Penicillin G expansible ring enzyme mutant, polynucleotide, expression vector and application

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a penicillin G expansin mutant, polynucleotide, an expression vector and application. The mutant is a mutant with R27M point mutation on an amino acid sequence as shown in SEQ ID NO.19 in a sequence table. And the gene also comprises point mutation of one or more of the following positions: L50V, M73T, R139K, Y184H, Y217A, R249A and T292A. The conversion rate of converting penicillin G into G-7-ADCA under catalysis of the mutant provided by the invention is obviously improved compared with that of a wild type, and the mutant has a relatively good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine technology, and specifically relates to a penicillin G expandase mutant and polynucleotide, an expression vector and uses. Background Art

[0002] Cephalosporin antibiotics are widely used in clinical practice. They have strong selective effects on bacteria and are almost non-toxic to humans. They have the advantages of broad antibacterial spectrum, strong antibacterial effects, penicillinase resistance, and less allergic reactions than penicillins. They are widely used in the market. 7-Amino-3-deacetoxycephalosporanic acid (7-ADCA) is one of the important nuclei for the synthesis of cephalosporin antibiotics. As an important intermediate for semi-synthetic cephalosporin antibiotics, the demand for it is gradually increasing.

[0003] At present, there are two main methods for industrial production of 7-ADCA: chemical enzymatic method and fermentation method. The chemical enzymatic method for preparing 7-ADCA uses penicillin G as raw material, and obtains phenylacetyl-7-amino-3-deacetoxycephalosporanic acid (G-7-ADCA) after chemical oxidation, ring expansion, and rearrangement. Then, the side chain is removed under the action of penicillin acylase to obtain 7-ADCA. This method has the disadvantages of high cost and environmental unfriendly. With the further development of industrial processes, this method has been gradually eliminated. The industrial production of 7-ADCA can also use the fermentation method. In a report in 1995, it was first predicted that there was an enzyme that could convert the five-membered ring of penicillin G into the six-membered ring of G-7-ADCA. Shortly thereafter, in 1998, Cho and his colleagues discovered that the expandase (DAOCS) could catalyze this reaction, making the theoretical method a reality. At present, the commonly used method in industry is to clone the expandase gene into Pseudomonas, Penicillium chrysogenum or Streptomyces clavuligerus, add phenylacetic acid, salt or ester as substrate, and obtain G-7-ADCA by one-step fermentation. Subsequently, G-7-ADCA removes the phenylacetyl side chain under the catalysis of acyltransferase to obtain 7-ADCA.

[0004] The preparation of 7-ADCA by the whole enzyme method has the advantages of being green, environmentally friendly and low cost. The whole enzyme method starts from the cheap penicillin G salt, generates G-7-ADCA through the catalytic ring expansion reaction of penicillin G expandase, and then hydrolyzes and removes the acyl side chain through the action of penicillin acylase to generate 7-ADCA. The synthetic route is as follows: .

[0005] Penicillin acylase has been well studied and has been used in industry for many years. Currently, immobilized penicillin acylase is more commonly used, while expandase has low activity and is the rate-limiting step in the synthesis of 7-ADCA from penicillin G. Therefore, there is an urgent need to improve the availability and activity of expandase.

