Application of Sphk1 selective inhibitor in treatment of encephaledema after cerebral hemorrhage

Abstract

The invention belongs to the technical field of biological medicines, and discloses application of an Sphk1 selective inhibitor in treatment of encephaledema after cerebral hemorrhage. The Sphk1 selective inhibitor PF543 provided by the invention is mainly used for inhibiting the formation of encephaledema after cerebral hemorrhage by protecting the integrity of a blood brain barrier, preventing the damage of tight junction protein between endothelial cells and reducing the endocytosis of the endothelial cells. Researches show that the PF543 small molecule compound may be a promising effective medicine for preventing, relieving and / or treating encephaledema after cerebral hemorrhage.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine technology, and specifically relates to the use of Sphk1 selective inhibitors in the treatment of brain edema after cerebral hemorrhage. Background Art

[0002] Intracerebral hemorrhage (ICH) refers to bleeding caused by non-traumatic rupture of blood vessels in the brain parenchyma. It is one of the most dangerous diseases in the world with high mortality and disability rates. According to the 2019 Global Burden of Disease Study, ICH accounts for as much as 28% of all new strokes, with an annual incidence of about 42 per 100,000 people. The incidence of ICH is particularly significant in Oceania and eastern Asia. Although innovations in surgical techniques have reduced the mortality rate of patients with ICH, the secondary brain injury process after ICH still seriously affects the prognosis of patients. For example, cerebral edema and brain herniation are still the main obstacles to patient recovery. Only 20% of patients with ICH can recover the ability to live independently within 6 months after the onset of the disease, which not only causes physical and psychological harm to patients and their families, but also brings a heavy disease burden to families and society.

[0003] The current clinical standard treatment for patients with cerebral hemorrhage includes surgical removal of intracerebral hematoma, followed by dehydration therapy with mannitol. Mannitol, as the first-line clinical drug for dehydration treatment of cerebral hemorrhage, is an osmotic diuretic and has a good effect on the treatment of cerebral edema after cerebral hemorrhage. However, mannitol treatment has many side effects, which can easily cause water and electrolyte imbalance, and can easily cause acute renal failure when used in large doses, which greatly limits the clinical application value of mannitol. Therefore, new drugs for preventing cerebral edema after cerebral hemorrhage are urgently needed.

[0004] Small molecule compounds are an important source of drugs for treating various human diseases, including cerebral hemorrhage. PF543 (Sphingosine Kinase 1 Inhibitor II) is a highly effective, selective, and reversible sphingosine kinase 1 (Sphk1) inhibitor with an IC50 of 2 nM and a Ki of 3.6 nM. PF543 is more than 100 times more selective for Sphk1 than for Sphk2. PF543 is also an effective inhibitor of sphingosine 1-phosphate (S1P) formation in whole blood with an IC50 of 26.7 nM. Although there are literature reports that PF543 inhibits the abnormal activation of Sphk1 after cerebral hemorrhage and inhibits the ferroptosis process of neuronal cells, its role in preventing brain edema after cerebral hemorrhage and its mechanism of action have not been reported. Summary of the invention

[0005] In view of the problems and shortcomings in the prior art, the present invention aims to provide a use of a Sphk1 selective inhibitor in the treatment of cerebral edema after cerebral hemorrhage.

[0006] Based on the above purpose, the present invention adopts the following technical solution: The first aspect of the present invention provides the use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a medicament for preventing, alleviating and / or treating brain edema after cerebral hemorrhage.

[0007] The second aspect of the present invention provides the use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for preventing, alleviating and / or treating blood-brain barrier leakage after cerebral hemorrhage.

[0008] The third aspect of the present invention provides the use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for preventing, alleviating and / or treating the degradation of tight junction proteins after cerebral hemorrhage.

[0009] According to the above application, preferably, the tight junction proteins include Claudin-5, Occludin, and ZO-1.

[0010] A fourth aspect of the present invention provides use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for improving the permeability of the blood-brain barrier after cerebral hemorrhage.

[0011] According to the above application, preferably, the drug improves the permeability of the blood-brain barrier by inhibiting and / or reducing the endocytosis of endothelial cells. More preferably, the endocytosis is Mfsd2a / Caveolin-1-mediated endocytosis.

[0012] According to the applications of the first to fourth aspects above, preferably, the substance inhibiting Sphk1 expression and / or function is an inhibitor of Sphk1 protein or siRNA specifically targeting Sphk1 gene or shRNA specifically targeting Sphk1 gene; more preferably, the inhibitor of Sphk1 protein is PF543.

[0013] A fifth aspect of the present invention provides a drug, which contains a substance that inhibits the expression and / or function of Sphk1 and a pharmaceutically acceptable carrier or excipient, and is used for preventing, alleviating and / or treating brain edema after cerebral hemorrhage.

[0014] A sixth aspect of the present invention provides a drug, which contains a substance that inhibits the expression and / or function of Sphk1 and a pharmaceutically acceptable carrier or excipient, and is used for preventing, alleviating and / or treating blood-brain barrier leakage after cerebral hemorrhage.

[0015] A seventh aspect of the present invention provides a drug, which contains a substance that inhibits the expression and / or function of Sphk1 and a pharmaceutically acceptable carrier or excipient, and is used for preventing, alleviating and / or treating the degradation of tight junction proteins after cerebral hemorrhage.

