-LYTAC was administered intravenously starting on the same day as DBCO-PDL1apt, with a dose of 100 nmol / kg, once every 2 days, for a total of 4 times);

[0133] When the tumor volume reaches about 25mm 3 After that, the first intravenous injection of nucleic acid ligand was performed and recorded as day 0. The drugs were administered by intravenous injection on days 0, 2, 4, and 6 according to the above grouping. From day 0, the size of the mouse tumor was monitored and its growth curve was calculated. The weight of the mice was monitored and their mental state, activity and eating were observed.

[0134] Figure 8 b The results of tumor treatment showed that Ac4ManNAz treatment alone had no effect on tumor inhibition (ie, Example E1.2), and the use of DBCO-LYTAC alone on mice without Ac4ManNAz treatment could only bring limited effects on inhibiting tumor growth (ie, Example E1.4). On the contrary, after covalent degradation treatment (ie, Example E1.5), the growth of mouse tumors was greatly inhibited. As can be seen from the data, Example E1.5 showed better therapeutic effects than Example E1.3, proving the importance of complete degradation of PD-L1 in vivo for inhibiting tumor growth. It shows that immune checkpoint degradation therapy based on protein degraders has a good therapeutic effect and is beneficial for inhibiting tumor growth. DBCO-LYTAC mainly utilizes azido sugars modified on the cell surface to improve the binding efficiency and binding strength with the target protein. At the same time, the mental state, activity and eating conditions of each group of mice were observed during the treatment, and no significant differences were found between the groups, which to a certain extent illustrates the safety of the protein degrader described in the present invention.

[0135] Example E2. Study on anti-tumor immune response of protein degraders

[0136] To further investigate this mechanism, we investigated whether protein degrader-induced PD-L1 degradation could induce a strong anti-tumor immune response. To this end, we inoculated B16F10 tumors into C57BL / 6 mice, and randomly divided the mice into five groups after inoculation. From the second day, the mice (Examples E2.2, E2.3 and E2.5) were intraperitoneally injected with Ac4ManNAz (30 mg / kg) for 5 consecutive days to make the mice express azide-labeled PD-L1. When the tumor reached about 25 mm 3 After starting treatment:

[0137] Example E2.1: blank control group;

[0138] Example E2.2: Ac4ManNAz;

[0139] Example E2.3: DBCO-PDL1 apt+Ac4ManNAz (the administration method, dosage and frequency of DBCO-PDL1 apt are the same as those in Example E1.3);

[0140] Example E2.4: DBCO-LYTAC (6T-linker) (DBCO-LYTAC administration method, dosage and frequency are the same as in Example E1.4);

[0141] Example E2.5: DBCO-LYTAC (6T-linker) + Ac4ManNAz (the administration method, dosage and frequency of DBCO-LYTAC are the same as those in Example E1.5).

[0142] When the tumor volume reaches about 25mm 3 After that, the first intravenous injection of nucleic acid ligand was performed and recorded as day 0, and the drugs were administered by intravenous injection on days 0, 2, 4, and 6 according to the grouping. After the treatment, the lymphatic tissue and tumor tissue of the mice were collected on the 9th day, and some tumor tissues were used for in vivo protein blotting experiments; the remaining tumor tissue and lymphatic tissue were homogenized and filtered to collect single cell suspensions, and the infiltration of immune cells in them was analyzed by flow cytometry. In addition, the supernatant of tumor tissue homogenization was collected, and the cytokine level in the tumor tissue was analyzed by ELISA, which was used as an indicator to evaluate the effects of different treatment regimens on the tumor suppressive immune microenvironment.

[0143] We first demonstrated the effectiveness of protein degraders in degrading PD-L1 in vivo through Western blotting experiments. Fig. 9 It was shown that the protein degrader in Example E2.5 could induce a decrease of about 70% in PD-L1, while in Example E2.4, PD-L1 was only reduced by about 27%, indicating that the covalent effect of the protein degrader in Example E2.5 could greatly enhance the PD-L1 degradation efficiency at the in vivo level.