[0006] Penicillin G expandase (DAOCS), also known as deacetyloxycephalosporin C synthetase, is a 2+ It works in the presence of , O2 and α-ketoglutaric acid, and mainly catalyzes the conversion of the five-membered thiazole ring of penicillin to the six-membered thiazine ring. It is a key step in catalyzing the synthesis of cephalosporin antibiotics by Streptomyces rod-shaped and other prokaryotes. This reaction does not require the exogenous addition of phenylacetic acid and other easily made-to-drug chemicals as substrates, and is also environmentally friendly. Therefore, DAOCS has important industrial application value. However, in practical applications, it was found that DAOCS had low biological activity in catalyzing penicillin G and could not meet industrial applications. This became the rate-limiting step in the synthesis of 7-ADCA using the whole enzyme method. Therefore, it is urgent to modify the expandase in order to greatly improve its conversion efficiency of penicillin G and lay a foundation for industrial applications. At present, the crystal structure of scDAOCS derived from Streptomyces clavuligerus has been obtained, and its amino acid sequence is shown in the sequence listing SEQ ID NO.19 (WT-scDAOCS), and the nucleotide sequence is shown in the sequence listing SEQID NO.20. This makes it possible to transform scDAOCS through protein engineering technology, improve its catalytic activity and broaden its substrate spectrum, providing broad industrial application prospects for the enzymatic production of 7-ADCA. Summary of the invention

[0007] The purpose of the present invention is to provide mutants of penicillin G expandase, wherein the mutants are substituted at one or more positions of the parent polypeptide and have significantly improved activity compared with the parent polypeptide. The present invention also provides genes encoding the mutants, nucleic acid constructs, vectors, host cells, and uses of the mutants.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is: a mutant of penicillin G expandase, which is a mutant having an R27M point mutation in the amino acid sequence shown in SEQ ID NO.19.

[0009] Preferably, the mutant further comprises point mutations at one or more of the following positions: L50V, M73T, R139K, Y184H, Y217A, R249A and T292A.

[0010] The present invention also provides a polynucleotide encoding the mutant.

[0011] The present invention further provides an expression vector comprising the polynucleotide, wherein the expression vector is used to encode and produce the one or more mutants in an expression host.

[0012] The present invention further provides a recombinant host cell comprising the expression vector.

[0013] The present invention further provides the use of the mutant, which is used to synthesize phenylacetyl-7-amino-3-deacetoxycephalosporanic acid (G-7-ADCA) using penicillin G as a raw material.

[0014] The present invention further provides a penicillin G ring expansion composition, which comprises the mutant, the expression vector or the recombinant host cell.

[0015] The present invention further provides a method for preparing the mutant, which comprises: culturing the recombinant host cell and recovering the mutant.

[0016] The present invention further provides a method for preparing phenylacetyl-7-amino-3-deacetoxycephalosporanic acid using the mutant. The method uses penicillin G as a raw material, adds the mutant, recombinant host cell culture or fermentation liquid into the reaction system, and reacts for 1.5-2 hours.

[0017] The mutant provided by the present invention catalyzes the conversion rate of penicillin G into G-7-ADCA, which is significantly higher than that of the wild type, and has good application prospects. The present invention also constructs an expandase mutant expression library, and compared with the wild-type expandase, the enzyme activity is greatly improved, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The plasmid map is pET30a-scDAOCS. DETAILED DESCRIPTION

[0019] In order to facilitate the understanding of the present invention, the present invention is described in more detail below in conjunction with the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0020] 1. Mutants The present invention relates to isolated penicillin G expandase mutants comprising substitutions at one or more of positions 27, 50, 73, 139, 184, 217, 249, 292 of the polypeptide shown in the sequence table SEQ ID NO. 19, and these mutants have the activity of catalyzing the conversion of the five-membered thiazole ring of penicillin into a six-membered thiazine ring.

[0021] The above-mentioned variants having substitutions or deletions should be understood to cover all possible combinations of one or more substitutions or deletions at the specified positions.

[0022] The penicillin G expandase mutant comprises point mutations at one or more of the following positions: R27M, L50V, M73T, R139K, Y184H, Y217A, R249A and T292A.

[0023] When there are two point mutations at the same time, the mutation positions include any one of the following combinations: R27M and L50V; R27M and R139K; R27M and M73T; R27M and Y184H; R27M and Y217A; R27M and R249A; R27M and T292A.

