Primer composition for amplifying coding sequence of heavy chain CDR3 of human B cell receptor and application of primer composition

Abstract

The invention is applicable to the technical field of biotechnology, and particularly relates to a primer composition for amplifying a coding sequence of a human B cell receptor heavy chain CDR3 and application of the primer composition, and two primer groups, namely a first primer group and a second primer group, are designed. The two primers are respectively used as an upstream primer and a downstream primer, and comprise at least one human IGH CDR3 upstream primer and at least one human IGH CDR3 downstream primer. The primers can be respectively combined with nucleic acid of human B cells, and a basis for researching a CDR3 region of a B cell receptor is provided. The first primer group and the second primer group are combined with the nucleic acid of the human B cell, so that the coding sequence of the heavy chain of the human B cell receptor is effectively enriched, part of pseudogenes are contained, the amplification efficiency of the heavy chain CDR3 library of the human B cell receptor can be improved, and the deep research on immune response of the human B cell is promoted.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology, and in particular relates to a primer composition for amplifying a human B cell receptor heavy chain CDR3 coding sequence and its use. Background Art

[0002] Human B cells play a key role in the immune system and are essential for protecting the body from infection and maintaining immune balance. A deeper understanding of human B cells helps us understand the function of the immune system and provide new insights into the prevention and treatment of diseases.

[0003] Changes in gene sequences are of great significance in human B cell immune responses. Currently, the amplification efficiency of the human B cell receptor heavy chain CDR3 library is low, and in-depth research on human B cell immune responses remains a complex and challenging problem. Summary of the invention

[0004] The embodiments of the present application provide a primer composition for amplifying the human B cell receptor heavy chain CDR3 coding sequence and its use, which can effectively enrich the human B cell receptor heavy chain coding sequence and contain some pseudogenes, which can improve the amplification efficiency of the human B cell receptor heavy chain CDR3 library and promote the in-depth research of human B cell immune response.

[0005] In a first aspect, the present invention provides a primer composition for amplifying a human B cell receptor heavy chain CDR3 coding sequence, comprising:

[0006] A first primer set and a second primer set; wherein the first primer set is an upstream primer set, including at least one human IGH CDR3 upstream primer; the second primer set is a downstream primer set, including at least one human IGH CDR3 downstream primer;

[0007] The first primer set and the second primer set can bind to nucleic acid of human B cells respectively.

[0008] The above technical solutions in the embodiments of the present application have at least the following technical effects:

[0009] The primer composition for amplifying the human B cell receptor heavy chain CDR3 coding sequence provided in the embodiment of the present application is designed by designing two primer sets, namely the first primer set and the second primer set. The two primers are respectively used as upstream primers and downstream primers, including at least one human IGH CDR3 upstream primer and at least one human IGH CDR3 downstream primer. These primers can be combined with the nucleic acid of human B cells respectively, providing a basis for studying the B cell receptor CDR3 region. Based on the combination of the first primer set and the second primer set with the nucleic acid of human B cells, the human B cell receptor heavy chain coding sequence is effectively enriched, and some pseudogenes are included, which can improve the amplification efficiency of the human B cell receptor heavy chain CDR3 library and promote the in-depth study of human B cell immune response.

[0010] In a possible implementation of the first aspect, the first primer set consists of 7 primers covering functional gene fragments and pseudogene fragments of human IGHV;

[0011] The second primer set consists of 9 primers covering human IGHJ functional gene fragments and pseudogene fragments.

[0012] In a possible implementation of the first aspect, the gene sequences of the seven primers in the first primer set covering the functional gene fragments and pseudogene fragments of human IGHV are shown in SEQ ID NOs: 1-7, respectively;

[0013] The gene sequences of the 9 primers in the second primer set covering human IGHJ functional gene fragments and pseudogene fragments are shown in SEQ ID NOs: 8-16, respectively.

[0014] In a second aspect, the present application provides a method for constructing a CDR3 repertoire based on multiplex PCR amplification, comprising:

[0015] Obtaining mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences isolated from human peripheral blood;

[0016] Extracting and obtaining genomic nucleic acid based on mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequence separated from the human peripheral blood;

[0017] Combining the genomic nucleic acid with the primer combination described in the first aspect to perform multiplex PCR amplification to obtain an amplification product of the human B cell receptor heavy chain CDR3 coding sequence;

[0018] The amplified products of the human B cell receptor heavy chain CDR3 coding sequence were analyzed to complete the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire.

[0019] In a possible implementation of the second aspect, obtaining mononuclear cells containing a human B cell receptor heavy chain CDR3 coding sequence separated from human peripheral blood comprises:

[0020] Human peripheral blood was collected and diluted with PBS in equal proportions;

[0021] Mixing the blood diluted with PBS in equal proportion with the human lymphocyte separation solution, and centrifuging to obtain a first centrifuge solution;

[0022] Aspirate PBMCs from the first centrifuge solution, add PBS, mix well, and continue centrifugation to obtain a second centrifuge solution;

[0023] The bottom cells in the second centrifugation solution were blown up with a pipette, and mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence were washed and collected.

[0024] The method of extracting genomic nucleic acid from mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequence separated from human peripheral blood comprises:

[0025] adding the obtained mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence to a mixture of proteinase K and Buffer AL, incubating and adding ethanol to obtain a first mixture;

[0026] Use a DNA Mini column to absorb the first mixed solution, add Buffer AW1 and centrifuge to obtain the first DNA Mini column;

[0027] Mix the first DNA Mini column and Buffer AW2 and centrifuge to obtain a second DNA Mini column;

[0028] Repeat the elution of the second DNA Mini column with Buffer AE to obtain genomic nucleic acid.

[0029] In a possible implementation of the second aspect, extracting genomic nucleic acid from mononuclear cells containing a human B cell receptor heavy chain CDR3 coding sequence separated from human peripheral blood comprises:

[0030] adding the obtained mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence to a mixture of proteinase K and Buffer AL, incubating and adding ethanol to obtain a first mixture;

[0031] Use a DNA Mini column to absorb the first mixed solution, add Buffer AW1 and centrifuge to obtain the first DNA Mini column;

[0032] Mix the first DNA Mini column and Buffer AW2 and centrifuge to obtain a second DNA Mini column;

[0033] Repeat the elution of the second DNA Mini column with Buffer AE to obtain genomic nucleic acid.