[0016] An eighth aspect of the present invention provides a drug, which contains a substance that inhibits the expression and / or function of Sphk1 and a pharmaceutically acceptable carrier or excipient, and is used for improving the permeability of the blood-brain barrier after cerebral hemorrhage.

[0017] According to the applications of the fifth to eighth aspects above, preferably, the substance that inhibits the expression and / or function of Sphk1 is PF543; the carrier / excipients include (but are not limited to): diluents, excipients such as lactose, sodium chloride, glucose, urea, starch, water, etc., fillers such as starch, sucrose, etc.; binders such as monosaccharide syrup, glucose solution, starch solution, cellulose derivatives, alginate, gelatin and polyvinyl pyrrolidone; wetting agents such as glycerol; disintegrants such as dry starch, sodium alginate, laminarin powder, agar powder, calcium carbonate and sodium bicarbonate; absorption promoters such as quaternary ammonium compounds, sodium dodecyl sulfate, etc.; surfactants such as polyoxyethylene sorbitan fatty acid esters, sodium dodecyl sulfate, monoglyceride of stearic acid, hexadecanol, etc.; humectants such as glycerol, starch, etc.; adsorption carriers such as starch, lactose, bentonite, silica gel, kaolin and bentonite, etc.; lubricants such as talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, etc.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: The mouse cerebral hemorrhage model established by the collagenase method in the present invention was found to have a protective effect on motor function after cerebral hemorrhage, and to reduce the S1P content in serum, the volume of cerebral hematoma, cerebral edema and the degree of brain swelling after cerebral hemorrhage, reduce the exudation of IgG after cerebral hemorrhage, prevent the destruction of tight junction proteins Claudin-5, Occludin and ZO-1 between endothelial cells after cerebral hemorrhage, and reduce the Mfsd2a / Caveolin-1-mediated endocytosis pathway to improve the permeability of the blood-brain barrier. Our test results show that PF543 has no obvious systemic toxicity in mice. Our research shows that the Sphk1 selective inhibitor PF543 may be a promising and effective drug for the treatment of cerebral edema after cerebral hemorrhage. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the expression of Sphk1 in vascular endothelial cells around the hematoma after intracerebral hemorrhage (ICH); A is a diagram of the expression of Sphk1 in vascular endothelial cells around the hematoma 24 hours after intracerebral hemorrhage SPHK1qPCR results of mRNA (data are mean ± SEM, ****p<0.0001, two-tailed unpaired Student's t-test, n=6); B, C are Western blot bands and quantitative analysis of Sphk1 protein 24h after human ICH (****p<0.0001, two-tailed unpaired Student's t-test, n=6); D is the Western blot bands and quantitative analysis of Sphk1 protein 24h after mouse ICH SPHK qPCR results of mRNA (****p<0.0001, two-tailed unpaired Student's t-test, n=6); E and F are Western blot bands and quantitative analysis of Sphk1 protein 24 hours after mouse ICH (****p<0.0001, two-tailed unpaired Student's t-test, n=6); G is the result of enzyme-linked immunosorbent assay (ELISA), serum S1P content level 24 hours after human ICH (****p<0.0001, two-tailed unpaired Student's t-test, n=6); H is the result of ELISA, serum S1P content level 24 hours after mouse ICH (****p<0.0001, two-tailed unpaired Student's t-test, n=6); I is a schematic diagram of the mouse ICH model established by collagenase method and time points; J is a schematic diagram of the mouse ICH model established by collagenase method and time points; SPHK1 Time course of mRNA expression level (**p<0.01vssham; one-way ANOVA, Tukey multiple comparison test, n=3); K, L are representative Western blot bands and quantitative analysis of the time course of Sphk1 protein expression level after intracerebral hemorrhage in mice; (*p<0.05vs sham operation; ***p<0.001vs sham operation; one-way ANOVA, Tukey multiple comparison test, n=3); M is a representative picture of double immunofluorescence staining; scale bar = 20μm; N. Quantitative analysis of Sphk1 fluorescence density after intracerebral hemorrhage in mice (****p<0.0001, two-tailed unpaired Student's t test, n=6); Figure 2Figure 1 is a schematic diagram of the protective effect of Sphk1 selective inhibitor PF543 on the motor function of mice; A is a diagram of the dosing regimen for mice and the subsequent molecular biological experiment model; B is the ELISA results, serum S1P concentrations of mice in different groups; (data are mean ± SEM, ****p<0.0001, one-way ANOVA, Tukey multiple comparison test, n=6); C is a representative brain section of mice in each group, comparing the volume of cerebral hematoma; D is a quantitative analysis of the volume of cerebral hematoma in each group of mice; (****p<0.0001, one-way ANOVA, Tukey multiple comparison test, n=6); E is a quantitative analysis of brain water content in each group of mice (*p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Tukey multiple comparison test, n=6) ; F is a representative brain magnetic resonance image of mice in each group; G is a quantitative analysis of brain swelling of mice in each group (****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); H is a comparison of survival curves of mice in each group (Log-rank (Mantel-Cox) test, n=48); IM is the neurobehavioral score of mice in each group 3 days after ICH (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, by one-way ANOVA, Tukey's multiple comparison test, n=6); Figure 3 Schematic diagram of the protective effect of Sphk1 selective inhibitor PF543 on the blood-brain barrier (BBB) ​​after intracerebral hemorrhage in mice; A is a representative image of Evans blue extravasation in the hematoma area of ​​each group of mice after intracerebral hemorrhage; B is a quantitative analysis of Evans blue extravasation in each group of mice (data are mean ± SEM, ***p<0.001, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); C is a representative image of horseradish peroxidase (HRP) extravasation in the hematoma area of ​​each group of mice after intracerebral hemorrhage; D is a quantitative analysis of HRP extravasation in each group of mice (*p<0.05, **p<0.01, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); E is a representative image of double immunofluorescence staining of IgG (green) exuded from endothelial cells in the hematoma area after intracerebral hemorrhage; F is a representative image of IgG extravasation in mice after intracerebral hemorrhage Quantitative analysis of fluorescence intensity (**p<0.01, ***p<0.001, ****p<0.0001, using one-way ANOVA, Tukey's multiple comparison test, n=6); Figure 4Figure 1 is a schematic diagram of the protective effect of Sphk1 selective inhibitor PF543 on tight junction (TJ) proteins in intracerebral hemorrhage in mice; A is a representative Western-blot band of TJ proteins in the perihematomal area of ​​each group of mice after intracerebral hemorrhage; B is a quantitative analysis of TJ protein expression in each group of mice (data are mean ± SEM, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); E is a representative image of double immunofluorescence staining of Claudin-5 (green) in the perihematomal area of ​​each group of mice after intracerebral hemorrhage; F is a quantitative analysis of Claudin-5 fluorescence intensity in each group of mice (*p<0.05, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); G is a representative image of Occludin in the perihematomal area of ​​each group of mice after intracerebral hemorrhage (green) Representative images of double immunofluorescence staining; H is the quantitative analysis of fluorescence intensity after intracerebral hemorrhage in mice (***p<0.001, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); I is the representative image of ZO-1 double immunofluorescence staining (green); J is the quantitative analysis of ZO-1 fluorescence intensity after intracerebral hemorrhage in mice (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); K is the representative image of TJ protein transmission electron microscopy in the perihematomal area after intracerebral hemorrhage in mice in each group; arrows indicate damaged TJs; in the figure, L: luminal EC: endothelial cells BM: basement membrane P: pericytes; L is the quantitative analysis of the percentage of tight junction protein opening after intracerebral hemorrhage in mice (**p<0.01, ***p<0.001, ****p<0.0001, Tukey's multiple comparison test, n=6); Figure 5Figure 3 is a schematic diagram of the protective effect of Sphk1 selective inhibitor PF543 on BBB permeability; A is a representative Western-blot band of Mfsd2a / Caveolin-1 in the hematoma area after intracerebral hemorrhage in each group of mice; BC is the quantitative analysis of Mfsd2a / Caveolin-1 protein expression in each group of mice (data are mean ± SEM, *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, multiple comparison test, n=6); D is a representative image of double immunofluorescence staining of Mfsd2a (green) in the hematoma area after intracerebral hemorrhage in each group of mice; E is the quantitative analysis of Mfsd2a fluorescence intensity in each group of mice (*p<0.05, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); F is the quantitative analysis of Caveolin-1 in the hematoma area after intracerebral hemorrhage in each group of mice. (Green) Representative images of double immunofluorescence staining; G is the quantitative analysis of Caveolin-1 fluorescence intensity in each group of mice (***p<0.001, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6); H is the representative transmission electron microscopy (TEM) image of vesicles in the perihematomal area after intracerebral hemorrhage in each group of mice; arrows indicate vesicles in endothelial cells; L: lumen EC: endothelial cells BM: basement membrane P: pericyte; I is the quantitative analysis of vascular vesicle density in each group of mice (**p<0.01, ***p<0.001, ****p<0.0001, one-way ANOVA, Tukey's multiple comparison test, n=6). DETAILED DESCRIPTION