[0024] When there are three point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V and R139K; R27M, L50V and Y184H; R27M, L50V and Y217A; R27M, L50V and R249A; R27M, L50V and M73T; R27M, L50V and T292A; R27M, R139K and Y184H; R27M, R139K and Y217A; R27M, R139K and R249A; R27M , R139K and T292A; R27M, R139K and M73T; R27M, Y184H and Y217A; R27M, Y184H and R249A; R27M, Y184H and M73T; R27M, Y184H and T292A; R27M, Y217A and R249A; R27M, Y217A and M73T; R27M, Y217A and T292A; R27M, R249A and M73T; R27M, R249A and T292A.

[0025] When there are 4 point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V, R139K and Y184H; R27M, L50V, R139K and Y217A; R27M, L50V, R139K and R249A; R27M, L50V, R139K and M73T; R27M, L50V, R139K and T292A; R27M, R139K, Y184H and Y217A; R27M, R139K , Y184H and R249A; R27M, R139K, Y184H and M73T; R27M, R139K, Y184H and T292A; R27M, Y184H, Y217A and R249A; R27M, Y184H, Y217A and M73T; R27M, Y184H, Y217A and T292A; R27M, Y217A, R249A and M73T; R27M, Y217A, R249A and T292A.

[0026] When there are five point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V, R139K, Y184H, and Y217A; R27M, L50V, R139K, Y184H, and R249A; R27M, L50V, R139K, Y184H, and M73T; R27M, L50V, R139K, Y184H, and T292A; R2 7M, R139K, Y184H, Y217A and R249A; R27M, R139K, Y184H, Y217A and M73T; R27M, R139K, Y184H, Y217A and T292A; R27M, Y184H, Y217A, R249A and M73T; R27M, Y184H, Y217A, R249A and T292A.

[0027] When there are 6 point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V, R139K, Y184H, Y217A and R249A; R27M, L50V, R139K, Y184H, Y217A and M73T; R27M, L50V, R139K, Y184H, Y217A and T292A; R27M, R139K, Y184H, Y217A, R249A and M73T; R27M, R139K, Y184H, Y217A, R249A and T292A; R27M, Y184H, Y217A, R249A, M73T and T292A.

[0028] When there are 7 point mutations at the same time, the mutation positions include any one of the following combinations: R27M, L50V, R139K, Y184H, Y217A, R249A and M73T or R27M, L50V, R139K, Y184H, Y217A, R249A and T292A.

[0029] When there are 8 point mutations at the same time, the mutation positions include: R27M, L50V, R139K, Y184H, Y217A, R249A, M73T and T292A.

[0030] In a further embodiment, except for the specified substitution or deletion, the variant is selected from the group consisting of: a) a polypeptide having at least 65% sequence identity with the polypeptide shown in SEQ ID NO.9 in the sequence listing; b) a polypeptide encoded by a polynucleotide that hybridizes with the mature polypeptide coding sequence of SEQ ID NO. 9 in the sequence listing, or with the full-length complement of SEQ ID NO. 9 under low stringency conditions; c) a polypeptide encoded by a polynucleotide having at least 65% identity with the mature polypeptide coding sequence shown in SEQ ID NO.9 in the sequence listing; d) A fragment of the polypeptide shown in SEQ ID NO.9 in the sequence listing having penicillin G expandase activity.

[0031] These variants may further comprise one or more additional substitutions at one or more (e.g., several) other positions. These amino acid changes may be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; typically smaller deletions of 1-30 amino acids; smaller amino or carboxyl terminal extensions, such as an amino-terminal methionine residue; smaller linker peptides of up to 20-25 residues; or smaller extensions that facilitate purification by changing the net charge or another function, such as a polyhistidine sequence, an antigenic epitope, or a binding domain.

[0032] Examples of conservative substitutions are within the scope of the following groups: basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Alternatively, amino acid changes are essentially changes in the physicochemical properties of the polypeptide. For example, amino acid changes can improve the thermal stability of the polypeptide, change substrate specificity, change pH optimum, etc.