[0034] In a possible implementation of the second aspect, in the step of combining the genomic nucleic acid with the primer composition as described in the first aspect to perform multiplex PCR amplification to obtain an amplification product of a human B cell receptor heavy chain CDR3 coding sequence, the reaction system of the multiplex PCR amplification comprises: 25 μl of PCR premix, 0.2 μl*7 of the first primer set, 0.15 μl*9 of the second primer set, 1 μg of the genomic nucleic acid, and ddH2O supplemented to a total of 50 μl of the reaction system;

[0035] In the step of combining the genomic nucleic acid with the primer composition as described in the first aspect to perform multiplex PCR amplification to obtain an amplified product of the human B cell receptor heavy chain CDR3 coding sequence, the reaction procedure of the multiplex PCR amplification comprises:

[0036] Pre-denaturation at 94°C for 3 min;

[0037] Denaturation at 94°C for 1 min, annealing at 56°C for 3 min, and extension at 72°C for 1 min were performed for 40 cycles;

[0038] The final extension was carried out at 72°C for 10 min.

[0039] In a possible implementation of the second aspect, the amplified product of the human B cell receptor heavy chain CDR3 coding sequence obtained by analyzing the obtained amplified product to complete the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire comprises:

[0040] Prepare a 2% agarose gel and add Gold View Type I nucleotide stain to obtain a first gel;

[0041] The first gel was allowed to stand for 30 minutes, and after the first gel solidified, it was placed in an electrophoresis tank, and electrophoresis buffer was added;

[0042] Add the products of the multiplex PCR amplification to the sample wells of the first gel using a micropipette, and perform electrophoresis using an electrophoresis instrument;

[0043] When bromophenol blue moved to 1 cm from the front of the gel, electrophoresis was stopped;

[0044] The gel was taken out and placed in a gel imaging analyzer to obtain PCR product bands, and the first gel image was saved.

[0045] The amplified product of the human B cell receptor heavy chain CDR3 coding sequence obtained by the analysis completes the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire, and also includes:

[0046] Based on the first gel image, extract the target PCR band between 200-300 bp;

[0047] Weigh the target PCR band, add 3 times the volume of Buffer QG to incubate and dissolve;

[0048] Add an equal volume of isopropanol, mix well, and transfer to the adsorption column;

[0049] Add Buffer PE to the adsorption column to elute the target substance;

[0050] Prepare agarose gel, mix loading dye and purified DNA, and perform electrophoresis;

[0051] After electrophoresis, the gel is taken out to obtain the purified DNA product band and save the second gel image;

[0052] Based on the purified DNA product bands, a CDR3 repertoire was constructed.

[0053] In a third aspect, the present application provides a method for determining sequence information of a human B cell receptor heavy chain CDR3 coding sequence, comprising:

[0054] Based on the method described in any one of the second aspects above, obtaining a CDR3 repertoire;

[0055] Based on the CDR3 repertoire, sequencing of the human B cell receptor heavy chain CDR3 coding sequence is performed;

[0056] Based on the results of sequencing the human B cell receptor heavy chain CDR3 coding sequence, the sequence information of the human B cell receptor heavy chain CDR3 coding sequence is confirmed.

[0057] In a fourth aspect, the present application provides an antigen site prediction method based on a B cell receptor heavy chain CDR3 coding sequence, comprising:

[0058] Based on the method for determining the sequence information of the human B cell receptor heavy chain CDR3 coding sequence described in the third aspect above, the sequence information of the human B cell receptor heavy chain CDR3 coding sequence is obtained, wherein the sequence information of the CDR3 coding sequence has a first antigen key point set;

[0059] Acquire an antigen structure simulation model of a standard antigen, wherein the antigen structure simulation model includes a second antigen key point set of the standard antigen;

[0060] Acquire a first antigen key point set, and match the first antigen key point set with a second antigen key point set of a standard antigen to obtain a successful matching result;

[0061] Calculating the affinity simulation value of the second antigen key point set and the first antigen key point set;

[0062] According to the affinity simulation value, the antigen site prediction result is obtained.

[0063] In a fifth aspect, an embodiment of the present application provides a kit for detecting the coding sequence of human B cell receptor heavy chain CDR3.

[0064] It can be understood that the beneficial effects of the second to fifth aspects mentioned above can be found in the relevant descriptions in the specification and will not be repeated here. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0066] Figure 1 It is a schematic diagram of a process for constructing a CDR3 repertoire based on multiplex PCR amplification provided in one embodiment of the present application;

[0067] Figure 2 is a schematic flow chart of step S100 in the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in one embodiment of the present application;

[0068] Figure 3 is a flow chart of step S200 in the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in one embodiment of the present application;

[0069] Figure 4 is a flow chart of step S400 in the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in one embodiment of the present application;

[0070] Figure 5 The first gel image and the second gel image in step S400 of the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in one embodiment of the present application;

[0071] Figure 6 Another flow chart of step S400 in the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in one embodiment of the present application

[0072] Figure 7 It is a result schematic diagram of the VJ gene segment pairing distribution and abundance in the method for determining the sequence information of the human B cell receptor heavy chain CDR3 coding sequence provided in one embodiment of the present application;

[0073] Figure 8 It is a schematic diagram of a flow chart of a method for predicting antigenic sites based on a B cell receptor heavy chain CDR3 coding sequence provided in an embodiment of the present application;

[0074] Fig. 9 This is a flow chart of step S20 in the method for predicting antigenic sites based on the B cell receptor heavy chain CDR3 coding sequence provided in one embodiment of the present application;

[0075] Fig.10 This is a flow chart of step S30 in the method for predicting antigenic sites based on the B cell receptor heavy chain CDR3 coding sequence provided in one embodiment of the present application;

[0076] Fig.11 This is another flow chart of step S30 in the method for predicting antigenic sites based on the B cell receptor heavy chain CDR3 coding sequence provided in one embodiment of the present application;

[0077] Fig.12 This is a schematic diagram of the results of an antigen site prediction device based on the B cell receptor heavy chain CDR3 coding sequence provided in one embodiment of the present application. DETAILED DESCRIPTION

[0078] In the following description, specific details such as specific system structures, technologies, etc. are provided for the purpose of illustration rather than limitation, so as to provide a thorough understanding of the embodiments of the present application. However, it should be clear to those skilled in the art that the present application may also be implemented in other embodiments without these specific details. In other cases, detailed descriptions of well-known systems, devices, circuits, and methods are omitted to prevent unnecessary details from obstructing the description of the present application.

[0079] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0080] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0081] As used in the specification and appended claims of this application, the term "if" can be interpreted as "when" or "uponce" or "in response to determining" or "in response to detecting", depending on the context. Similarly, the phrase "if it is determined" or "if [described condition or event] is detected" can be interpreted as meaning "uponce it is determined" or "in response to determining" or "uponce [described condition or event] is detected" or "in response to detecting [described condition or event]", depending on the context.

[0082] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0083] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0084] Changes in gene sequences are of great significance in human B cell immune responses. Currently, the amplification efficiency of the human B cell receptor heavy chain CDR3 library is low, and in-depth research on human B cell immune responses remains a complex and challenging problem.

