Transcription factor gene for promoting adventitious root generation of apple dwarf rootstock and regulation and control method

Abstract

The invention discloses a transcription factor gene for promoting adventitious root generation of apple dwarf rootstock and a regulation and control method, and belongs to the technical field of plant genetic engineering. The method comprises the following specific regulation and control operations: cloning a transcription factor gene shown as SEQ ID No.1 in a nucleotide sequence table to an overexpression vector in an apple dwarfing rootstock with difficulty in adventitious root generation; transferring agrobacterium tumefaciens EHA105 by using a freeze thawing method to obtain strain cells, and culturing in a culture medium; centrifugally collecting thalli, and suspending with an infection solution to obtain an infection buffer solution; immersing the apple dwarf rootstock tissue culture seedlings in the infection buffer solution, and carrying out vacuum treatment; and culturing in a cuttage culture medium, and obtaining transplanted seedlings when the length of adventitious roots is greater than 10mm and the rooting number is greater than 3 and reaches the transplanting standard. The instant infection and sugar-free culture technology provided by the invention can quickly promote the occurrence of the dwarf rootstock adventitious roots without a tissue culture technology, and has important economic and social benefits for improving the occurrence of the apple dwarf rootstock adventitious roots.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to the regulation of an apple transcription factor gene MdANT in promoting the rooting of apple dwarf rootstocks. Background Art

[0002] In 2020, my country's annual apple production was 44.066 million tons, accounting for 15% of the country's total fruit production. Dwarfing, dense planting and intensive production are important trends in the development of the apple industry, and are also the main reform direction of modern apple cultivation systems and models. Traditional dwarfing self-rooted rootstocks are mostly propagated by layering, cuttings and plant tissue culture. The layering and tissue culture breeding procedures are cumbersome, costly and have a low breeding coefficient. Compared with layering and tissue culture, green branch cuttings have high efficiency, short seedling cycle, low seedling cost, and are easy to industrialize. However, the limiting factor is that adventitious roots are difficult to occur, and the mechanism affecting the occurrence of adventitious roots is not clear.

[0003] During the development of trees, compared with the adult stage, young trees have better rooting ability and more vigorous growth and development, but as the trees grow gradually, these advantages will gradually disappear. Experiments have shown that the transition of individual development stages will affect the ability of adventitious roots, and the age of the plant is negatively correlated with the adventitious rooting ability of cuttings. It is a common phenomenon that cuttings in the juvenile stage are easy to root, while cuttings in the adult stage are difficult to root, which is a common phenomenon in most woody plants. For example, the rooting rate of juvenile cuttings of the apple dwarf rootstock 'Xiaojin Haitang' is 94%, which is significantly higher than the rooting rate of adult cuttings, indicating that juvenility is an important factor in the occurrence of adventitious roots in apple rootstocks.

[0004] Studies have shown that continuous subculture by tissue culture can achieve the restoration of apple rootstocks to juvenile status. The leaves of the apple dwarfing rootstock 'Xiaojin Haitang' are entire in the mature stage, while the leaves of the juvenile stage are nicked. After about one year of subculture to the 15th generation, the degree of leaf nicking is consistent with that of the juvenile stage, showing signs of restoration to juvenile status, and the rooting ability has returned to the juvenile level. The mature stem tips of the apple dwarfing rootstock 'M9T337' and another apple dwarfing rootstock 'SH6' were used as materials, and the restoration of juvenile status was achieved by stem segment subculture, which significantly improved the rooting ability of green branch cuttings. However, the growth cycle of continuous stem segment subculture is long, and genetic variation is prone to occur during tissue culture, and certain genetic variation will occur with the increase of subculture number.

[0005] The occurrence of adventitious roots in apple dwarfing rootstocks is regulated by multiple transcription factors and genes. Clarifying the mechanism of action of transcription factors in promoting adventitious roots in apple dwarfing rootstocks provides a new direction for apple fruit tree cultivation. Therefore, the ethylene response element binding protein AP2 / ERF family is a large gene family that is widely involved in plant primary and secondary metabolism processes and plant growth and development stages. The ANT gene belongs to the AP2 subfamily in AP2 / ERF, and this gene is involved in the regulation of plant development processes. Recent studies have revealed that ANT plays an important role in plant development stages, but its role in the occurrence of adventitious roots in apple dwarfing rootstocks has not been publicly reported. Summary of the invention

[0006] In order to solve the problem that the apple dwarf rootstock 'M9T337' is difficult to root during the cutting process, the present invention provides a transcription factor gene and a regulation method for promoting adventitious rooting of the apple dwarf rootstock.