[0033] 2. Preparation of Mutants These variants can be prepared using any mutagenesis procedure known in the art, such as random mutagenesis, site-directed mutagenesis, synthetic gene construction, semisynthetic gene construction, and the like.

[0034] 3. Polynucleotides The present invention also relates to an isolated polynucleotide encoding the mutant of the present invention. The polynucleotide molecule is specifically a gene sequence encoding the mutant protein.

[0035] 4. Nucleic acid constructs The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a mutant of the present invention linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0036] The polynucleotide can be manipulated in a variety of ways to provide expression of a variant. This depends on the expression vector and the control sequences that control expression.

[0037] The control sequence can be a promoter, i.e., a polynucleotide recognized by a host cell for expressing the polynucleotide. The promoter can be any polynucleotide that exhibits transcriptional activity in the host cell, including mutants, truncated and hybrid promoters, and can be obtained from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the host cell.

[0038] 5. Expression vector The present invention also relates to a recombinant cloning vector and a recombinant expression vector comprising a polynucleotide encoding a variant of the present invention. The recombinant cloning vector comprises any polynucleotide encoding a variant of the present invention. The recombinant expression vector may also comprise the 3' non-translated region of the exogenous gene, i.e., a polyadenylation signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylation signal may guide the addition of polyadenylation to the 3' end of the mRNA precursor. When the gene is used to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter may be added before the transcription start nucleotide thereof, and they may be used alone or in combination with other promoters; in addition, when the gene of the present invention is used to construct a recombinant expression vector, an enhancer may also be used, including a translation enhancer or a transcription enhancer, and these enhancer regions may be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and may be natural or synthetic. The translation start region may be from a transcription start region or a structural gene.

[0039] The recombinant expression vector can be any vector (e.g., plasmid or virus) that undergoes a recombinant DNA program and can cause polynucleotide expression. The selection of the vector will depend on the compatibility of the vector with the host cell to be introduced into the vector. The vector can be a linear or closed circular plasmid. It can also be a self-replicating vector, that is, a vector that exists as an extrachromosomal entity. The replication of the vector is independent of chromosome replication, such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector can include any element for ensuring self-replication. Alternatively, the vector can be a vector that, when introduced into the host cell, is integrated into the genome and replicated with one or more chromosomes into which it has been integrated. In addition, a single vector or plasmid, or two or more vectors or plasmids (these vectors or plasmids together contain the total DNA to be introduced into the genome of the host cell), or a transposon can be used. The vector preferably includes one or more selectable markers that allow easy selection of transformed cells, transfected cells, transduced cells, or similar cells. A selectable marker is a gene whose product confers biocide or viral resistance, heavy metal resistance, auxotrophy, and the like.

[0040] 6. Recombinant host cells The present invention also relates to recombinant host cells, which comprise a polynucleotide encoding a mutant of the present invention, operably connected to one or more control sequences, which instruct the production of a mutant of the present invention. The construct or vector comprising the polynucleotide is introduced into the host cell so that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicated extrachromosomal vector. The host cell can be any cell useful in the recombinant production of a mutant, such as a prokaryotic cell or a eukaryotic cell.

[0041] 7. Methods for generating mutants The present invention also relates to methods for producing a mutant of penicillin G expandase, which methods comprise: (a) culturing a recombinant host cell of the present invention under conditions suitable for the expression of the mutant; and (b) recovering the mutant.

[0042] Use methods known in the art to cultivate these host cells in a kind of nutrient medium that is suitable for producing this mutant.For example, can be by shaking bottle culture, or in a kind of suitable substratum and under the condition that allows this mutant to express and / or separate, carry out small-scale or large-scale fermentation (comprising continuous fermentation, batch fermentation, batch-fed fermentation or solid-state fermentation) to cultivate this cell in laboratory or industrial fermentor tank.This substratum comprises carbon source and nitrogen source and inorganic salt.Suitable substratum can be obtained from commercial supplier, or can be prepared according to disclosed composition (for example, in the catalogue of American Type Culture Collection).If this mutant is secreted in this nutrient medium, then this mutant can directly reclaim from this substratum.If this mutant is not secreted, then it can reclaim from cell lysate.