[0020] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below through embodiments in combination with the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0021] The test methods described in the following examples are all conventional techniques in the art, or are based on the conditions recommended by the manufacturers unless otherwise specified; the reagents, materials and instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0022] Example 1: Study on the expression of Sphk1 in vascular endothelial cells around the hematoma after cerebral hemorrhage This example compares brain tissue samples from patients with acute intracerebral hemorrhage (ICH) and normal controls. SPHK1mRNA and protein expression of Sphk1 and serum S1P content; collagenase injection was used to establish a mouse cerebral hemorrhage model, and qPCR, Western blot, ELISA and immunofluorescence staining were used to detect the expression of Sphk1 mRNA and protein in the vascular endothelial cells around the hematoma after cerebral hemorrhage. SPHK1 The expression of Sphk1 mRNA and protein and serum S1P content were detected.

[0023] 1. Test methods 1.1 Sources of human tissue samples Six acute intracerebral hemorrhage (ICH) samples and six normal brain tissue samples were collected from the Department of Neurosurgery, The First Affiliated Hospital of Zhengzhou University. All procedures were approved by the Human Experimentation Ethics Committee of Zhengzhou University (approval number: 2021-KY-0156), informed consent was obtained, and the study was approved by the University Review Board, and it was conducted in accordance with the Declaration of Helsinki.