[0007] The invention discloses an application of a transcription factor gene shown in a nucleotide sequence table SEQ ID NO.1 in promoting the occurrence of adventitious roots in apple dwarfing rootstocks. In apple dwarfing rootstocks where adventitious roots are difficult to occur, the transcription factor gene shown in the nucleotide sequence table SEQ ID NO.1 is cloned into a plant overexpression vector, and the transcription factor gene is transiently overexpressed by using instantaneous vacuum extraction and sugar-free culture technology to promote the occurrence of adventitious roots in apple dwarfing rootstocks.

[0008] Based on the regulation method of the transcription factor gene shown in nucleotide sequence table SEQ ID NO.1 in promoting adventitious rooting of apple dwarf rootstock, the operation steps are as follows:

[0009] (1) The transcription factor gene shown in SEQ ID NO.1 in the nucleotide sequence table was cloned into the plant overexpression vector pRI101-AN to obtain a recombinant plasmid;

[0010] (2) transferring the recombinant plasmid into Agrobacterium tumefaciens EHA105 strain cells by freeze-thaw method to obtain strain cells;

[0011] (3) inoculating the strain cells into 200 mL of lysate broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at an inoculum volume ratio of 1:50 to obtain Agrobacterium bacterial liquid;

[0012] (4) shaking and culturing the Agrobacterium bacterial solution at 28° C. until the absorbance at a wavelength of 600 nm reaches 1.0, and collecting the bacterial cells by centrifugation to obtain the bacterial cells;

[0013] (5) adding the bacterial cells to 200 mL of infection solution, breaking up the bacterial cells, and suspending them at room temperature until the absorbance at a wavelength of 600 nm is 1, thereby obtaining an infection buffer solution;

[0014] (6) Immerse the apple dwarf rootstock tissue culture seedlings in the infection buffer and place them at -0.8 kg / cm 2 Under vacuum conditions, vacuum treatment was performed for 5 to 6 minutes, air was slowly released for 20 to 25 minutes, and the cells were rinsed with clean water to obtain tissue culture seedlings of transiently overexpressed apple dwarf rootstocks;

[0015] (7) Stir and mix 350 g of vermiculite and 1 L of nutrient solution to obtain a cutting medium, and insert the transiently overexpressed apple dwarf rootstock tissue culture seedlings into the cutting medium respectively; culture for 25 days in an environment with alternating light hours of 16 hours and dark hours, room temperature of 23 to 25°C, light intensity of 2000 to 4000 lx, and humidity of 75 to 80%, and count the number of roots and the length of adventitious roots;

[0016] Adventitious roots with a length greater than 10 mm and a number of roots greater than 3 meet the transplanting standards and are used as transplant seedlings.

[0017] The further technical solution is as follows:

[0018] In step (1), the overexpression vector is a plant binary expression vector (pRI101-AN).

[0019] In step (5), the infection solution is prepared by adding 1 mL of 1 mol / L fatty acid methyl ester sulfonate, 400 μL of 50 mmol / L acetosyringone and 1 mL of 1 mol / L magnesium chloride to 100 mL of distilled water and mixing them evenly. The pH value of the infection solution is 5.6.

[0020] In step (7), the nutrient solution is prepared by adding 2.3 g of 1 / 2MS culture medium, 0.6 g of 3-indolebutyric acid and 1 mL of 1 mol / L S206 plant fungicide to 1000 mL of distilled water and mixing them evenly.

[0021] The beneficial technical effects of the present invention are embodied in the following aspects:

[0022] (1) At present, there are many reports on the role of ANT in plant development stages, but there is no public report on its role in the occurrence of adventitious roots in apple dwarfing rootstocks. The present invention clarifies the mechanism of action of the apple transcription factor gene MdANT in regulating the occurrence of adventitious roots in apple dwarfing rootstocks from a molecular mechanism, providing a theoretical basis and gene resources for apple fruit tree cultivation. Transient infection experiments and physiological data measurement and analysis show that the occurrence of adventitious roots in apple dwarfing rootstocks can be promoted by overexpressing the transcription factor gene MdANT shown in the nucleotide sequence table SEQ ID NO.1.