[0043] The mutants can be detected using methods known in the art that are specific for these mutants. These detection methods include, but are not limited to, the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of the mutant.

[0044] The mutant can be recovered using methods known in the art. For example, the mutant can be recovered from the nutrient medium by a variety of conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0045] The mutant may be purified by a variety of procedures known in the art to obtain a substantially pure mutant, including, but not limited to, chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatofocusing, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubilization (e.g., hydrogen sulfate precipitation), SDS-PAGE, or extraction.

[0046] In an alternative aspect, the mutant is not recovered, but rather a host cell of the invention expressing the mutant is used as a source of the mutant.

[0047] 8. Application of mutants The present invention also relates to a method for producing 7-ADCA by enzymatic method using a penicillin G expandase mutant. The method comprises: using penicillin G as a raw material, adding a penicillin G expandase mutant and a culture or fermentation liquid of a recombinant host cell into a reaction system, and reacting for 1.5-2 hours to synthesize 7-ADCA (phenylacetyl-7-amino-3-deacetoxycephalosporanic acid).

[0048] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0049] The whole gene synthesis, primer synthesis and sequencing in the examples were all completed by Suzhou Genewise Biotechnology Co., Ltd.

[0050] The molecular biology experiments in the examples include plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., and are mainly carried out with reference to Molecular Cloning Experiment Guide (3rd edition), edited by J. Sambrook and Dw Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002). If necessary, the specific experimental conditions can be determined by simple experiments.

[0051] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0052] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (LB solid medium plus 20 g / L agar powder).

[0053] Kanamycin (Kan, 100 mg / L) was used as required according to the antibiotic gene carried by the plasmid.

[0054] Protein purification reagents: 1M PB solution: Take 174.0 g of potassium dihydrogen phosphate and dilute it to 1 L of ultrapure water (the pH value of potassium dihydrogen phosphate is adjusted to 7.1); 4M sodium chloride solution: Take 117.0 g of sodium chloride and dilute it to 0.5 L of ultrapure water; 4M imidazole solution: Take 136.0 g imidazole and dilute it to 0.5 L ultrapure water; Balance solution: Dissolve 50 g glycerol, 13 mL sodium chloride mother solution, and 10 mL 1M PB solution in 100 mL water, then add ultrapure water to make up to 500 mL; Impurity removal solution: Dissolve 20 g glycerol, 5 mL 4M sodium chloride solution, 4 mL 1M PB solution, and 1.25 mL 4M imidazole solution in 100 mL ultrapure water, then add ultrapure water to make up to 200 mL (adjust pH to 7.1 with hydrochloric acid); Coomassie Brilliant Blue colorimetric solution: weigh 100 mg of Coomassie Brilliant Blue G-250, dissolve it in 50 mL of 90% ethanol, add 100 mL of 85% phosphoric acid, and add ultrapure water to make up to 1000 mL; Eluent: Dissolve 20 g glycerol, 5 mL 4M sodium chloride solution, 4 mL 1M PB solution, and 12.5 mL 4M imidazole solution in 100 mL ultrapure water, then add ultrapure water to make up to 200 mL (adjust pH to 7.1 with hydrochloric acid); Desalting equilibrium solution: Take 10 mL of 1M PB solution and dilute to 500 mL with ultrapure water.

[0055] The technical solution of the present invention is further described below in conjunction with Examples 1-5 and the accompanying drawings.