[0085] To solve the above problems, the embodiments of the present application provide a primer composition for amplifying the human B cell receptor heavy chain CDR3 coding sequence and its use.

[0086] In a first aspect, an embodiment of the present application provides a primer composition for amplifying a human B cell receptor heavy chain CDR3 coding sequence, comprising a first primer set and a second primer set; wherein the first primer set is an upstream primer set, comprising at least one human IGH CDR3 upstream primer; the second primer set is a downstream primer set, comprising at least one human IGH CDR3 downstream primer; the first primer set and the second primer set can respectively bind to the nucleic acid of human B cells.

[0087] By designing two primer sets, namely the first primer set and the second primer set. The two primers are respectively used as upstream primers (i.e., positive chain primers) and downstream primers (i.e., antisense chain primers), respectively, and include at least one human IGH CDR3 upstream primer and at least one human IGH CDR3 downstream primer. These primers can be combined with the nucleic acid of human B cells, respectively, providing a basis for studying the CDR3 region of the B cell receptor. Based on the combination of the first primer set and the second primer set with the nucleic acid of human B cells, the human B cell receptor heavy chain coding sequence is effectively enriched, and some pseudogenes are included, which can improve the amplification efficiency of the human B cell receptor heavy chain CDR3 library and promote the in-depth study of human B cell immune response.

[0088] In a possible implementation, the first primer set consists of 7 primers covering human IGHV functional gene fragments and pseudogene fragments; the second primer set consists of 9 primers covering human IGHJ functional gene fragments and pseudogene fragments.

[0089] The first primer set consists of 7 primers covering human IGHV functional gene fragments and pseudogene fragments, which are designed to amplify IGHV gene fragments (including functional and pseudogene fragments), thereby ensuring that the maximum diversity of IGHV gene fragments is captured during the amplification process. The second primer set consists of 9 primers covering human IGHJ functional gene fragments and pseudogene fragments, which are designed to amplify IGHJ gene fragments (including functional and pseudogene fragments), thereby ensuring that the maximum diversity of IGHJ gene fragments is captured during the amplification process. In this way, the coverage and diversity of CDR3 sequences can be maximized, thereby improving the accuracy and comprehensiveness of sequencing and analysis of B cell receptor heavy chain CDR3 coding sequences.

[0090] In one possible implementation, the gene sequences of the 7 primers covering the functional gene fragments and pseudogene fragments of human IGHV in the first primer set are respectively shown as SEQ ID NOs: 1-7; the gene sequences of the 9 primers covering the functional gene fragments and pseudogene fragments of human IGHJ in the second primer set are respectively shown as SEQ ID NOs: 8-16.

[0091] Tab.1 IGHV gene sequences primers of human IGH CDR3 (5'-3')

[0092] Primer number Primer sequence (SEQ ID NO:) IGHV1 GCACAGCCTACATGGAGCTGAG(1) IGHV2 CACCATCTCCAAGGACACCTCC(2) IGHV3 GXTTCACCATCTCCAGAGA(3) IGHV4 CCTGAAGCTGAGCTCTGTGAC(4) IGHV5 TGCAGTGGAGCAGCCTGAAGG(5) IGHV6 CCCTGCAGCTGAACTCTGTGAC(6) IGHV7 GTATGCCCAGGGCTTCACAGG(7)

[0093] Tab.2 IGHJ gene sequences primers of human IGH CDR3 (5'-3')

[0094] Primer number Primer sequence (SEQ ID NO:) IGHJ1*01 TGAGGAGACGGTGACCAGGGT(8) IGHJ1P*01 TCTCAGGGCGGGTCGGGTTCA(9) IGHJ2*01 AGGGTGCCACGGCCCCAGAGA(10) IGHJ2P*01 TGACGTTCCCAGGGAGACGGT(11) IGHJ3*01&*02 AAGAGACGGTGACCATTGTCC(12) IGHJ3P*01&*02 ACCCCTCAGAAGCCAGACCAC(13) IGHJ4*01&*02&*03 CCTTGGCCCCAGTAGTCAAAGT(14) IGHJ5*01&*02 TTGGCCCCAGGAGTCGAACCAGT(15) IGHJ6*01&*02&*03&*04 GAGACGGTGACCGTGGTCCCTT(16)

[0095] In the second aspect, the present application embodiment provides a method for constructing a CDR3 library based on multiple PCR amplification. In this method, mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences separated from human peripheral blood are obtained as the starting point of the whole process, providing raw materials for subsequent experimental steps. Based on mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences separated from human peripheral blood, genomic nucleic acids are extracted to obtain PCR amplification in the next step. The genomic nucleic acid is combined with a primer composition for multiple PCR amplification to obtain an amplified product of the human B cell receptor heavy chain CDR3 coding sequence, amplify the target CDR3 coding sequence, effectively enrich the human B cell receptor heavy chain coding sequence, and promote the in-depth study of human B cell immune response. Finally, the amplified product of the obtained human B cell receptor heavy chain CDR3 coding sequence is analyzed, the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 library are completed, the CDR3 nucleic acid sequence can be identified, and the CDR3 library is constructed at the same time, which provides important data for immune response research.

[0096] In order to better understand the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in the embodiments of the present application, the specific implementation process of the method for constructing a CDR3 repertoire based on multiplex PCR amplification provided in the embodiments of the present application is exemplarily introduced below.

[0097] Figure 1 A schematic flow chart of a method for constructing a CDR3 library based on multiplex PCR amplification provided in an embodiment of the present application is shown. The method for constructing a CDR3 library based on multiplex PCR amplification includes:

[0098] S100, obtaining mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences isolated from human peripheral blood.

[0099] It is understandable that obtaining mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences isolated from human peripheral blood is to conduct a more in-depth study of the diversity and function of B cell receptors. The B cell receptor heavy chain CDR3 sequence is a key site for B cells to recognize and bind antigens, and its diversity directly affects the breadth and specificity of the immune response. By analyzing mononuclear cells, the receptor sequence information of each B cell can be obtained, thereby gaining a deeper understanding of the diversity of B cell receptors and the characteristics of the immune response. This is of great significance for studying the pathogenesis of immune diseases and developing new vaccines and immunotherapy strategies.

[0100] In one possible implementation, see Figure 2 , S100, obtaining mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences separated from human peripheral blood, comprising:

[0101] S110, human peripheral blood was collected and diluted with PBS in equal proportions.

[0102] As you can understand, PBS is the abbreviation of Phosphate Buffered Saline. It is a commonly used biological experiment buffer for diluting and washing cells, tissues and biomolecules. The formula of PBS usually includes ingredients such as phosphate, sodium chloride and potassium chloride to maintain the stability of biological samples in the ideal pH range.

