Kit for rapidly detecting DNA (deoxyribonucleic acid) of colletotrichum siamensis and application of kit

Abstract

The invention discloses a kit for detecting DNA (deoxyribonucleic acid) of colletotrichum siamensis and application of the kit. The kit comprises a primer group, a Bst DNA polymerase, dNTP, a Cas12b nuclease, sgRNA, MgSO4, a reaction buffer solution, taurine and a single-stranded oligonucleotide probe carrying a fluorescence reporter group. The nucleotide sequence of the specific primer group is as shown in SEQ ID No. 1 to 6 or SEQ ID No. 7 to 12, and the nucleotide sequence of the sgRNA is as shown in SEQ ID No. 13 to 15. According to the invention, a CRISPR / Cas12b detection system for the colletotrichum siamensis is established and optimized. The detection method is high in specificity, high in sensitivity, simple, convenient and rapid to operate, capable of completing detection within 30 minutes and more suitable for basic-level popularization and application.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for rapidly detecting Siamese anthrax DNA and an application thereof. Background Art

[0002] Colletotrichum siamense is a soil-borne pathogenic fungus that is seriously harmful and is listed as one of the top ten plant pathogenic fungi in the world. Especially in subtropical and tropical regions, Colletotrichum siamense can cause rot and anthracnose of a variety of fruits, vegetables and ornamental plants, causing huge economic losses to agriculture. Colletotrichum siamense is highly contagious and the disease progresses rapidly, so early, specific and accurate identification is the key to effective disease control. At present, the main methods for identifying Colletotrichum siamense are morphological observation, culture method, polymerase chain reaction (PCR) method and loop-mediated isothermal amplification (LAMP) method. Among them, the morphological method requires sufficient professional knowledge and may make mistakes in judgment for uncommon diseases; the culture method is the current "gold standard", but it takes too long; the PCR method (including fluorescent quantitative PCR method) requires professional PCR instruments, which is complicated to operate and difficult to apply at the grassroots level; although the LAMP method does not require expensive instruments and reacts quickly, it is prone to nonspecific amplification and cross-contamination, resulting in false positive results. Therefore, there is still an urgent need for a means to achieve rapid and accurate detection of Colletotrichum siamense. Summary of the invention

[0003] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a kit for rapid detection of Siamese anthrax DNA, which can save detection time and is easy to operate.

[0004] The invention also provides an application of a kit for rapidly detecting Siamese anthrax DNA.

[0005] Technical solution: To achieve the above-mentioned purpose, the kit for rapid detection of Siamese anthrax DNA of the present invention comprises a primer set, Bst DNA polymerase, dNTP mix, Cas12b nuclease, sgRNA, MgSO4, reaction buffer, taurine, and a single-stranded oligonucleotide probe carrying a fluorescent reporter group.

[0006] Furthermore, the nucleotide sequence of the primer set is shown as SEQ ID No.1-6 or SEQ ID No.7-12.

[0007] Furthermore, the sgRNA sequence is shown in any one of SEQ ID No.13-15.

[0008] Preferably, the sgRNA sequence is shown as SEQ ID No.15.

[0009] Furthermore, the sequence of the single-stranded oligonucleotide probe carrying the fluorescent reporter group is 5'-FAM-TTATT-BHQ1-3'.

[0010] Among them, the kit for rapid detection of Siamese anthrax DNA is used in rapid detection of Siamese anthrax DNA.

[0011] Furthermore, the kit detection process is:

[0012] S1: prepare the reaction mixture;

[0013] S2: Add 1-2 μL sample template to the reaction mixture of S1, mix thoroughly, and place in a heatable fluorescence instrument for reaction. If the fluorescence signal increases significantly, it indicates that the sample contains Siamese anthrax DNA.

[0014] Furthermore, the reaction mixture in S1 includes: 20-30U Bst DNA polymerase, 50-300nmol dNTP, 200-400nmol MgSO4, LAMP primer set, 2-4pmol Cas12b nuclease, 280-285ng / μl sgRNA, 21-26pmol single-stranded fluorescent probe, taurine, and reaction buffer.

[0015] Preferably, the reaction mixture in S1 includes: 3 μL Bst DNA polymerase (8U / μL), 7 μL dNTP (10 mM each), 4 μL MgSO4 (100 mM), 5 μL LAMP primer premix (1.6 μM FIP / BIP, 0.2 μM F3 / B3, 0.8 μM LB / LF), 3 μL Cas12b nuclease (1 μM), 1 μL sgRNA (280 ng / μl), 5 μL single-stranded fluorescent probe (5 μM), 5 μL taurine (500 mM), and 5 μL 10× reaction buffer.

[0016] Furthermore, the S2 reaction condition is 55-60° C. for 30-35 min.

[0017] Furthermore, the S1 is prepared and stored at 2-4°C.