[0144] Fig.10 The results showed that the maturation level of dendritic cells (DC cells) in the mouse lymph nodes in Example E2.5 reached about 60%, which was higher than that in Examples E2.1-2.4, indicating that protein degraders are most efficient in promoting the antigen presentation process. In addition, we studied tumor infiltrating lymphocytes (TILs) in tumor tissues. Fig.11 The results showed that the covalent degradation treatment in Example E2.5 promoted the infiltration of T lymphocytes into tumor tissues most significantly, with CD3-positive T lymphocytes accounting for about 9% of the tumor tissues, while the non-covalent degradation treatment in Example E2.4 could only promote the infiltration of about 3% of CD3-positive T lymphocytes. +) found that the proportion of cytotoxic T cells in Example E2.5 increased significantly, indicating that the protein degrader can significantly enhance cellular immunity and induce better tumor killing effect; Figure 12-13 The results showed that the protein degrader in Example E2.5 also produced higher IFN-γ and granzyme B (Graz B) than other control groups. The above results indicate that the protein degrader can effectively reverse the immunosuppressive microenvironment of the tumor and enhance the anti-tumor immune response.

[0145] Example E3. Comparison of protein degrader-based immune checkpoint degradation therapy and antibody-based immune checkpoint blockade therapy

[0146] B16F10 tumor cells were subcutaneously inoculated into the right hind leg of C57BL / 6 mice (6-8 weeks old). The mice inoculated with B16F10 tumor cells were randomly divided into three groups:

[0147] Example E3.1: blank control group;

[0148] Example E3.2: PD-L1 antibody treatment group (administered intravenously with PD-L1 antibody at a dose of 15 μg / time / mouse, once every 2 days, for a total of 4 times);

[0149] Example E3.3: DBCO-LYTAC (6T-linker) + Ac4ManNAz treatment (the administration of Ac4ManNAz is the same as in Example E1.5, and DBCO-LYTAC is administered intravenously on the same day as the intravenous injection of PD-L1 antibody. The dosage is the same as that of the antibody group, and the drug is administered once every 2 days for a total of 4 times).

[0150] Starting from the first intravenous injection of nucleic acid aptamer / PD-L1, which was recorded as day 0, the above drugs were injected intravenously on days 0, 2, 4, 6, and 8, respectively. The tumor size of the mice was monitored from day 0, and its growth curve was calculated. At the same time, the weight of the mice was monitored, and their mental state, activity and eating habits were observed. Fig.14 The treatment results showed that the tumor volume of mice treated with Example E3.3 was significantly lower than that of Example E3.1 and Example E3.2, indicating that the immune checkpoint degradation therapy using protein degraders in Example E3.3 showed a better tumor inhibition effect than the traditional immune checkpoint blocking therapy. At the same time, the weight of mice in each group did not fluctuate significantly, and their activity and eating were normal, which to a certain extent showed that the immune checkpoint degradation therapy had good biosafety.

[0151] Example F. Protein degraders are used to degrade other pathogenic membrane proteins on the surface of tumor cells

[0152] Example F1. Degradation of epithelial cell adhesion molecule (EpCAM)

[0153] To demonstrate the versatility of this protein degrader platform, several other covalent lysosome-targeting chimeric structures were designed to degrade other highly expressed pathogenic membrane proteins present on the surface of different tumor cells. First, DBCO-LYTAC 2 (6T-linker) was designed for the epithelial cell adhesion molecule (EpCAM), which is overexpressed in breast cancer cells and is essential for the proliferation of tumor cells. The sequence is 5'-(DBCO)-TTT-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGG GTTGGCCTG-TTTTTT-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTT TAGGAC-3'. We compared the effects of covalent blocking, non-covalent degradation, and covalent degradation.

[0154] Experimental groups:

[0155] Example F1.1: blank control group;

[0156] Example F1.2: DBCO-EpCAM apt (concentration: 1 μM);

[0157] Example F1.3: LYTAC 2 (6T-linker) (concentration: 1 μM);

[0158] Example F1.4: DBCO-LYTAC 2 (6T-Linker) (concentration: 1 μM).

[0159] First, EpCAM-positive 4T1 cells (mouse breast cancer cells) were treated with 50 μM Ac4ManNAz for 3 days to achieve EpCAM azide labeling. After co-incubation with the azide-labeled 4T1 cells with different samples for 24 hours, the degradation of EpCAM was verified by Western blotting. Fig.15 It can be seen that the covalent blocking in Example F1.2 has little effect on the level of EpCAM on the surface of 4T1 cells, while the non-covalent degradation corresponding to Example F1.3 can induce about 30% EpCAM downregulation, and the covalent degradation corresponding to Example F1.4 further enhances this trend to ~65%, indicating that the protein degrader can achieve significant EpCAM clearance by covalent degradation, thereby effectively inhibiting the proliferation of 4T1 tumor cells.