[0023] The mechanism of the regulation and control operation steps of the present invention is described as follows:

[0024] In step (3), the strain cells are cultured in a lysate broth liquid culture medium containing kanamycin and rifampicin for the purpose of screening, and the strain cells are only cultured in the corresponding liquid culture medium.

[0025] In step (4), the purpose of culturing the Agrobacterium culture liquid until the absorbance value at a wavelength of 600 nm is 1.0 is that the absorbance value is an important indicator for measuring the concentration of the Agrobacterium culture liquid. The best growth period of Agrobacterium tumefaciens is when the absorbance value at a wavelength of 600 nm is 1.0, which indicates high activity and is conducive to improving the infection efficiency.

[0026] In step (5), the purpose of culturing the infection buffer until the absorbance at a wavelength of 600 nm is 1.0 is to make the ratio of strain cells in plant cells appropriate and to improve the infection efficiency by affecting the permeability of cell membranes.

[0027] (2) The present invention utilizes genetic engineering to overexpress the transcription factor MdANT gene in apple dwarfing rootstock varieties where adventitious roots are difficult to form, thereby increasing the rate of adventitious root formation in apple dwarfing rootstocks. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Venn diagram and KEGG pathway analysis diagram of differentially expressed genes between auxin and control, auxin + γ-aminobutyric acid and auxin for transcriptome data analysis.

[0029] Figure 2 This is a diagram showing the rooting conditions of adult and juvenile cuttings of the apple dwarfing rootstock 'Xiaojin Haitang' after auxin treatment.

[0030] Figure 3 This is a diagram showing the adventitious rooting ability of mature and young cuttings of the apple dwarfing rootstock 'M9T337'.

[0031] Figure 4 Diagram showing the role of overexpressed transcription factor gene MdANT in root regeneration. DETAILED DESCRIPTION

[0032] The present invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings.

[0033] The present invention has conducted in-depth research and isolated and cloned the apple MdANT gene from the apple dwarf rootstock 'M9T337'. The full-length CDS is 1956bp and is recorded in the Rosaceae database (https: / / www.rosaceae.org). As shown in the nucleotide sequence table SEQ ID NO.1, ATG represents the start codon and TAG represents the stop codon.

[0034] In order to study the function of the gene MdANT, the present invention constructs an overexpression vector of the transcription factor gene MdANT.

[0035] The construction of the gene overexpression vector is as follows:

[0036] The forward primer and reverse primer of the transcription factor gene MdANT were designed, and then the gene sequence was cloned from the cDNA of the apple dwarf rootstock 'M9T337', and constructed into the plant overexpression vector pRI101-AN using the double restriction sites of SacI and KpnI to form a recombinant plasmid, which was then transformed into Agrobacterium tumefaciens EHA105 strain cells by freeze-thaw method. The primer sequences are as follows:

[0037] First forward primer: CCGTCGACCCCGGGGATGAAGTCCATGAATGATCATAACA

[0038] First reverse primer: GATCGGGGAAATTCGCTAGGTCTCATTCCAGGCAGC

[0039] Transient infection experiments and physiological data measurement and analysis showed that overexpression of the transcription factor gene MdANT can promote the occurrence of adventitious roots in apple dwarfing rootstocks where adventitious roots have difficulty occurring.

[0040] The sources of the biological materials used in the following examples are described as follows:

[0041] The overexpression vector is a plant binary expression vector (pRI101-AN) purchased from Beijing Coolable Technology Co., Ltd. The DNA sequence of pRI101-AN is recorded in the instruction manual of the official website of Coolable Technology Co., Ltd.