[0018] The technical principle of the present invention is to rapidly amplify the DNA of Siamese anthrax bacteria through loop-mediated isothermal amplification (LAMP) reaction. After the specific sgRNA is perfectly paired with the amplified product, it will activate the trans-cleavage activity of Cas12b, cut the single-stranded oligonucleotide probe, thereby releasing the fluorescent signal group and emitting a fluorescent signal. The Bst DNA polymerase and Cas12b nuclease used in LAMP have good activity at 60°C and can react synchronously.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0020] The present invention provides a specific primer set for LAMP amplification of Siamese anthrax DNA and sgRNA for CRISPR / Cas12b detection. At the same time, the kit provided by the present invention has good specificity and sensitivity, is easy to operate, and has a short detection time. Siamese anthrax and other pathogens can be quickly distinguished within only 30 minutes. The result interpretation is simple and accurate, and is suitable for grassroots detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the screening diagram of LAMP primers of the present invention;

[0022] Figure 2 This is a screening diagram for sgRNA of the present invention;

[0023] Figure 3 This is a specificity test diagram of the LAMP-CRISPR / Cas12b detection method of the present invention. DETAILED DESCRIPTION

[0024] Bst II DNA polymerase, Bst II reaction buffer, 10×BST II Reaction Buffer: Jiangsu Best Biotechnology Co., Ltd., catalog number EG23101;

[0025] Cas12b nuclease: Jiangsu Best Biotechnology Co., Ltd., catalog number EG23202;

[0026] RNase inhibitor: Jiangsu Bristol-Myers Squibb Biotechnology Co., Ltd., catalog number EG20002;

[0027] The abbreviations of technical terms in the present invention are as follows: LAMP: loop-mediated isothermal amplification, CRISPR: clustered regularly interspaced short palindromic repeats, Cas: CRISPR-associated system protein, sgRNA: guide RNA, dNTP: deoxynucleoside triphosphate, dATP: deoxyadenosine triphosphate, dCTP: deoxycytidine triphosphate, dGTP: deoxyguanosine triphosphate, dTTP: deoxythymidine triphosphate.

[0028] The siam anthracnose fungi, Fusarium oxysporum, Aspergillus subspora, flat-headed anthracnose fungi, Fusarium solani, Talaromyces cnidium, Aspergillus niger, Aspergillus fumigatus, Aspergillus terreus, and Verticillium dahliae used in the present invention are all conventional wild-type strains, which can be isolated from nature or commercially available from strain banks.

[0029] Example 1

[0030] LAMP primer screening

[0031] According to the species-specific sequence of Colletotrichum siamensis (Genbank accession number XM_036636074.1), two sets of LAMP primers (LAMP2-1 and LAMP2-2, the primer sequences are shown in SEQ ID No. 1-6 or SEQ ID No. 7-12 in Table 1, respectively) were designed and synthesized at General Biotechnology (Anhui) Co., Ltd.

[0032] The genomic DNA of Siamese anthrax preserved by Nanjing Institute of Agricultural Sciences in Jiangsu hilly area was used as template, and LAMP amplification was performed using the above-mentioned LAMP primer sets. The amplification system was 25 μL: 10 ng DNA, 1 μL BST II DNA Polymerase (8 U / μL), 2.5 μL 10× BST II Reaction Buffer, 1.5 μL MgSO4 (100 mM), 3.5 μL dNTP Mix (including dATP, dCTP, dGTP, dTTP, 10 mM each), 2 μL FIP / BIP equal volume premix (20 μM), 0.5 μL F3 / B3 equal volume premix (10 μM), 1 μL LB / LF equal volume premix (20 μM), and the rest was made up to 25 μL with enzyme-free raw water. LAMP amplification procedure: constant temperature 60°C reaction for 30 min, incubation at 85°C for 5 min to terminate the reaction.

[0033] The above system was used, the only difference being that a system without sample DNA was set up as a control (NTC), and the rest remained unchanged.

[0034] The results are as follows Figure 1 As shown, lanes 1-2 represent the LAMP2-1 (SEQ ID No. 1-6) experimental group and NTC, lanes 3-4 represent the LAMP2-2 (SEQ ID No. 7-12) experimental group and NTC, and M represents a 2000 bp marker. The results show that primer LAMP2-1 (SEQ ID No. 1-6) has better amplification efficiency, so primer LAMP2-1 is preferred.

[0035] Table 1 Sequences of specific primer sets for Siamese anthrax

[0036]

[0037]

[0038] Example 2

[0039] Design and screening of sgRNA

[0040] The dumbbell-shaped core structure sequence of the LAMP amplification product of Example 1 was used as a template, and three Cas12b cleavage PAM sites (5'-TNN-3') and 20bp sequences at their 3' ends were selected as targets for potential sgRNA guide sequences (sequences as shown in SEQ ID Nos. 16 to 18). General Bio (Anhui) Co., Ltd. was commissioned to synthesize sgRNA (sequences as shown in SEQ ID Nos. 13 to 15) and single-stranded fluorescent probes (sequence 5'-FAM-TTATT-BHQ1-3').