[0024] Inclusion criteria: clear clinical diagnosis of spontaneous ICH. ICH confirmed by imaging examinations (such as CT or MRI). Specimen collection within 24 hours after the onset of hemorrhage. Informed consent was signed by the patient or his legal representative. Age and gender met the requirements of the study protocol. Exclusion criteria: bleeding caused by trauma, tumor, vascular malformation or other non-spontaneous factors; severe coagulation dysfunction or taking anticoagulants; other serious neurological diseases, such as cerebral infarction, brain tumor, severe brain trauma, etc.; severe systemic diseases, such as severe heart, lung, liver, and kidney dysfunction; pregnant or lactating women. Known history of allergy to experimental procedures or reagents; other conditions that are not suitable for participation in the study. Six patients with acute ICH and patients with basal ganglia hematoma volume exceeding 40 ml underwent microscope-guided minimally invasive surgery. Informed consent was obtained for the collection of 6 perihematoma tissue samples (ICH group). As a control, 6 normal brain tissue samples (Normal group) were collected during non-functional tissue resection in patients with deep meningioma, and the patients gave explicit written consent for this purpose. No significant differences were found in general data between the two groups.

[0025] 1.2 Construction of mouse intracerebral hemorrhage model All procedures involving animal experiments in this invention have been approved by the Animal Care and Use Committee (IACUC) of Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences (approval number: SIAT-IACUC-231116-FMZ-A2385). Adult male C57BL / 6J mice (8-10 weeks old, weighing 20-25 g, purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) were used in this study. All mice were housed in a barrier facility with a 12-h day-night cycle and had free access to standard mouse chow and water.

[0026] A mouse intracerebral hemorrhage (ICH) model was established. Collagenase (type VII collagenase, 0.15 U) was injected into the right basal ganglia of the mouse (2.0 mm to the right of the anterior fontanelle, 0.2 mm in front, and about 3.0 mm in depth) by in situ injection. The needle was withdrawn at a speed of 0.5 mm / 30 s, and then sutured with 4-0 sutures. Samples were collected at 6 h, 12 h, 1 d, 2 d, 3 d, and 7 d after the operation for subsequent experiments. The above model was constructed as follows: Figure 1 I. The control group (Sham) was injected with an equal volume of saline as a control.

[0027] 1.3 Real-time fluorescence quantitative PCR (qPCR) Total mRNA was extracted from tissues and cells using a kit according to the manufacturer's instructions (Vazyme, China), and then cDNA conversion was performed using a high-capacity cDNA reverse transcription kit (Vazyme, China). The mRNA expression of each gene was analyzed by RT-qPCR using SYBRGreen Mix (Vazyme, China) and a LightCycler96 instrument (Roche, Switzerland). The data were normalized to the internal control gene β-Actin. The following primer sequences were used: Human: SPHK1 forward primer: TCTGCTTGGTCCAATGTGCAA, SPHK1 reverse primer: GGAACAGTTCGTGTCATCCTC. ACTB forward primer: GCTGCATTTAGTGGCCTCATT, ACTB reverse primer: GCAAGGCATAACCTGATGTGG. Mouse: Sphk1 forward primer: GCAACGTGGAATCACCACTGA, Sphk1 reverse primer: CAGCCAGTAGTCTGTGGACTC. Actb forward primer: ATGACCCAAGCCGAGAAGG, Actb reverse primer: CGGCCAAGTCTTAGAGTTGTTG.

[0028] 1.4 Western blot C57BL / 6J mice were deeply anesthetized and then intracardially perfused with ice-cold PBS. Perihematoma tissues of the ipsilateral cerebral hemisphere were collected, frozen with liquid nitrogen, and then stored in a -80°C freezer until use. All collected samples were lysed in RIPA lysis (Solarbio, China) buffer with protease inhibitors for 15 min, centrifuged at 12000g (4°C, 15 min), and then the supernatant was collected. Protein concentration was determined using BCA (Solarbio, China). Equal amounts of protein samples were loaded onto SDS-PAGE gels, followed by electrophoresis and transfer onto PVDF membranes. PVDF membranes were blocked with 5% skim milk (Thermo Fisher Scientific, USA) for 2 h and incubated with the following primary antibodies overnight at 4°C: anti-Sphk1 (1:1000, Thermo Fisher Scientific, USA); anti-β-Actin (1:1000, CST, USA); anti-GAPDH (1:1000, Cell Signaling Technology, USA); anti-Claudin-5 (1:1000, Thermo Fisher Scientific, USA); anti-Occludin (1:1000, Thermo Fisher Scientific, USA); anti-ZO-1 (1:1000, Thermo Fisher Scientific, USA); anti-Mfsd2a (1:1000, Cell Signaling Technology, USA); and anti-Caveolin-1 (1:1000, Cell Signaling Technology, USA) antibodies. The next day, the membrane was incubated with species-specific secondary antibodies (1:2000, Cell Signaling Technology, USA) at room temperature for 1 hour. The ECL+ chemiluminescence kit (Amersham Bioscience, USA) was selected for immunoblotting visualization. ImageJ (NIH, Bethesda, USA) was used to quantify the density of the bands, and the results were normalized with β-Actin as a control.

[0029] 1.5 Enzyme-linked immunosorbent assay (ELISA) Enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer's instructions. Human and mouse serum was obtained by centrifuging blood at 4°C for 20 minutes, and the supernatant was used for subsequent experiments. The level of S1P (sphingosine-1-phosphate) was measured using a commercial ELISA kit (Product No.: RXJ106471H, Ruixin, China).