[0042] Example 1: Cloning of the coding sequence and specific fragments of the apple MdANT gene

[0043] 1. RNA extraction and reverse transcription of apple dwarf rootstock 'M9T337'

[0044] 1.1 Plant total RNA extraction

[0045] 1) Take a 2 mL sterilized centrifuge tube, add alcohol-sterilized steel balls, sample the leaves of apple dwarf rootstock 'M9T337', freeze them in liquid nitrogen, and grind the samples with a tissue shaker;

[0046] 2) Add 800 μl of RNA extraction solution preheated at 65°C to the ground sample and vortex for 30-60 seconds to thoroughly homogenize the sample;

[0047] 3) Place the homogenized sample in a 65°C water bath for 10 minutes, inverting and mixing 3-5 times;

[0048] 4) After heating, add an equal volume of chloroform mixture (chloroform: isoamyl alcohol = 24:1), shake and mix for 3-5 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C;

[0049] 5) (All the following operations are performed on ice) Take 700 μl of the supernatant after centrifugation of the sample, add an equal volume of chloroform mixture (chloroform: isoamyl alcohol = 24:1), shake and mix for 3-5 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C;

[0050] 6) Take 500 μl of the supernatant after centrifugation, add an equal volume of chloroform mixture (chloroform: isoamyl alcohol = 24:1), shake and mix for 3-5 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C;

[0051] 7) Carefully aspirate 400 μl of the supernatant after centrifugation, add 200 μl of 10 mol / L lithium chloride into a 1.5 mL centrifuge tube, mix well and incubate at 4°C overnight for precipitation;

[0052] 9) Take out the liquid that has been left to settle overnight and centrifuge it at 12,000 rpm for 30 minutes at 4°C.

[0053] 10) After centrifugation, carefully pour off the supernatant, add 750 μl of anhydrous ethanol + 250 μl of DEPC water, flick off the bottom precipitate by hand, and centrifuge at 12,000 rpm for 7 minutes at 4°C;

[0054] 11) Pour off the supernatant after centrifugation; add 750 μl of anhydrous ethanol, flick off the bottom precipitate by hand, and centrifuge at 12,000 rpm for 7 minutes at 4°C;

[0055] 12) Pour off the supernatant after centrifugation, invert the centrifuge tube and place it on filter paper to absorb water. After absorbing all the water, place it on ice and blow dry it on a clean bench for 10 minutes;

[0056] 13) After drying, add 30 μl of DEPC water into the centrifuge tube and vortex to mix to obtain RNA solution;

[0057] The RNA solution was stored in a − 80 °C refrigerator. Before storage, the integrity of the RNA was checked by agarose gel electrophoresis and the concentration of RNA was determined on an Agilent 2100 Bioanalyzer (Santa Clara, CA, USA).

[0058] 2. Reverse transcription of RNA into cDNA

[0059] The samples were reverse transcribed using HiScript III All-in-one RT SuperMix Perfect for qPCR Kit (Novozymes, Nanjing). The specific steps are as follows:

[0060] 1) Reaction system preparation

[0061]

[0062] Use a pipette to gently pipette 8-10 times to mix thoroughly, and centrifuge briefly to collect the liquid at the bottom of the tube.

[0063] 2) Reaction procedure

[0064]

[0065] Obtain the reverse transcription product. The product can be used immediately for real-time fluorescence quantitative reverse transcription polymerase chain reaction, or stored at -20°C and used within half a year; for long-term storage, it is recommended to store at -80°C after aliquoting. Repeated freezing and thawing of cDNA should be avoided.

[0066] 2. Cloning of the MdANT gene coding sequence

[0067] The cDNA of 2 in step (i) of Example 1 was used as a template and amplified using KOD-FX (Toyobo, Shanghai) high-fidelity enzyme. The upstream and downstream gene primers of the coding sequence of MdANT are as follows:

[0068] Second forward primer: ATGAAGTCCATGAATGATCATAACA

[0069] Second reverse primer: CTAGGTCTCATTCCAGGCAGC

[0070]

[0071] (ii) PCR reaction program: pre-denaturation at 94°C for 2 minutes; cycle parameters: denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 68°C for 120 seconds, for 35 cycles; full extension at 72°C for 5 minutes.

[0072] After the PCR reaction, the PCR product was recovered, connected to the cloning vector TOPO, transformed into Escherichia coli DH5α strain cells, and spread on Luria-Bertani solid culture medium with 50 mg / L kanamycin. The culture was incubated at 37°C overnight, and a single colony was selected and sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequencing results were blasted against the Rosaceae database (https: / / www.rosaceae.org). The sequence shown in the clone was consistent with the MD15G1064600 sequence, namely the MdANT gene.