[0103] For example, 10 ml of human peripheral blood can be collected and diluted with PBS in equal proportions using a 50 ml centrifuge tube.

[0104] S120, mixing the blood diluted with PBS in an equal proportion with the human lymphocyte separation solution, and centrifuging to obtain a first centrifuge solution.

[0105] For example, a 15 ml centrifuge tube can be taken, 5 ml of human lymphocyte separation solution can be added first, and then the centrifuge tube can be tilted 45 degrees and 4 ml of diluted blood can be slowly added, and the centrifuge speed can be set to 2000 rpm and centrifuged for 20 minutes. For better distinction, the obtained centrifuge solution is called the first centrifuge solution.

[0106] S130, aspirating PBMCs from the first centrifuge solution, adding PBS, mixing, and continuing centrifugation to obtain a second centrifuge solution.

[0107] It is understood that during the centrifugation process, the centrifugal force will precipitate the solid particles or sediment in the sample to the bottom of the centrifuge tube, and the supernatant will be located in the upper layer of the centrifuge tube.

[0108] For example, 1-2 ml of PBMCs (annular milky white lymphocyte layer) can be drawn into a 15 ml centrifuge tube, 3-4 times PBS can be added, mixed thoroughly, the centrifugal speed is set to 1500 rpm, centrifuged for 10 minutes, the supernatant is discarded, and 0.5 ml of the sample is retained. The obtained centrifuge fluid is called the second centrifuge fluid.

[0109] S140, using a pipette to blow up the bottom cells in the second centrifugation solution, washing and collecting the mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence.

[0110] Illustratively, the bottom cells can be blown up with a disposable pipette, and the cells at the bottom of the second centrifuge can be blown up with a disposable pipette and transferred to a 2 ml centrifuge tube. Then, the cells at the bottom of the centrifuge tube are washed with 1 ml of PBS, and the wash is transferred to the same 2 ml centrifuge tube. The centrifuge tube is placed in a centrifuge, the centrifugal force is set to 300 g, and centrifuged for 5 minutes. This will cause the cells to settle to the bottom of the centrifuge tube. After the centrifugation is completed, the supernatant is discarded, leaving the cell pellet at the bottom.

[0111] S200, based on the extraction of genomic nucleic acid from mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence isolated from human peripheral blood.

[0112] It is understood that genomic nucleic acids are extracted from mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences isolated from human peripheral blood for subsequent gene sequencing and analysis. Genomic nucleic acids contain all the genetic information of the cell, including the coding sequence of the B cell receptor. By sequencing these genomic nucleic acids, the B cell receptor heavy chain CDR3 coding sequence of each B cell can be obtained, and then the diversity of B cell receptors and the characteristics of immune responses can be further studied. This is a key step in studying B cell immune responses, disease mechanisms, and developing new vaccines and immunotherapy strategies.

[0113] In one possible implementation, see Figure 3 , S200, based on the mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence separated from human peripheral blood, extracting genomic nucleic acid, including:

[0114] S210, adding the obtained mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence to a mixture of proteinase K and Buffer AL, incubating and adding ethanol to obtain a first mixture.

[0115] As you can understand, Buffer AL is a commonly used reagent used in nucleic acid extraction and purification. It usually contains some buffer salts and surfactants to help lyse cell membranes, release nucleic acids, and protect nucleic acids from degradation during the extraction process.

[0116] Exemplarily, add 200 μl PBS (phosphate buffered saline) to a centrifuge tube containing nuclear cells and mix gently to suspend the cells in PBS. Add 20 μl proteinase K and mix gently to evenly disperse the proteinase K in the cell suspension. Add 200 μl Buffer AL (without ethanol) and mix gently to evenly mix Buffer AL in the cell suspension. Vortex mix and vortex mix for 30 seconds to ensure that the cells and reagents are fully mixed. Place the centrifuge tube in an incubator at 56 degrees Celsius and incubate for 10 minutes to promote cell lysis and release of nucleic acids. After the incubation is completed, add 200 μl of anhydrous ethanol and mix gently to evenly mix the ethanol in the cell and reagent mixture. Vortex mix again and vortex mix for 30 seconds to ensure that the cells and reagents are fully mixed.

[0117] S220, using a DNA Mini column to absorb the first mixed solution, adding Buffer AW1 and centrifuging to obtain a first DNA Mini column.

[0118] As you can understand, DNA Mini column is a commonly used DNA purification tool used to purify DNA from a mixture. It usually consists of a small column and a collection tube. Buffer AW1 is a reagent containing high concentrations of guanidinium hydrochloride and sodium chloride, which is mainly used to wash away non-specifically bound proteins on the silica membrane during DNA purification. The guanidinium chloride in Buffer AW1 is used to denature the proteins in the sample so that they can pass through the column during the purification process and be discarded with the washing solution.

[0119] For example, the DNA Mini column is placed in a 2 ml collection tube, the first mixed solution is sucked into the column, the centrifugal force is set to 6000 g, centrifuged for 1 min, and the waste liquid and the collection tube are discarded. The DNA Mini column is placed in a new 2 ml collection tube, 500 ul Buffer AW1 is added, the centrifugal force is set to 6000 g, 1 min, the waste liquid and the collection tube are discarded, and for better distinction, the obtained DNA Mini column is called the first DNA Mini column.

[0120] S230, the first DNA Mini column and Buffer AW2 are mixed and centrifuged to obtain a second DNA Mini column.

[0121] It can be understood that Buffer AW2 is a washing buffer used in the washing step of DNA purification. The ingredients of Buffer AW2 basically include Tris-HCl, water and ethanol. Its main function is to wash away the salt ions such as guanidine hydrochloride and sodium chloride remaining on the silica gel membrane to purify the DNA sample. DNase membrane is a specially designed filter membrane with a small pore size that can prevent DNA molecules from passing through but allow other solutions and substances to pass through. During the nucleic acid extraction or purification process, passing the solution containing the sample to be purified through the DNase membrane can effectively remove the exogenous DNA therein.

[0122] For example, the first DNA Mini column was placed in a new 2 ml collection tube, 500 ul of Buffer AW2 was added, the centrifugal force was set to 20000 g, and centrifuged for 3 min to dry the DNase membrane, and the waste liquid and collection tube were discarded. When moving the DNA Mini column, the waste liquid should not be touched. If it is touched, it should be centrifuged at the same speed for 1 min. To ensure that there is no ethanol residue, the DNA Mini column was opened for 1 min after centrifugation to allow the ethanol to fully evaporate, and the resulting DNA Mini column was called the second DNA Mini column.