[0056] Example 1 Construction of an engineered bacterium expressing an expandase mutant Based on the amino acid sequence WT-scDAOCS (SEQ ID NO.19) of the wild-type penicillin G expandase from Streptomyces clavuligerus (GenBank accession number 1W28_A), the codon was optimized according to the codon preference of Escherichia coli (SEQ ID NO.20), and Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize and cloned into the NdeI and XhoI sites of plasmid pET30a to obtain plasmid pET30a-ScDAOCS. The plasmid schematic diagram is shown in the figure. Figure 1 As shown. Electroporation (BIO-RAD Gene Pulser) or Ca 2+ The recombinant plasmid was transformed into the expression host Escherichia coli BL21 (DE3) by RNA-mediated chemical transformation to obtain Ec-WT-scDAOCS.

[0057] Example 2 Purification of expandase mutants 1. Fermentation of expandase strains and cell disruption The engineered E. coli strain was spread on an LB plate for activation. A single colony was picked from the activated LB plate and transferred to 4 ml LB liquid medium containing 100 mg / L kanamycin, and cultured overnight at 37 °C and 220 rpm; then, the colony was transferred to 1 L LB medium containing 100 mg / L kanamycin at a 1 v / v% inoculation amount, and cultured at 37 °C until OD600 reached 0.6-0.8, and a final concentration of 0.2 mM IPTG was added to induce protein expression, and the culture was induced at 25 °C for 16 h to obtain recombinant bacteria expressing expandase.

[0058] The cells were collected by centrifugation at 4 °C and 12,000 rpm for 10 min, and washed once with 0.1 M potassium phosphate buffer (pH 8.0). The cells were resuspended with 30 mL 0.1 M potassium dihydrogen phosphate buffer (pH 8.0), and then crushed with an ultrasonic cell crusher (Ningbo Xinzhi JY92-IIN) for 20 minutes, and then centrifuged at 4 °C and 12,000 rpm for 30 min, and the supernatant was taken to obtain the crude expandase enzyme solution.

[0059] 2. Purification of Expandase Mutants Protein purification of the penicillin G expandase mutants included the following steps. All protein purification steps were performed at 4 °C: (1) Resuspend the cells in the equilibration solution at a concentration of 15 w / v%, perform ultrasonic disruption (5 seconds on, 5 seconds off, for a total of 30 minutes), centrifuge for 30 minutes, and collect the supernatant after disruption; (2) Mix with 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and incubate at 4 °C on a gentle rotator for 30 min. Then load it onto an empty column for protein purification; (3) Use 4 column volumes of impurity removal solution to pass through the column to remove impurities. When the Coomassie brilliant blue of the impurity removal solution turns light blue, add the eluent; (4) Elute with 3 column volumes of eluent until Coomassie Brilliant Blue turns light blue; (5) Elute the target protein bound to the Ni-NTA resin with 10 mL of elution buffer. Concentrate the eluate at 5,000 g for 30–60 min using an AmiconUltra centrifugal filter (Merck KGaA, Darmstadt, Germany). (6) The protein solution was loaded onto a pre-equilibrated PD-10 column (GE Healthcare, Buckinghamshire, UK) and buffer exchanged with 5 mL of desalting buffer. Finally, the desalted protein fractions were aliquoted, snap-frozen in liquid nitrogen, and stored at -80 °C. The protein concentration was determined by the Bradford method using BSA as the standard.

[0060] Example 3 Expandase mutant catalytic reaction 1. Reaction system of penicillin G to G-7-ADCA catalyzed by expandase mutant Reaction solution formula: 20 mM pH 7.4 phosphate buffer, 10 mg / L FeSO4, 0.1 mM ascorbic acid, 10 mM α-ketoglutaric acid, 10 mM penicillin G.

[0061] Reaction: Add 170 μL of reaction solution to 30 μL of pure enzyme, mix well, place on a shaker at 25°C at 220 rpm, and react for 2 h. After the reaction, add 200 μL of methanol to quench the reaction, followed by HPLC analysis.

[0062] 2. Product test results Detection of the amount of G-7-ADCA produced: After 2 h of reaction, centrifuge at 12,000 rpm for 1 min and take the supernatant for HPLC detection.