[0073] Example 2: MdANT expression is positively correlated with rooting ability of apple dwarfing rootstock cuttings

[0074] The present invention relies on molecular bioengineering to find a transcription factor gene to promote the rapid occurrence of adventitious roots in apple dwarf rootstocks. After the apple dwarf rootstock 'M9T337' tissue culture seedlings were treated with MS medium, MS medium + auxin (IBA), MS medium + auxin (IBA) + γ-aminobutyric acid (GABA), the stem bases were collected 3 days, 6 days and 9 days after treatment, and transcriptome sequencing (RNA-seq) analysis was performed, in which the MS medium treatment group was used as a control. By analyzing the transcriptome results, 220 differentially expressed genes that were upregulated in auxin vs control and downregulated in auxin + γ-aminobutyric acid vs auxin were screened, see Figure 1 A in . The 220 differentially expressed genes were subjected to pathway analysis in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, and the differentially expressed genes were enriched in the plant hormone signal transduction pathway, see Figure 1 B. Further analysis revealed that one of these differentially expressed genes was associated with the occurrence of adventitious roots, and the name of this gene was MdANT.

[0075] In previous studies, auxin and juvenile nature are important factors in the occurrence of adventitious roots. The mature (Mx-A) and juvenile (Mx-J) cuttings of the apple dwarf rootstock 'Xiaojin Haitang' were treated with auxin (IBA). It was found that compared with the control, the mature cuttings hardly took root after the application of auxin (IBA). Figure 2 A in the figure. The rooting rate of the cuttings in the early stage reached more than 80%, see Figure 2 B. After applying auxin (IBA), the number of adventitious roots of juvenile cuttings of 'Xiaojin Haitang' was three times that of mature cuttings, see Figure 2 C in; the length of adventitious roots is also 3 times that of mature cuttings, see Figure 2 D in the figure. It is generally believed that the reason why young cuttings are easy to root may be that they actively respond to auxin. However, data from previous studies show that mature cuttings actively resist auxin induction, which ultimately results in no rooting in the mature stage. After auxin treatment, the MdANT gene in the mature cuttings of 'Xiaojin Haitang' was significantly downregulated, see Figure 2 E in.

[0076] Treatment of mature and rejuvenated cuttings of apple dwarf rootstock 'M9T337' with auxin (IBA) revealed that mature cuttings of apple dwarf rootstock 'M9T337' did not take root regardless of whether auxin (IBA) was applied or not. Figure 3 A in the figure. However, the rooting rate of the cuttings of apple dwarf rootstock 'M9T337' was over 80% when auxin (IBA) was applied. Figure 3 B. After the application of auxin (IBA), the number of adventitious roots of juvenile cuttings of apple dwarf rootstock 'M9T337' was 30 times that of mature cuttings, see Figure 3 C in; the length of adventitious roots is three times that of mature cuttings, see Figure 3 D in. In addition, in the mature and juvenile cuttings of apple dwarf rootstock 'M9T337', the transcription factor gene MdANT had a relatively low expression level in the mature cuttings, while it had a relatively high expression level in the juvenile cuttings, see Figure 3 Therefore, the MdANT gene plays an important role in the transition of developmental stages of apple dwarf rootstocks and positively regulates the occurrence of adventitious roots.

[0077] Example 3: Construction of MdANT gene overexpression vector

[0078] The MdANT gene coding sequence shown in the nucleotide sequence SEQ ID NO.1 obtained in step (ii) of Example 1 was amplified using the first forward primer and the first reverse primer sequence with SacI and KpnI restriction sites, and then the plant overexpression vector pRI101-AN was digested with restriction endonucleases SacI and KpnI, agarose gel electrophoresis, gel recovery, homologous recombination linear overexpression vector pRI101-AN and the coding sequence of the target gene MdANT were transformed into Escherichia coli DH5α strain cells, and the recombinant plasmid MdANT-pRI101 was extracted from the single colony with correct sequencing. The recombinant plasmid was transferred into Agrobacterium tumefaciens EHA105 strain cells by freeze-thaw method.