[0030] 1.6 Immunofluorescence staining Deeply anesthetize C57BL / 6J mice and perfuse the heart with about 20 ml of pre-cooled PBS, then take the brain tissue around the cerebral hematoma. Wash the tissue with PBS, fix it with 4% PFA at room temperature for 1 hour, then dehydrate it with 15% sucrose at room temperature for 1-2 hours, and then transfer it to 30% sucrose at 4°C for dehydration overnight. After dehydration, embed it with OCT and freeze it at -80°C for use. Use a freezing microtome to cut the OCT-embedded tissue into 10μm slices and place them at -80°C for use. The sections were removed and dried at room temperature for about 1 hour, washed three times with PBS, 10 minutes each time, incubated with blocking solution (PBS containing 5% goat blood + 1% BSA + 0.3% Triton + 0.1% NaN3) at room temperature for 1 hour, and then incubated with primary antibodies (PBS containing 1% BSA + 0.3% Triton + 0.1% NaN3, group 1: rabbit Sphk1: 1 / 100, mouse Iba-1: 1 / 500, group 2: rabbit Sphk1: 1 / 100, chicken GFAP: 1 / 1000, group 3: rabbit Sphk1: 1 / 100, mouse NeuN: 1 / 500, group 4: rabbit Sphk1: 1 / 100, mouse NeuN: 1 / 500, group 5: rabbit Sphk1: 1 / 100 :1 / 100, hamster CD31:1 / 500, fifth group: rabbit Claudin-5:1 / 100, hamster CD31:1 / 500, sixth group: rabbit Occludin:1:100, hamster CD31:1 / 500, seventh group: ZO-1:1:100, hamster CD31:1 / 500, eighth group: rabbit Mfsd2a:1:1000, hamster CD31:1:500, ninth group: Caveolin-1:1:1 000, hamster CD31: 1:500. Then wash with PBS for 3 times, 10 minutes each time, incubate with secondary antibody (PBS containing 1% BSA + 0.3% Triton + 0.1% NaN3, anti-rabbit-488: 1 / 500, anti-mouse-594: 1 / 500, anti-hamster-594: 1 / 500) at room temperature for 1 hour, wash with PBS for 3 times, 10 minutes each time, and finally seal with antifade sealing medium containing DAPI, observe with fluorescence microscope or store at 4°C.

[0031] 2. Test results qPCR detection of human brain tissue samples in ICH group and Normal group SPHK1 The mRNA expression results are as follows Figure 1 As shown in A, compared with the Normal group, the perihematoma area of ​​the ICH group was SPHK1 The expression of mRNA was significantly increased.

[0032] Western blot detection of Sphk1 protein expression in human brain tissue samples from the ICH group and the Normal group Figure 1 As shown in B and C, compared with the Normal group, the Sphk1 protein in the perihematoma area of ​​the ICH group was significantly increased 24 hours after ICH.

[0033] qPCR detection of brain tissue of mice in ICH group and Sham group Sphk1 The mRNA expression results are as follows Figure 1 D shows that compared with the Sham group, the ICH group mice had Sphk1 The mRNA expression was significantly increased.

[0034] The results of Western blot and immunofluorescence staining to detect the expression of Sphk1 protein in the brain tissue of mice in the ICH group and the Sham group are shown in Figure 1 E, F, and Figure 1 As shown in M ​​and N, compared with the Sham group, the Sphk1 protein in the perihematoma area of ​​the mice in the ICH group increased significantly 24 hours after ICH.

[0035] The results of ELISA detection of S1P content in human and mouse serum are shown in Figures G and H. Compared with the Normal group and Sham group, the serum S1P content levels of humans and mice were significantly increased 24 hours after cerebral hemorrhage.

[0036] qPCR and Western blot were used to detect the expression of cytokines in the perihematoma area of ​​mice in the Sham group and ICH group at 6h, 12h, 1d, 2d, 3d, and 7d after cerebral hemorrhage. Sphk1 The results of mRNA and Sphk1 protein expression are shown in Figure 1 JL, mouse perihematoma area Sphk1 The expression levels of Sphk1 mRNA and protein were highest 12h after ICH.

[0037] Tissue immunofluorescence staining was used to detect the tissue distribution of Sphk1 protein in the sham group and ICH group of mice after intracerebral hemorrhage. Figure 1 As shown in M ​​and N, it can be seen that 24 hours after cerebral hemorrhage, most of the Sphk1 (green) around the hematoma co-localizes with the vascular endothelial cell marker CD31 (red), indicating that Sphk1 is mainly expressed in vascular endothelial cells, and it can be seen that the expression of Sphk1 protein is significantly increased.

[0038] These results indicate that the expression of Sphk1 is increased in vascular endothelial cells around the hematoma after intracerebral hemorrhage (ICH).

[0039] Example 2: Study on the protective effect of Sphk1 selective inhibitor PF543 on motor function in mice In this example, ELISA was used to detect the serum S1P levels of four groups of mice, namely the control group (Sham), hemorrhage group (ICH), solvent group (ICH + Vehicle) and test group (ICH + PF543), and the cerebral hematoma volume, brain water content, brain swelling, survival rate and neurobehavioral score of the mice were detected to study the protective effect of Sphk1 selective inhibitor PF543 on the motor function of mice.