[0123] S240, repeatedly use Buffer AE to elute the second DNA Mini column to obtain genomic nucleic acid.

[0124] It can be understood that Buffer AE is a commonly used buffer, which is usually used for elution and storage of DNA. Buffer AE is mainly used to elute purified DNA and dissolve it in a buffer for storage and subsequent experimental operations. The DNA solution in Buffer AE can be stored for a long time at -20 degrees Celsius or lower to maintain the stability of DNA. EP tube is a commonly used laboratory utensil, also known as centrifuge tube (Eppendorf tube).

[0125] Exemplarily, place the second DNA Mini column in a new 1.5 ml EP tube, add 90 ul Buffer AE to the DNase membrane, incubate at room temperature for 5 min, set the centrifugal force to 6000 g, centrifuge for 1 min to elute the DNA, repeat this step to increase the DNA yield, the final elution total volume should be less than 180 ul, and store the collected DNA at -20 °C.

[0126] S300, combining the genomic nucleic acid with the primer combination of any one of the above embodiments to perform multiplex PCR amplification to obtain an amplification product of the human B cell receptor heavy chain CDR3 coding sequence.

[0127] As you can understand, PCR (Polymerase Chain Reaction) is a technique widely used in laboratories to amplify specific DNA sequences. PCR uses DNA polymerase enzymes (such as Taq DNA polymerase) in the presence of template DNA, primers and nucleotides to amplify the target DNA sequence through multiple temperature cycles. The basic steps of PCR usually include the following three main stages:

[0128] Reaction system preparation: Mix together the components needed for the PCR reaction. This includes the DNA template (the starting material for the target DNA sequence to be amplified), primers (specific sequences used to selectively amplify both ends of the target sequence), and nucleotides (dNTPs, which serve as the building blocks for DNA synthesis).

[0129] PCR Cycles: A PCR cycle consists of a series of temperature changes and generally includes three phases: denaturation, annealing, and extension.

[0130] PCR result analysis: After the PCR reaction is completed, the amplified products can be analyzed by methods such as gel electrophoresis. Gel electrophoresis can separate and visualize the amplified products according to size to verify whether the target DNA sequence has been successfully amplified.

[0131] In a possible implementation, in step S300: combining the genomic nucleic acid with the primer combination of any of the above embodiments to perform multiplex PCR amplification to obtain the amplified product of the human B cell receptor heavy chain CDR3 coding sequence, the reaction system of the multiplex PCR amplification includes: 25 μl of PCR premix, 0.2 μl*7 of the first primer set, 0.15 μl*9 of the second primer set, 1 μg of genomic nucleic acid, and 50 μl of ddH2O.

[0132] As you can understand, ddH2O is a commonly used abbreviation in laboratories, which stands for deionized water. Deionized water is pure water made by removing ions and impurities from water, and is commonly used in experiments and preparation processes in laboratories.

[0133] For example, the centrifuge tube containing the solid primer can be centrifuged at 3500 rpm for 3 min. The solid primer is diluted to a solution with a concentration of 20 μmol / L. The DNA template, PCR premix, ddH2O, GAPDH primer, and upstream and downstream primers are thawed and placed on an ice box. They are gently vortexed and microcentrifuged before use. Samples are added according to the table below, with three tubes for each sample.

[0134]

[0135] In a possible implementation, in step S300: combining the genomic nucleic acid with the primer combination of any of the above embodiments to perform multiplex PCR amplification to obtain an amplified product of the human B cell receptor heavy chain CDR3 coding sequence, the multiplex PCR amplification reaction procedure includes:

[0136] Pre-denaturation at 94°C for 3 min;

[0137] Denaturation at 94°C for 1 min, annealing at 56°C for 3 min, and extension at 72°C for 1 min were performed for 40 cycles;

[0138] The final extension was carried out at 72°C for 10 min.

[0139] Exemplarily, the reaction program of multiplex PCR amplification, i.e., the PCR thermal cycle conditions are as follows:

[0140]

[0141] S400, analyzing the amplified product of the human B cell receptor heavy chain CDR3 coding sequence, completing the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire.

[0142] It can be understood that the analysis of the amplified products of the obtained human B cell receptor heavy chain CDR3 coding sequence is mainly to complete the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire. This process involves PCR amplification using specific primers, and then sequencing the amplified products to obtain the nucleic acid sequence of CDR3. This sequence information will be used to construct the CDR3 repertoire, which is a database containing a large number of different CDR3 sequences. By analyzing this repertoire, we can understand the diversity of B cell receptors and how different CDR3 sequences correspond to different antigen recognition. This is of great significance for studying immune responses, disease mechanisms, and developing new vaccines and immunotherapy strategies.

[0143] In one possible implementation, see Figure 4 , S400, analyzing the amplified product of the human B cell receptor heavy chain CDR3 coding sequence, completing the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire, including:

[0144] S4110, prepare a 2% agarose gel and add Gold View Type I nucleotide stain to obtain a first gel.

[0145] As you can understand, agarose gel is a commonly used gel electrophoresis medium for separating and visualizing the size of DNA molecules. Agarose is a polysaccharide that has gelling properties and can be used to form a gel matrix. Gold View I Nucleotide Stain is a new type of nucleic acid stain that can replace ethidium bromide (EB). It can produce a strong fluorescent signal after binding to DNA and is used to detect DNA in agarose gel electrophoresis. Under ultraviolet transmitted light, Gold View I Nucleotide Stain shows green fluorescence for double-stranded DNA and red fluorescence for single-stranded DNA.

[0146] Exemplarily, a 2% agarose gel is prepared and Gold View I type nucleotide stain is added thereto, and the gel solution is poured into a horizontal plate of an electrophoresis tank with a comb. For better distinction, the obtained gel is referred to as the first gel.

[0147] S4120, leaving the first gel to stand for 30 minutes, after the first gel solidifies, placing it in an electrophoresis tank, and adding electrophoresis buffer.

[0148] Exemplarily, after the agarose gel is allowed to solidify (first gel) for 30 minutes, it is placed in an electrophoresis tank and electrophoresis buffer is added.

[0149] S4130, adding the products of the multiplex PCR amplification to the sample loading wells of the first gel using a micropipette, and performing electrophoresis using an electrophoresis apparatus.

[0150] For example, the obtained PCR product is added to the agarose gel sample wells using a micropipette, 5 ul is added to each well, and the sample addition order and amount are recorded. The electrophoresis instrument is powered on, the voltage is adjusted to 80-100 V, and the electrophoresis is performed for about 40 minutes.

[0151] S4140, when bromophenol blue moved to 1 cm from the front of the gel, stop electrophoresis.