[0079] Take 1 μL of the recombinant plasmid and add it to 100 μL of the competent cells of Agrobacterium tumefaciens EHA105 strain, put the competent cells of Agrobacterium tumefaciens EHA105 strain mixed with the recombinant plasmid in an ice bath for 5 minutes, put them in liquid nitrogen for quick freezing for 5 minutes after the ice bath, and then heat shock at 37°C for 5 minutes, and ice bathe for 5 minutes after the heat shock. After the ice bath, take 500 μL of lysate broth (Luria-Bertani) liquid culture medium and add it to the competent cells of Agrobacterium tumefaciens EHA105 strain mixed with the recombinant plasmid, and shake and culture at 28°C and 200 rpm for 2-3 hours. Take 100 μL and apply it to the solid culture medium of lysing broth containing 50 mg / L kanamycin and 25 mg / L rifampicin, put it in a 28℃ incubator for 2-3 days, pick a white single colony from the solid culture plate of lysing broth, add 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and shake and culture for 24 hours at 28℃ and 200 rpm. The expanded bacterial solution was used as a template for polymerase chain reaction amplification verification to obtain the bacterial solution of Agrobacterium tumefaciens EHA105 strain cells containing the recombinant plasmid.

[0080] Example 4: Transient transformation of apple dwarf rootstock tissue culture seedlings with MdANT gene overexpression vector

[0081] The preparation of the infection solution used in Example 4 is as follows: add 1 mL of 1 mol / L fatty acid methyl ester sulfonate, 400 μL of 50 mmol / L acetosyringone and 1 mL of 1 mol / L magnesium chloride to every 100 mL of distilled water, mix well, and adjust the pH value to 5.6 with dilute hydrochloric acid. The infection solution does not need to be sterilized and is used immediately after preparation.

[0082] The nutrient solution used in Example 4 was prepared as follows: 2.3 g of 1 / 2MS culture medium, 0.6 g of 3-indolebutyric acid and 1 mL of 1 mol / L S206 plant fungicide were added to 1000 mL of distilled water and mixed evenly.

[0083] The regulation operation steps of the transcription factor gene of the present invention in promoting the occurrence of adventitious roots in apple dwarfing rootstock are as follows:

[0084] (1) The transcription factor gene shown in SEQ ID NO.1 in the nucleotide sequence table was cloned into the plant overexpression vector pRI101-AN to obtain a recombinant plasmid; the specific operation steps are shown in the MdANT gene overexpression vector construction operation steps in Example 3.

[0085] (2) The recombinant plasmid was transferred into Agrobacterium tumefaciens EHA105 strain cells by freeze-thaw method to obtain strain cells. The specific operation steps of freeze-thaw method refer to the operation steps of constructing MdANT gene overexpression vector in Example 3.

[0086] (3) Inoculate the strain cells into 200 mL of lysate broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at an inoculum volume ratio of 1:50 to obtain Agrobacterium culture liquid.

[0087] (4) The Agrobacterium bacterial solution was cultured at 28°C and 200 rpm with shaking until the absorbance at 600 nm was 1.0. The cultured Agrobacterium bacterial solution was added to a 50 mL centrifuge tube and centrifuged at 5000 rpm for 5 minutes in a centrifuge, and the supernatant was discarded to obtain the bacterial cells.

[0088] (5) Add the bacteria to 200 mL of infection solution, use a pipette to blow the bacteria to evenly suspend them in the infection solution, mix them by pipetting until there are no lumps, and measure the concentration of the resuspended bacteria solution using an ultraviolet spectrophotometer to make the absorbance value of the resuspended bacteria solution at a wavelength of 600 nm be 1.0, thereby obtaining the infection buffer solution.

[0089] (6) Immerse the apple dwarf rootstock tissue culture seedlings in the infection buffer and place them at -0.8 kg / cm 2 Suction infection was performed under vacuum conditions, with 5 minutes of evacuation and 20 minutes of deflation to treat 30 apple dwarf rootstock tissue culture seedlings. After infection, the seedlings were rinsed with distilled water to obtain 30 apple dwarf rootstock tissue culture seedlings with transient overexpression.

[0090] (7) Place 350 g of vermiculite and 1 L of nutrient solution in a sugar-free culture box and stir well to obtain a cutting medium. Insert 30 transiently overexpressed apple dwarf rootstock tissue culture seedlings into the cutting medium respectively, and culture for 25 days under the environmental conditions of alternating 16 hours of light and 8 hours of darkness, room temperature of 23-25°C, light intensity of 2000-4000 lx, and humidity of 75-80%. Count the number of roots and adventitious root length;

[0091] Among them, the adventitious roots of 29 cutting seedlings were longer than 10 mm and the number of roots was greater than 3, which met the transplanting standards and were used as transplanting seedlings.