[0040] 1. Test methods 1.1 Construction and grouping of mouse cerebral hemorrhage model The method for establishing the mouse cerebral hemorrhage model was as described in 1.2 of Example 1, and the control group (Sham) was injected with an equal amount of normal saline as a control. The mice with cerebral hemorrhage model were randomly divided into hemorrhage group (ICH), solvent group (ICH + Vehicle) and test group (ICH + PF543) (n = 6). The mice in the test group (ICH + PF543) were intraperitoneally injected with PF543 solution 1 hour after modeling. The preparation method of PF543 solution was as follows: 5 mg PF543 powder was dissolved in 250 μl DMSO stock solution and mixed to form a 40 mM working solution. The injection dose of PF543 solution was 10 mg / kg body weight. Each mouse weighed about 20 g, so 10 μl of the prepared 40 mM PF543 solution was added to 190 μl saline, mixed and injected intraperitoneally. The mice in the solvent group were intraperitoneally injected with 5% DMSO solution 1 hour after modeling. The preparation method of 5% DMSO solution was as follows: 10 μl DMSO stock solution was added to 190 μl saline to make a 5% DMSO solution. The injection dose for each mouse was 200 μl. In the next two days, the mice in the solvent group (ICH The mice in the ICH + Vehicle group and the experimental group (ICH + PF543) were given the drug once a day for a total of 3 times. Samples were taken 3 days after cerebral hemorrhage for subsequent experiments. The dosing schedule for mice and the subsequent molecular biology test model are shown in the figure. Figure 2 A.

[0041] 1.2 Enzyme-linked immunosorbent assay (ELISA) Refer to 1.5 in Example 1 for the test method.

[0042] 1.3 Quantitative analysis of cerebral hematoma volume and brain edema: Briefly, in mouse brain sections, the hematoma area was multiplied by the thickness of the hematoma volume of each brain section, and then the sum of all hematoma volumes was calculated. Brain water content was calculated as (wet weight - dry weight) / wet weight × 100%.

[0043] 1.4 MRI examination of mouse brain Magnetic resonance imaging (MRI) was used to assess brain swelling 72 h after intracerebral hemorrhage (ICH). Mice were anesthetized with 1.5% isoflurane and placed on a scanning stand. Body temperature, heart rate, and blood oxygen saturation were monitored during scanning. MRI scanning was performed using a 9.4T MRI scanner (uMR930, China United Imaging). T2 maps were acquired using a fast spin echo (FSE) sequence. During MRI acquisition, the following parameters were used: zoom: 1.00, KF: SM, IF: SM, fixed TP: 0, SP: H3.5, field of view (FOV) = 19 × 19 mm, 0.5 mm slice thickness, matrix: 384 × 384, TRA>COR5.0>SAG-1.1, window width (WW): 411, window level (WL): 207. Brain swelling was calculated as follows: (affected brain area-contralateral brain area) / affected brain area × 100%.

[0044] 1.5 Calculation of mouse survival rate: When drawing the mouse survival curve, the survival rate of mice is calculated according to the following steps: Determine the survival status: Record the survival status of each mouse during the experiment, that is, whether it is alive or dead. Calculate the survival ratio: At a specific time point (0h, 12h, 24h, 36h, 48h, 60h, 72h after ICH), calculate the ratio of the number of surviving mice to the initial total number of mice. This ratio is expressed as a percentage. Survival rate formula: The survival rate is calculated using the following formula: Survival rate (%) = (number of surviving mice / initial total number of mice) × 100.

[0045] 1.6 Neurobehavioral score: Neurological function was assessed using the Longa test, Bederson scale, limb placement test, corner turn test, and beam walking test. The Longa test was used to assess forelimb walking and limb movement symmetry, with a maximum score of 4 points, with higher scores indicating more severe neurological deficits. The Bederson scale was used to assess tactile perception, axial sensation, and forelimb activity. The limb placement test was used to selectively block the cortical sensorimotor area, including visually induced, tactilely induced, and proprioceptive induced limb placement responses, to test the forelimb and lateral limb placement response function of mice. In the corner turn test, mice were allowed to enter a 30° corner, and the number of left or right turns was recorded, repeated 10 times, and the average percentage of left turns was calculated. The beam walking test was performed using a device consisting of a long piece of wood suspended at a height of 60 cm, with a closed box attached to the other end. After being trained to cross the beam to reach the closed box, the mice were placed 20 cm from the start of the beam, and the time required to cross the beam and the number of times the foot slipped off the beam were recorded.

[0046] 2. Test results The ELISA test results of each group of mice are as follows Figure 2 As shown in B, compared with the Sham group, the serum S1P content of mice in the ICH group and ICH + Vehicle group was significantly increased, and compared with the ICH group and ICH + Vehicle group, the serum S1P content of mice in the ICH + PF543 group was significantly decreased.

[0047] The brain sections and cerebral hematoma volume of each group of mice were Figure 2 As shown in C and D, compared with the Sham group, the ICH group and ICH + Vehicle group had obvious cerebral hematoma. Compared with the ICH group and ICH + Vehicle group, the volume of cerebral hematoma in the ICH + PF543 group was significantly reduced. The brain water content of mice in each group is shown in Figure 2 As shown in E, compared with the Sham group, the brain water content of mice in the ICH group and ICH + Vehicle group was significantly increased, and compared with the ICH group and ICH + Vehicle group, the brain water content of mice in the ICH + PF543 group was significantly reduced; the brain magnetic resonance images and brain swelling results of mice in each group are shown in Figure 2 As shown in F and G, compared with the Sham group, the ICH group and ICH + Vehicle group showed obvious brain swelling. Compared with the ICH group and ICH + Vehicle, the degree of brain swelling in the mice in the ICH + PF543 group was significantly reduced, indicating that PF543 treatment effectively alleviated ICH-induced brain edema.