[0152] As you can understand, bromophenol blue is commonly used in gel electrophoresis experiments to visualize the migration of DNA or proteins. It is added to the gel sample or to the electrophoresis buffer in order to observe the migration during electrophoresis. Bromophenol blue can be used to visualize the location and migration distance of DNA or proteins in gel electrophoresis. After it binds to DNA or protein, it forms blue bands or spots, making them visible on the gel.

[0153] Illustratively, electrophoresis is stopped when bromophenol blue is observed to move to 1 cm from the front edge of the gel.

[0154] S4150, taking out the gel, placing it in a gel imaging analyzer to obtain PCR product bands, and saving the first gel image.

[0155] Exemplarily, the gel is taken out and placed in a gel imaging analyzer to observe the PCR product bands, and the following Figure 5 The agarose electrophoresis diagram of the twin DNA shown on the right side of the letter a in the figure is saved. For better distinction, the obtained gel image is called the first gel image.

[0156] In one possible implementation, see Figure 6 S400, analyzing the amplified product of the human B cell receptor heavy chain CDR3 coding sequence, completing the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire, and also comprising:

[0157] S4210, based on the first gel image, extract the target PCR band between 200-300 bp.

[0158] It can be understood that "bp" refers to "base pair" in biology. Base pairs are the structural units of DNA molecules, formed by two complementary bases bound to each other through hydrogen bonds. The base pairs of DNA include adenine (A) and thymine (T), as well as guanine (G) and cytosine (C). In a DNA sequence, the number of base pairs is used to measure the length of the sequence. For example, the length of a DNA fragment can be expressed as the number of base pairs (bp). For example, if the length of a DNA fragment is 1000bp, it means that the fragment consists of 1000 base pairs.

[0159] For example, the PCR product is subjected to agarose gel electrophoresis to obtain a clear target band between 200-300 bp, and the desired PCR product band is removed with a clean scalpel.

[0160] S4220, weigh the target PCR band and add 3 times the volume of Buffer QG to incubate and dissolve.

[0161] As you can understand, Buffer QG is a buffer commonly used in the purification and extraction of DNA and RNA. Buffer QG is mainly used to dissociate and dissolve proteins in DNA or RNA samples for subsequent purification and extraction steps. It can effectively release the binding between proteins and nucleic acids, making nucleic acids easier to separate and purify during the extraction process.

[0162] For example, the gel is weighed in a 2 ml EP tube. 3 volumes of Buffer QG are added to 1 volume of gel (100 mg gel-100 μl). The maximum amount of gel per EP tube is 400 mg. Incubate at 50°C for 10 min (or until the gel is completely dissolved). To facilitate complete dissolution of the gel, rotate and invert the EP tube every 2-3 min during incubation.

[0163] S4230, filtering the dissolved sample through an adsorption column and drying it.

[0164] For example, add the same volume of isopropanol as the gel to the sample and mix by pipetting. Take out the adsorption column and place it in a 2 ml collection tube. Transfer all the mixed liquid into the adsorption column (spin column), incubate for 2 minutes, set the centrifugal force to 17900g, 1min, discard the waste liquid in the collection tube, tap dry, and return the adsorption column to the collection tube. Add 500μl of Buffer QG to the adsorption column, incubate for 2 minutes, set the centrifugal force to 17900g, 1min, discard the waste liquid in the collection tube, tap dry, and return the adsorption column to the collection tube.

[0165] S4240, add Buffer PE to the adsorption column to elute the target substance.

[0166] It can be understood that Buffer PE is a buffer commonly used in DNA purification and extraction processes. Buffer PE is mainly used to wash and purify DNA samples to remove residual salt ions, proteins and other contaminants. It can help improve the purity and quality of DNA samples. EB Elution Buffer is a commonly used buffer used to elute target molecules, such as DNA or RNA, from gels or solid phase materials. EB Elution Buffer is mainly used to elute target molecules from gels or solid phase materials. In molecular biology experiments, it is often used to elute DNA molecules from agarose gels for subsequent experiments, such as PCR, sequencing, etc.

[0167] Exemplarily, add 750μl of Buffer PE to the adsorption column to wash the product, let it stand for 5min, set the centrifugal force to 17900g, centrifuge for 1min, discard the waste liquid in the collection tube, dry it, and put the adsorption column back into the collection tube. Empty the adsorption column at 17900g for 1min, discard the liquid completely, place the adsorption column in a clean 2ml centrifuge tube, open the lid and dry for 6min. Add 40μl EB elution solution to the middle position of the adsorption membrane in mid-air, incubate for 4min, set the centrifugal force to 17900g, 1min. In order to increase the elution concentration of DNA, 30μl EB elution solution can be added to the middle position of the adsorption membrane again, let it stand for 2min, and set the centrifugal force to 17900g for 1min.

[0168] S4250, prepare agarose gel, mix loading dye and purified DNA, and perform electrophoresis.

[0169] As you can understand, loading dye is a buffer commonly used in gel electrophoresis experiments to add color and weight to samples so that they can be loaded and tracked during electrophoresis. Loading dye is mainly used to add color to samples to make them easier to see and load during electrophoresis. It can also help samples settle in the gel so that they can be better loaded into the electrophoresis wells.

[0170] For example, a 2% agarose gel was prepared, 0.5 μl of Loading Dye was mixed with 2.5 μl of purified DNA, and electrophoresis was performed at 100 V for 40-50 min.

[0171] S4260, after electrophoresis, the gel is removed to obtain the purified DNA product band and save the second gel image.

[0172] For example, after electrophoresis, the gel is taken out and placed in a gel imaging analyzer to observe the purified DNA product strip, and the following is obtained: Figure 5 The electrophoresis diagram of the PCR product gel recovery shown on the right side of the letter b in the figure is a saved gel image, i.e., the second gel image.

[0173] S4270, construct a CDR3 repertoire based on the purified DNA product band.

[0174] It can be understood that the product after PCR amplification and purification is the CDR3 repertoire that can be used for sequencing. This repertoire is an important tool for studying B cell receptor diversity and antigen recognition.

[0175] In a third aspect, the embodiments of the present application provide a method for determining the sequence information of the human B cell receptor heavy chain CDR3 coding sequence. In this method, the CDR3 library is obtained through the construction method based on multiple PCR amplification of the CDR3 library in the above embodiment to obtain the basic raw materials for sequencing. Based on the CDR3 library, sequencing of the human B cell receptor heavy chain CDR3 coding sequence is performed to help understand the diversity and uniqueness of B cells. Based on the results of sequencing the human B cell receptor heavy chain CDR3 coding sequence, the sequence information of the human B cell receptor heavy chain CDR3 coding sequence is confirmed, and the following is obtained: Figure 7 The schematic diagram of the VJ gene fragment pairing distribution and abundance results shown will help to better understand and interpret genomic data, understand the antigen recognition ability of B cells and their role in immune responses, promote in-depth research on human B cell immune responses, and discover meaningful patterns and differences.