[0063] Liquid chromatography detection conditions are as follows: chromatographic column: Agilent Z0RBAXSB - C18 StableBond Analytical 4.6x250mm; mobile phase: 20 mM pH 3.0; sodium phosphate buffer: methanol = 55:45. Flow rate: 1 mL / min, detection wavelength 215 nm.

[0064] Example 4 Expandase mutants generated based on error-prone PCR technology 1. Construction of random mutation point library by error-prone PCR The wild-type expandase expression plasmid pET30a-scDAOCS was used as a template to construct a random mutant library using error-prone PCR technology. The following primer pair scDAOCS-F / scDAOCS-R was designed, forward primer scDAOCS-F: ATGGATACCACCGTTCCGAC, reverse primer scDAOCS-R: TTAGGCTTTGGTTTTGGTGCG.

[0065] Plasmid pET30a-scDAOCS was used as a template for PCR amplification to obtain a mutant DNA sequence of about 0.95 kb. The 50 μL error-prone PCR reaction system included: 10 ng plasmid (pET30a-scDAOCS) template, 50 pmol of a pair of primers scDAOCS-F and scDAOCS-R, 1× Taq buffer, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mMdTTP, 7 mM MgCl2, (0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM) MnCl2, and 2.5 units of Taq enzyme (Takara). The PCR reaction conditions are shown in Table 1.

[0066] Table 1 Error-prone PCR reaction conditions .

[0067] The PCR product was verified by electrophoresis and then recovered by gel excision (Axygen DNA gel recovery kit AP-GX-50). Plasmid pET30a-scDAOCS was used as a template, the recovered product of about 0.95 kb (random mutation fragment) was used as a large primer, and KOD-plus DNA polymerase was used as a MegaPrimer. The reaction procedure is shown in Table 2.

[0068] Table 2 Reaction procedure .

[0069] The plasmid template was then digested with restriction endonuclease DpnI (Thermo) and electroporated into E. coli BL21 (DE3) to obtain a random mutation library of more than 500 clones.

[0070] 2. 96-well plate culture of random mutation library clones Single colonies were picked from the LB plates of each clone and placed in a 96-well plate (each well contained 500 μL of liquid LB-Kan medium). The control strain was pET30a empty load. After culturing at 37 °C and 400 rpm for 12 h, 5% of the overnight culture was transferred to a new 96-well deep-well plate. The remaining bacterial liquid was added with an equal volume of 30% glycerol and stored in a -80 °C refrigerator. 500 μL of LB medium containing kanamycin was added to the 96-well plate and cultured at 37 °C and 400 rpm for 4 h. IPTG was then added at a final concentration of 0.2 mmol / L and cultured at 20 °C and 400 rpm for 20 h. 3, centrifuge at 700 g for 10 min, collect the cells, resuspend the cells in 200 μL potassium phosphate buffer (50 mmol / L, pH 7.4, containing 100 mg / L lysozyme, 300 U / mL DNaseI and 10% Triton X-100), centrifuge and collect the supernatant. Purify the expandase according to the expandase purification method and quantify the protein concentration.

[0071] Example 5 Conversion rate test of expandase mutants 1. Determination of G-7-ADCA synthesis activity of mutants 170 μL of substrate solution (reaction solution formula: 20 mM pH 7.4 phosphate buffer, 10 mg / L FeSO4, 0.1 mM ascorbic acid, 10 mM α-ketoglutaric acid, 10 mM penicillin G) was added to 30 μL of enzyme solution, and 200 μL of methanol was added to quench the reaction after 2 h of reaction. The sample was then filtered and analyzed by HPLC, and quantified by comparison with the quantitative curve of the standard substance.

[0072] 2. Conversion rate data results of catalytic penicillin G conversion The present invention tested the enzymatic activity of 480 expandase mutants and found that 15 of them had significantly improved enzymatic activity, named ScDAOCS-1-ScDAOCS-15. These 15 strains were entrusted to Suzhou Genewiz Company for nucleic acid sequencing, mainly single mutation sites. Table 3 shows the conversion efficiency of these single mutants.