[0048] The survival rate of mice in each group is shown in Figure 2 As shown in H, compared with the Sham group, the survival rate of mice in the ICH group and ICH + Vehicle group was significantly decreased, and compared with the ICH group and ICH + Vehicle, the survival rate of mice in the ICH + PF543 group showed an upward trend; the neurobehavioral scores of mice in each group are shown in Figure 2 As shown in IM, compared with the Sham group, the motor function of mice in the ICH group and ICH + Vehicle group was significantly decreased, and compared with the ICH group and ICH + Vehicle group, the motor function of mice in the ICH + PF543 group was significantly improved.

[0049] The above results indicate that the Sphk1 selective inhibitor PF543 has a protective effect on the motor function of mice and reduces brain edema 3 days after ICH.

[0050] Example 3: Study on the protective effect of Sphk1 selective inhibitor PF543 on the blood-brain barrier (BBB) ​​after intracerebral hemorrhage in mice In this example, the blood-brain barrier (BBB) ​​leakage of four groups of mice, namely the control group (Sham), hemorrhage group (ICH), vehicle group (ICH + Vehicle) and experimental group (ICH + PF543), 3 days after intracerebral hemorrhage was detected by Evans blue extravasation test, horseradish peroxidase extravasation test (HRP) and immunofluorescence staining.

[0051] 1. Test methods 1.1 Construction and grouping of mouse cerebral hemorrhage model The test method is as in Example 2, 1.1.

[0052] 1.2 Evans blue extravasation test: First, 2% EB dye was prepared by resuspending EB powder (Sigma-Aldrich, USA) in physiological saline. After 100 μl of 2% EB dye was injected into the circulation from the rat tail vein for 4 hours, the mouse was perfused with ice PBS through the heart to remove the intravascular dye. The brain was divided into the ipsilateral hematoma hemisphere and the contralateral non-hematoma hemisphere, then homogenized with 1 ml of 50% trichloroacetic acid and centrifuged (10,000 rpm, 20 min). After centrifugation, the supernatant was diluted 4 times with ethanol, and the concentration of EB was measured using a fluorescence reader (Thermo Fisher Scientific, USA) at 620 nm excitation.

[0053] 1.3 Horseradish peroxidase extravasation test: Horseradish peroxidase (HRP) type II (0.5 mg / g, SigmaAldrich, USA) was dissolved in 0.2 ml PBS and then injected into the rat tail vein. After circulating for 30 min, the mouse brain was dissected into 3 mm slices and fixed with 4% paraformaldehyde. After dehydration with sucrose, the brain specimens were cut into 30 μm thick coronal slices and incubated with DAB solution (Solarbio, China) at room temperature for 10 min. The extravasated HRP was observed under a light microscope.

[0054] 1.4 Immunofluorescence staining Refer to 1.6 in Example 1 for the test method.

[0055] 2. Test results The results of Evans blue extravasation test in the brain of mice in each group are as follows Figure 3 As shown in A and B, compared with Sham, the Evans blue exudation of mice in ICH group and ICH + Vehicle group was significantly increased, and compared with ICH group and ICH + Vehicle group, the Evans blue exudation of mice in ICH + PF543 group was significantly reduced.

[0056] The results of HRP extravasation test in each group of mice are shown in Figure 3 As shown in C and D, compared with Sham, HRP extravasation in mice in the ICH group and ICH + Vehicle group was significantly increased, and compared with the ICH group and ICH + Vehicle group, HRP extravasation in mice in the ICH + PF543 group was significantly reduced.

[0057] The immunofluorescence staining results of each group of mice are shown in Figure 3 As shown in E and F, compared with Sham, the IgG extravasation of mice in the ICH group and ICH + Vehicle group was significantly increased, and compared with the ICH group and ICH + Vehicle group, the IgG extravasation of mice in the ICH + PF543 group was significantly reduced.

[0058] The above results indicate that the Sphk1 selective inhibitor PF543 can reduce blood-brain barrier (BBB) ​​leakage 3 days after intracerebral hemorrhage in mice.

[0059] Example 4: The protective effect of Sphk1 selective inhibitor PF543 on tight junction (TJ) proteins in mice with intracerebral hemorrhage.

[0060] In this example, the expression levels of tight junction proteins Claudin-5, Occludin, and ZO-1 in the perihematomal area after intracerebral hemorrhage in four groups of mice, namely, the control group (Sham), the hemorrhage group (ICH), the solvent group (ICH + Vehicle), and the experimental group (ICH + PF543), were detected by Western blot and immunofluorescence staining, and the open percentages of tight junction proteins in the perihematomal area after intracerebral hemorrhage in these four groups of mice were detected by transmission electron microscopy.

[0061] 1. Test methods 1.1 Construction and grouping of mouse cerebral hemorrhage model The test method is as in Example 3, 1.1.

[0062] 1.2 Western blot The test method is as in 1.4 of Example 1.

[0063] 1.3 Immunofluorescence staining The test method is as in 1.4 of Example 3.

[0064] 1.4 Transmission electron microscopy Mouse brain sections were dehydrated in graded ethanol and embedded in epoxy resin. Ultrathin sections (80 nm) were collected on copper grids after cutting from the surface of the embedding blocks and stained with uranyl acetate and Reynolds lead citrate. The ultrastructure of the brain was scanned using a JEM-1400 Plus transmission electron microscope (JEOL, Tokyo, Japan).