[0176] In the fourth aspect, the present application embodiment provides an antigen site prediction method based on the B cell receptor heavy chain CDR3 coding sequence. In the method, by obtaining the method for determining the sequence information of the human B cell receptor heavy chain CDR3 coding sequence in the above embodiment, the sequence information of the human B cell receptor heavy chain CDR3 coding sequence is obtained, and the sequence information of the CDR3 coding sequence has a first antigen key point set, which is the key information for antigen site prediction. And obtain the antigen structure simulation model of the standard antigen, the antigen structure simulation model includes a second antigen key point set of the antigen, and this model can help understand the second antigen key point set of the antigen, which is an important part of the interaction between the antibody and the antigen. Obtain the first antigen key point set, match the first antigen key point set with the second antigen key point set of the standard antigen to obtain a successful matching result, so as to more accurately predict the antigen site. Calculate the affinity simulation value of the second antigen key point set and the first antigen key point set, and understand the interaction strength between the antibody and the antigen. According to the affinity simulation value, the antigen site prediction result is obtained. Predicting and understanding the key sites of antigens will help design more effective vaccines that target the key parts of pathogens, enhance immune protection, and promote the development of medicine.

[0177] In order to better understand the antigen site prediction method based on the B cell receptor heavy chain CDR3 coding sequence provided in the embodiment of the present application, the specific implementation process of the antigen site prediction method based on the B cell receptor heavy chain CDR3 coding sequence provided in the embodiment of the present application is exemplarily introduced below.

[0178] Figure 8 A schematic flow chart of an antigen site prediction method based on a B cell receptor heavy chain CDR3 coding sequence provided in an embodiment of the present application is shown. The antigen site prediction method based on a B cell receptor heavy chain CDR3 coding sequence includes:

[0179] S10, based on the method for determining the sequence information of the human B cell receptor heavy chain CDR3 coding sequence according to the third aspect above, the sequence information of the human B cell receptor heavy chain CDR3 coding sequence is obtained, wherein the sequence information of the CDR3 coding sequence has a first antigen key point set.

[0180] It can be understood that obtaining the B cell receptor heavy chain CDR3 coding sequence can understand the first antigen key point set of these sequences. The CDR3 region of the B cell receptor heavy chain is a key part of antibody recognition and antigen binding, and its diversity enables B cells to recognize and respond to a variety of different antigens. By deeply analyzing these CDR3 coding sequences, we can have a deeper understanding of the interaction between antibodies and antigens, which is of great significance for vaccine design and the formulation of disease treatment strategies.

[0181] In a possible implementation, S10, based on the method for determining sequence information of a human B cell receptor heavy chain CDR3 coding sequence according to the third aspect, sequence information of a human B cell receptor heavy chain CDR3 coding sequence is obtained, wherein the sequence information of the CDR3 coding sequence has a first antigen key point set, including:

[0182] S11, in response to the operation instruction, obtaining a CDR3 coding sequence from a database; the CDR3 coding sequence includes a first antigen key point set, and the CDR3 coding sequence includes a text form or a graphic form.

[0183] It can be understood that after receiving the operation instruction, the CDR3 coding sequence is obtained from the database. These sequences contain a set of first antigen key points, which are important parts of the binding of antibodies to antigens. The CDR3 coding sequence can be represented in text form or in graphical form. Sequences in text form are intuitive and can be used for bioinformatics analysis such as gene sequence alignment and mutation analysis. Sequences in graphical form, such as protein structure models, can help to more intuitively understand the spatial structure of proteins and the interactions between proteins.

[0184] S20, obtaining an antigen structure simulation model of the standard antigen, wherein the antigen structure simulation model includes a second antigen key point set of the standard antigen.

[0185] It can be understood that the structural model of the antigen can be simulated and established based on the known antigen sequence and structural image. Standard antigen is a reference substance used in immunology and biochemistry experiments to quantitatively measure the concentration or activity of antibodies or other biological molecules. Then, by analyzing this model, possible sets of key points of the second antigen can be identified. These key points may be part of the antigen surface and play an important role in the binding of antibodies.

[0186] In one possible implementation, see Fig. 9 , S20, obtaining an antigen structure simulation model of a standard antigen, the antigen structure simulation model including a second antigen key point set of the antigen, including:

[0187] S21, obtaining a three-dimensional structural image of a standard antigen.

[0188] It is understood that the three-dimensional structure image of the standard antigen can be obtained from a preset antigen structure image library. The antigen structure image library is a pre-established image library containing various three-dimensional structures of antigens.

[0189] S22, extracting antigen structure simulation data from the three-dimensional structure image.

[0190] It will be appreciated that PDB files can be loaded using molecular visualization and analysis tools such as PyMOL, Chimera or VMD. These tools can be used to extract various structural information, including but not limited to the coordinates of amino acid residues, secondary structural elements (e.g., α-helices and β-sheets), interatomic distances, angles, and hydrogen bonds and other non-covalent interactions.

[0191] S23, performing antigen key point detection and antigen structure detection on the antigen structure simulation data to obtain an antigen structure simulation model.

[0192] It is understood that antigen key points usually refer to key amino acid residues in protein structure, which play an important role in protein function, stability or interaction with other molecules. The detection of key points is usually based on a series of computational methods, including but not limited to sequence conservation analysis, structural stability analysis, molecular dynamics simulation, energy calculation, etc. There are many software and tools for such analysis, such as ConSurf for sequence conservation analysis and FoldX for structural stability and energy calculation. The key points of antigen-antibody interaction can be identified by identifying key residues. And the construction of antigen structure simulation model can be realized through molecular modeling and design software, such as Rosetta or I-TASSER.

[0193] S24, the CDR3 coding sequence and the antigen structure simulation model are displayed simultaneously on the page.

[0194] It is understood that a tool called a sequence alignment editor (such as BioEdit or Jalview) can be used to display the CDR3 coding sequence. These tools can display the DNA or protein sequence in an easy-to-read manner. A tool called a molecular visualization software (such as PyMOL or Chimera) can be used to display the antigen structure simulation model. These tools can display the three-dimensional structure of the molecule in the form of a graph. An editor or browser that supports multiple windows or split views can be used to display these two pieces of information on the same page. The CDR3 coding sequence can be displayed in one window and the antigen structure simulation model can be displayed in another window.

[0195] S30, obtaining a first antigen key point set, and matching the first antigen key point set with a second antigen key point set of a standard antigen to obtain a successful matching result.