[0073] Table 3 Conversion rates of single mutant expandase mutants generated using error-prone PCR .

[0074] A total of 8 mutation sites with significantly improved catalytic activity were obtained, namely R27M, L50V, M73T, R139K, Y184H, Y217A, R249A and T292A. Among them, the site with the highest mutation efficiency is R27M. This mutation is further combined with the remaining 7 sites to construct all mutants containing 2-8 combined mutations. Protein expression purification and catalytic activity determination were performed, and it was found that the catalytic activity of all combined mutants was higher than that of the wild type and the mutants of the single mutation site. Only the 10 combined mutant strains with the highest enzyme activity are listed here, named ScDAOCS-16-ScDAOCS-25, and Table 4 shows the conversion efficiency of these mutants.

[0075] Table 4 Conversion rate of expandase mutant combinations strain Relative conversion rate (%) sequence Mutation location WT-scDAOCS 100 SEQ ID NO.19 none ScDAOCS-16 256.36 SEQ ID NO.9 R27M, L50V, M73T, R139K, Y184H, Y217A, R249A, T292A ScDAOCS-17 186.53 SEQ ID NO.10 R27M, M73T, Y184H, Y217A, T292A ScDAOCS-18 170.64 SEQ ID NO.11 R27M, M73T, Y184H, T292A ScDAOCS-19 167.35 SEQ ID NO.12 R27M, L50V, Y184H, Y217A, T292A ScDAOCS-20 230.50 SEQ ID No.13 R27M, L50V, M73T, Y184H, Y217A, R249A, T292A ScDAOCS-21 179.38 SEQ ID NO.14 R27M, M73T, R139K, Y184H, Y217A, T292A ScDAOCS-22 198.34 SEQ ID NO.15 R27M, L50V, R139K, Y184H, Y217A, T292A ScDAOCS-23 220.96 SEQ ID NO.16 R27M, L50V, M73T, R139K, Y184H, Y217A, R249A ScDAOCS-24 185.33 SEQ ID NO.17 R27M, L50V, Y184H, Y217A, R249A ScDAOCS-25 208.63 SEQ ID NO.18 R27M, L50V, M73T, R139K, Y184H, Y217A, T292A .

Claims

1. A penicillin G expandase mutant, characterized in that: The mutant is a mutant having an R27M point mutation in the amino acid sequence shown in SEQ ID NO.19 in the sequence listing.

2. The penicillin G expandase mutant according to claim 1, characterized in that: The mutant further comprises point mutations at one or more of the following positions: L50V, M73T, R139K, Y184H, Y217A, R249A and T292A.

3. A polynucleotide encoding the mutant according to claim 1 or 2.

4. An expression vector comprising the polynucleotide of claim 3, characterized in that: The expression vector is used to encode and produce one or more mutants as claimed in claim 1 or 2 in an expression host. A recombinant host cell comprising the expression vector of claim 4.

6. Use of the mutant according to claim 1 or 2, characterized in that: The mutant is used to synthesize phenylacetyl-7-amino-3-deacetoxycephalosporanic acid using penicillin G as raw material.

7. A penicillin G ring expansion composition, characterized in that: The composition comprises the mutant according to claim 1 or 2, the expression vector according to claim 4 or the recombinant host cell according to claim 5.

8. A method for preparing the mutant according to claim 1 or 2, characterized in that: The mutant is recovered after culturing the recombinant host cell according to claim 5.

9. A method for synthesizing phenylacetyl-7-amino-3-deacetoxycephalosporanic acid, characterized in that: The method uses penicillin G as a raw material, adds the mutant described in claim 1 or 2, or the culture or fermentation liquid of the recombinant host cell described in claim 5 into the reaction system, and reacts for 1.5-2 hours.

Images