[0065] 2. Test results The Western blot results and immunofluorescence staining results of each group of mice are shown in Figure 4 As shown in AJ, compared with Sham, the expressions of tight junction proteins Claudin-5, Occludin, and ZO-1 in mice in ICH group and ICH + Vehicle group were reduced, and compared with ICH group and ICH + Vehicle group, the expressions of tight junction proteins Claudin-5, Occludin, and ZO-1 in mice in ICH + PF543 group were increased.

[0066] Transmission electron microscopy results of tight junction proteins in the perihematoma area of ​​mice after intracerebral hemorrhage in each group are as follows Figure 4 As shown in K and L, compared with Sham, the open proportion of tight junction proteins in mice in the ICH group and ICH + Vehicle group was significantly increased, and compared with the ICH group and ICH + Vehicle group, the open proportion of tight junction proteins in mice in the ICH + PF543 group was significantly decreased.

[0067] The above results showed that the Sphk1 selective inhibitor PF543 prevented the degradation of tight junction (TJ) proteins 3 days after ICH in mice.

[0068] Example 5: Study on the protective effect of Sphk1 selective inhibitor PF543 on BBB permeability.

[0069] In this example, the expression levels of Caveolin-1 and Mfsd2a in the perihematomal area of ​​four groups of mice after intracerebral hemorrhage, namely, the control group (Sham), hemorrhage group (ICH), vehicle group (ICH + Vehicle) and experimental group (ICH + PF543), were detected by Western blot and immunofluorescence staining, and the number of vesicles in the perihematomal area of ​​these four groups of mice after intracerebral hemorrhage was detected by transmission electron microscopy.

[0070] 1.1. Test methods 1.1 Construction and grouping of mouse cerebral hemorrhage model The test method is as in Example 4, 1.1.

[0071] 1.2 Western blot The test method refers to 1.2 in Example 4.

[0072] 1.3 Immunofluorescence staining The test method is as in 1.3 of Example 4.

[0073] 1.4 Transmission electron microscopy: The test method refers to Example 4-14.

[0074] 2. Test results Western blot and immunofluorescence staining results of mice in each group are shown in Figure 5 As shown in AG, compared with Sham, the expression of Mfsd2a protein in the mice in the ICH group and ICH + Vehicle group was decreased, and the expression of Caveolin-1 protein was increased. Compared with the ICH group and ICH + Vehicle group, the expression of Mfsd2a protein in the mice in the ICH + PF543 group was increased, and the expression of Caveolin-1 protein was decreased.

[0075] The transmission electron microscopy results of vesicles in the perihematoma area of ​​mice after intracerebral hemorrhage are shown in Figure 2. Figure 5 As shown in H and I, compared with Sham, the number of vesicles in the ICH group and ICH + Vehicle group of mice was significantly increased, and compared with the ICH group and ICH + Vehicle group, the number of vesicles in the ICH + PF543 group of mice was significantly decreased.

[0076] The above results indicate that the Sphk1 selective inhibitor PF543 improves the permeability of the mouse blood-brain barrier by reducing the Mfsd2a / Caveolin-1-mediated endocytosis pathway at 3 days after ICH.

[0077] In summary, the present invention has proved through in vivo experiments in mice that PF543 has the effect of inhibiting the formation of brain edema after cerebral hemorrhage, which is mainly achieved by protecting the integrity of the blood-brain barrier, preventing the destruction of tight junction proteins between endothelial cells, and reducing the endocytosis of endothelial cells. Our test results show that PF543 has no obvious systemic toxicity in mice, so the PF543 small molecule compound can be used to prepare an effective drug for preventing, alleviating and / or treating brain edema after cerebral hemorrhage. The role of the above embodiments is to illustrate the substantive content of the present invention, but it is not intended to limit the scope of protection of the present invention. Those of ordinary skill in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of protection of the technical solution of the present invention.

Claims

1. Use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for preventing, alleviating and / or treating brain edema after cerebral hemorrhage.

2. Use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for preventing, alleviating and / or treating blood-brain barrier leakage after cerebral hemorrhage.

3. Use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for preventing, alleviating and / or treating the degradation of tight junction proteins after cerebral hemorrhage.

4. The use according to claim 3, characterized in that The tight junction proteins include Claudin-5, Occludin, and ZO-1.

5. Use of a substance that inhibits the expression and / or function of Sphk1 in the preparation of a drug for improving the permeability of the blood-brain barrier after cerebral hemorrhage.

6. The use according to claim 5, characterized in that: The drug improves the permeability of the blood-brain barrier by inhibiting or / and reducing the endocytosis of endothelial cells.

7. The use according to claim 6, characterized in that The endocytosis is Mfsd2a / Caveolin-1-mediated endocytosis.

8. The use according to any one of claims 1 to 7, characterized in that: The substance that inhibits the expression and / or function of Sphk1 is an inhibitor of Sphk1 protein or a siRNA that specifically targets the Sphk1 gene or a shRNA that specifically targets the Sphk1 gene.

9. The use according to claim 8, characterized in that The inhibitor of Sphk1 protein is PF543.

10. A drug comprising a substance that inhibits Sphk1 expression and / or function and a pharmaceutically acceptable carrier or excipient, wherein the drug is used to prevent, alleviate and / or treat brain edema after cerebral hemorrhage or / and blood-brain barrier leakage or / and tight junction protein degradation or / and improve blood-brain barrier permeability after cerebral hemorrhage.

Images