[0041] The genomic DNA of Siamese anthrax was extracted (10 ng / μl), and different sgRNAs (sequences as shown in SEQ ID No. 13 to SEQ ID No. 15) were used to prepare the following reaction system: 5 μl 10× reaction buffer (2M Tris-HCl, 1M (NH4)2SO4, 1M Mg2SO4, 100% Tween 20), 7 μl dNTP mix (including dATP, dCTP, dGTP, dTTP, 10 mM each), 3 μl Bst II DNA Polymerase (8 U / μl), 4 μl MgSO4 (100 mM), 5 μl 10× LAMP primer premix (1.6 μM FIP / BIP, 0.2 μM F3 / B3, 0.8 μM LB / LF), 3 μl Cas12b (1 μM), 1 μL sgRNA (280ng / μl), 5μl single-stranded fluorescent probe (5μM), 5μl taurine (500mM), 1μL DNA sample to be tested, and the rest is supplemented with enzyme-free water to 50μL. Put it into the fluorescence quantitative PCR instrument, set it to 60℃ for 30min, and record the fluorescence curve. The results are as follows Figure 2 As shown, the fluorescence value of sgRNA3 (sequence shown in SEQ ID No. 15) is significantly higher than that of the other groups, and the detection efficiency is the highest. Therefore, sgRNA3 is selected for the kit.

[0042] Table 2 Target sequences of sgRNA guide sequences of Siamese anthrax

[0043] Target Name Sequence (5'→3') Sequence Listing Target sequence 1 CGCAACGCCGACGAAACCGA SEQ ID No.16 Target sequence 2 CAACAGCATGCCAAGAAGCT SEQ ID No.17 Target sequence 3 CCTCAACGACTTGAGCCAGC SEQ ID No.18

[0044] Table 3 Siamese anthrax-specific sgRNA sequences

[0045]

[0046]

[0047] Example 3

[0048] Kit-specific tests:

[0049] To verify the specificity of the kit, 10 fungal genomic DNAs of Siamese anthracnose, Fusarium oxysporum, Subsporium, Flat-headed anthracnose, Fusarium solani, Talaromyces cnidium, Aspergillus niger, Aspergillus fumigatus, Aspergillus terreus, and Verticillium dahliae provided by Nanjing Institute of Agricultural Sciences in the hilly area of ​​Jiangsu Province were detected. The same reaction system as in Example 2 was prepared, except that sgRNA1 (sequence as shown in SEQ ID No. 15) was selected, and NTC control without sample DNA was set at the same time, and the others remained unchanged. A fluorescent quantitative PCR instrument was placed to collect fluorescent signals, and the experimental results were distinguished according to the intensity of the fluorescent signal.

[0050] The results are as follows Figure 3 As shown, C01 is Colletotrichum siamensis, and the fluorescence signal is significantly increased; while the fluorescence signals of samples such as C02 (Fusarium oxysporum), C03 (Subsporium), C04 (Flat-headed Colletotrichum), C05 (Fusarium solani), C06 (Talaromyces cnidium), C07 (Aspergillus niger), C08 (Aspergillus fumigatus), C09 (Aspergillus terreus), and C10 (Verticillium dahliae) are close to NTC, indicating that this kit can only detect Colletotrichum siamensis, and has strong specificity.

Claims

1. A kit for rapid detection of Siamese anthrax DNA, characterized in that: The kit includes a primer set, BstDNA polymerase, dNTPmix, Cas12b nuclease, sgRNA, MgSO4, a reaction buffer, taurine, and a single-stranded oligonucleotide probe carrying a fluorescent reporter group.

2. The kit for rapid detection of Siamese anthrax DNA according to claim 1, characterized in that: The nucleotide sequences of the primer sets are shown as SEQ ID No. 1-6 or SEQ ID No. 7-12.

3. The kit for rapid detection of Siamese anthrax DNA according to claim 1, characterized in that: The sgRNA sequence is shown in any one of SEQ ID No.13-15.

4. The kit for rapid detection of Siamese anthrax DNA according to claim 1, characterized in that: The sgRNA sequence is shown as SEQ ID No.

15.

5. The kit for rapid detection of Siamese anthrax DNA according to claim 1, characterized in that: The sequence of the single-stranded oligonucleotide probe carrying a fluorescent reporter group is 5'-FAM-TTATT-BHQ1-3'.

6. Use of the kit for rapid detection of Siamese anthrax DNA according to claim 1 in rapid detection of Siamese anthrax DNA.

7. The use according to claim 6, characterized in that: The kit detection process is as follows: S1: prepare the reaction mixture; S2: Add 1-2 μL sample template to the reaction mixture of S1, mix thoroughly, place in a heatable fluorescence instrument to react for a certain period of time, and collect the fluorescence signal. If the fluorescence signal increases significantly, it indicates that the sample contains Siamese anthrax DNA.

8. The use according to claim 7, characterized in that: The reaction mixture in S1 includes: 20-30U Bst DNA polymerase, 50-300nmol dNTP, 200-400nmol MgSO4, LAMP primer set, 2-4pmol Cas12b nuclease, 280-285ng / μl sgRNA, 21-26pmol single-stranded fluorescent probe, taurine, and reaction buffer.

9. The use according to claim 7, characterized in that: The S2 reaction condition is 55-60° C. for 30-35 min.

10. The use according to claim 7, characterized in that: The S1 is prepared and stored at 2-4°C.

Images