[0160] Example F2. Degradation of nucleolin

[0161] The covalent degradation ability of protein degraders against another frequently targeted membrane glycoprotein, nucleolin, was studied in HeLa cells (human cervical cancer cells). Nucleolin is overexpressed in malignant tumors, affecting the proliferation, apoptosis, metastasis and other processes of tumor cells, promoting the occurrence and development of tumors. Therefore, in order to achieve efficient degradation of nucleolin, another DBCO-LYTAC 3 (6T-linker) targeting nucleolin was designed based on the AS1411 nucleic acid aptamer, and the effects of covalent blocking, non-covalent degradation and covalent degradation were compared. Among them, the sequence of DBCO-LYTAC 3 (6T-linker) is 5'-(DBCO)-TTT-GGTGGTGGTGGTTGTGGTGGTGGTGG-TTTTTT-GGGCGCGTAGATGA CGAGCAGTCCTAACATCGTTTAGGAC-3'.

[0162] Experimental groups:

[0163] Example F2.1: blank control group;

[0164] Example F2.2: DBCO-AS1411 apt (concentration: 1 μM);

[0165] Example F2.3: LYTAC 3 (6T-linker) (concentration: 1 μM);

[0166] Example F2.4: DBCO-LYTAC 3 (6T-Linker) (concentration: 1 μM).

[0167] First, nucleolin-positive human cervical cancer cell HeLa cells were treated with 50μM Ac4ManNAz for 3 days to achieve azide labeling of nucleolin, and then incubated with different samples for 24 hours, and the degradation of nucleolin by covalent lysosomal targeting chimera was verified by Western blotting experiments. The results showed that both covalent blocking (corresponding to Example F2.2) and non-covalent degradation (corresponding to Example F2.3) could induce a decrease in nucleolin by about 25%, while covalent degradation (corresponding to Example F2.4) could enhance the induction of a 71% decrease in nucleolin, showing a significantly better ability to degrade nucleolin ( Fig.16 ). This indicates that the covalent lysosome targeting chimera described in the present application can be applied to the specific degradation of various cell membrane surface proteins and has the potential to expand its application scenarios.

[0168] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A covalent lysosomal targeting chimera based on nucleic acid aptamers, characterized in that: The covalent lysosomal targeting chimera includes a first sequence, a second sequence modified by a first group, and a third sequence connecting the first sequence and the second sequence; wherein the first sequence includes a nucleic acid aptamer targeting a lysosomal shuttle receptor, the second sequence includes a nucleic acid aptamer targeting a target protein, and the first group is a group for covalent connection.

2. The covalent lysosomal targeting chimera according to claim 1, characterized in that: The first group includes a dibenzocyclooctyne group, a trans-cyclooctene group or a bicyclo[6.1.0]nonyne group.

3. The covalent lysosomal targeting chimera according to claim 1, characterized in that: The third sequence is an oligonucleotide chain with 3-20 bases.

4. A protein degradation agent, characterized in that The protein degrader comprises: (1) a first formulation comprising the covalent lysosomal targeting chimera of any one of claims 1 to 3, and (2) a second formulation comprising a second group, wherein the second group can be covalently linked to the first group.

5. The protein degradation agent according to claim 4, characterized in that: The target cells are treated with a second agent so that the target protein is modified with a second group.

6. The protein degradation agent according to claim 4, characterized in that: The first group is covalently linked to the second group via a click reaction.

7. The protein degradation agent according to claim 6, characterized in that: The second group includes an azide group.

8. The protein degradation agent according to claim 4, characterized in that: The target protein includes a target cell membrane surface glycoprotein.

9. Use of the covalent lysosomal targeting chimera according to any one of claims 1 to 3 or the protein degrader according to any one of claims 4 to 8 in the preparation of immunotherapy drugs.

10. The use according to claim 9, characterized in that: The target protein is an immunotherapy biomarker.

Images