[0092] The results showed that in the MdANT transient overexpression system, the root length and root number of apple dwarf rootstock tissue culture seedlings in the overexpression treatment group were significantly greater than those in the control group. Figure 4 A in the figure. And at the 18th day, the rooting rate of the overexpression treatment group reached 100%, see Figure 4 B. When the statistics were removed on the 25th day, the length of the adventitious roots in the control group was 16.1 mm, while the average length of the adventitious roots in the overexpression treatment group was 28.5 mm, and the length of the adventitious roots increased by 2 times, see Figure 4 C. And there was also a significant increase in the number of adventitious roots in the overexpression treatment group, see Figure 4 D in the figure. It can be seen that overexpression of the transcription factor gene MdANT can promote the occurrence of adventitious roots in apple dwarfing rootstocks.

[0093] It will be easily understood by those skilled in the art that the above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An application of a transcription factor gene shown in nucleotide sequence table SEQ ID NO.1 in promoting adventitious rooting of apple dwarf rootstock, characterized in that: In apple dwarfing rootstocks where adventitious roots are difficult to form, the transcription factor gene shown in the nucleotide sequence table SEQIDNO.1 is cloned into a plant overexpression vector, and the transcription factor gene is transiently overexpressed using instantaneous vacuum and sugar-free culture technology to promote the formation of adventitious roots in the apple dwarfing rootstock.

2. The method for regulating the transcription factor gene in promoting adventitious rooting of apple dwarfing rootstock according to claim 1, characterized in that: The steps are as follows: (1) The transcription factor gene shown in SEQ ID NO.1 in the nucleotide sequence table was cloned into the plant overexpression vector pRI101-AN to obtain a recombinant plasmid; (2) transferring the recombinant plasmid into Agrobacterium tumefaciens EHA105 strain cells by freeze-thaw method to obtain strain cells; (3) inoculating the strain cells into 200 mL of lysate broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at an inoculum volume ratio of 1:50 to obtain Agrobacterium bacterial liquid; (4) shaking and culturing the Agrobacterium bacterial solution at 28° C. until the absorbance at a wavelength of 600 nm reaches 1.0, and collecting the bacterial cells by centrifugation to obtain the bacterial cells; (5) adding the bacterial cells to 200 mL of infection solution, breaking up the bacterial cells, and suspending them at room temperature until the absorbance at a wavelength of 600 nm is 1, thereby obtaining an infection buffer solution; (6) Immerse the apple dwarf rootstock tissue culture seedlings in the infection buffer and place them at -0.8 kg / cm 2 Under vacuum conditions, vacuum treatment was performed for 5 to 6 minutes, air was slowly released for 20 to 25 minutes, and the cells were rinsed with clean water to obtain tissue culture seedlings of transiently overexpressed apple dwarf rootstocks; (7) Stir and mix 350 g of vermiculite and 1 L of nutrient solution to obtain a cutting medium, and insert the transiently overexpressed apple dwarf rootstock tissue culture seedlings into the cutting medium respectively; culture for 25 days in an environment with alternating light hours of 16 hours and dark hours, room temperature of 23 to 25°C, light intensity of 2000 to 4000 lx, and humidity of 75 to 80%, and count the number of roots and the length of adventitious roots; Adventitious roots with a length greater than 10 mm and a number of roots greater than 3 meet the transplanting standards and are used as transplant seedlings.

3. The control method according to claim 2, characterized in that: In step (1), the overexpression vector is a plant binary expression vector (pRI101-AN).

4. The control method according to claim 2, characterized in that: In step (5), the infection solution is prepared by adding 1 mL of 1 mol / L fatty acid methyl ester sulfonate, 400 μL of 50 mmol / L acetosyringone and 1 mL of 1 mol / L magnesium chloride to 100 mL of distilled water and mixing them evenly. The pH value of the infection solution is 5.

6.

5. The control method according to claim 2, characterized in that: In step (7), the nutrient solution is prepared by adding 2.3 g of 1 / 2MS culture medium, 0.6 g of 3-indolebutyric acid and 1 mL of 1 mol / L S206 plant fungicide to 1000 mL of distilled water and mixing them evenly.

Images