[0196] It is understandable that antigen key points are extracted from the B cell receptor heavy chain CDR3 coding sequence. The CDR3 region is the key part of the antibody in contact with the antigen, so the amino acid sequence it encodes usually reflects the key points of the antigen. Matching the first antigen key point set with the second antigen key point set requires comparing the similarity of the first antigen key point set with the second antigen key point set. This can be achieved by a variety of methods, such as sequence alignment or structural alignment. This process requires the use of specialized software tools, such as BLAST (for sequence alignment) or TM-align (for structural alignment). If the first antigen key point set has sufficient similarity with the second antigen key point set, then the match can be considered successful. A successful matching result may mean that the B cell receptor is able to recognize and effectively bind to the antigen, thereby triggering an immune response.

[0197] In one possible implementation, see Fig.10 , S30, obtaining a first antigen key point set, matching the first antigen key point set with a second antigen key point set of a standard antigen to obtain a successful matching result, including:

[0198] S31, obtaining an amino acid sequence encoded by CDR3; the amino acid sequence encoded by CDR3 includes an amino acid sequence translated from the CDR3 encoding sequence.

[0199] It is understood that after receiving the operation instruction, the amino acid sequence obtained by translating the CDR3 code from the database can be obtained. These amino acid sequences are translated from the CDR3 coding sequence, and they contain the first antigen key point set. By deeply analyzing these amino acid sequences, a deeper understanding of the interaction between antibodies and antigens can be achieved, which is of great significance for vaccine design and the formulation of disease treatment strategies.

[0200] S32, identify key amino acids from the amino acid sequence encoded by CDR3.

[0201] It is understood that key amino acids can be identified from the amino acid sequence encoded by CDR3. These key amino acids are an important part of antibody-antigen binding, and their identification can be performed by bioinformatics tools and methods, such as by aligning multiple sequences to identify highly conserved amino acid sites, or by structural biology analysis to identify amino acids that play a key role in antibody-antigen binding.

[0202] S33, performing antigen key point identification on the key point amino acids to obtain a first antigen key point set.

[0203] It is understood that by matching the preset key point amino acids of the antibody-antigen complex structure, it is possible to determine which amino acid sites may play a key role when the antibody binds to the antigen. Then, based on these key point amino acids, possible antigen key points can be identified through bioinformatics tools and databases. In this way, the first antigen key point set can be obtained.

[0204] In one possible implementation, see Fig.11 , S30, obtaining a first antigen key point set, matching the first antigen key point set with a second antigen key point set of a standard antigen to obtain a successful matching result, including:

[0205] S34, calculating the complementarity between the first antigen key point set and the second antigen key point set.

[0206] It will be appreciated that the amino acid sequences in the two sets can be aligned using a pre-set sequence alignment tool (such as BLAST or Clustal Omega). This process will generate an alignment score, which indicates the similarity of the two sequences. The alignment score can be converted into a complementarity value. This can be achieved by dividing the alignment score by the maximum possible alignment score (i.e., if the two sequences are exactly the same). The result will be a value between 0 (completely dissimilar) and 1 (completely similar), indicating the complementarity of the two sets.

[0207] S35, when the complementarity is greater than or equal to the complementarity threshold, a successful matching result is obtained, otherwise, a new first antigen key point set is obtained as the first antigen key point set, and the step of calculating the complementarity of the first antigen key point set and the second antigen key point set is returned until the complementarity is greater than or equal to the complementarity threshold, and a successful matching result is obtained.

[0208] It is understood that if the complementarity is greater than or equal to the complementarity threshold, a successful match result is obtained and the process ends. Otherwise, a new set of first antigen key points is reacquired. This can be achieved by various methods, for example, by changing certain elements in the set, or by using a search algorithm (such as simulated annealing or genetic algorithm) to find a new set that may have a higher complementarity. Until the complementarity is greater than or equal to the complementarity threshold, a successful match result is obtained.

[0209] S40, calculating the affinity simulation value of the second antigen key point set and the first antigen key point set.

[0210] It will be appreciated that affinity can be calculated using molecular dynamics simulations. Molecular dynamics simulations are a computational chemistry method used to simulate the physical motion of molecules and atoms. In this method, the interactions between a first set of antigen keypoints and a second set of antigen keypoints can be simulated, and then the energy of these interactions can be calculated, which can be considered a measure of affinity.

[0211] S50, obtaining the antigen site prediction result according to the affinity simulation value.

[0212] It can be understood that the antigenic site (or antigenic determinant) is the part of the antigen molecule that can be recognized and bound to the antibody. According to the calculated affinity simulation value of the second antigen key point set and the first antigen key point set, it can be used to predict the antigenic site. The higher the affinity simulation value, the stronger the binding between the first antigen key point set and the second antigen key point set, which may mean that these key points are effective antigenic sites. Therefore, a threshold value of a possible affinity simulation value can be set according to the level of the affinity simulation value. When the affinity simulation value exceeds the threshold, the possible antigenic site is predicted. By predicting and understanding the key sites of antigens, it is helpful to design more effective vaccines, target the key parts of pathogens, enhance the immune protection effect, and promote the development of medicine.

[0213] It should be understood that the size of the serial numbers of the steps in the above embodiments does not mean the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0214] In a fifth aspect, an embodiment of the present application provides a kit comprising a primer composition for detecting the coding sequence of human B cell receptor heavy chain CDR3.

[0215] The present application also provides an antigen site prediction device based on the B cell receptor heavy chain CDR3 coding sequence, Fig.12 This is a schematic diagram of the structure of an antigen site prediction device based on the B cell receptor heavy chain CDR3 coding sequence provided in one embodiment of the present application. Fig.12 As shown, the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence of this embodiment includes: at least one processor 60 ( Fig.12 Only one is shown), at least one memory 61 ( Fig.12Only one is shown in the figure) and a computer program 62 stored in the at least one memory 61 and executable on the at least one processor 60. When the processor 60 executes the computer program 62, the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence implements the steps in any of the above-mentioned embodiments of the antigen site prediction method based on the B cell receptor heavy chain CDR3 coding sequence.

[0216] Exemplarily, the computer program 62 may be divided into one or more units, which are stored in the memory 61 and executed by the processor 60 to complete the present application. The one or more units may be a series of computer program instruction segments capable of completing specific functions, which are used to describe the execution process of the computer program 62 in the electronic device 6.

[0217] The antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence can be a computing device such as a desktop computer, a notebook, a PDA, and a cloud server. The antigen site prediction device based on the B cell receptor heavy chain CDR3 coding sequence can include, but is not limited to, a processor 60 and a memory 61. Those skilled in the art can understand that Fig.12 It is only an example of an antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence, and does not constitute a limitation on the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence. It may include more or fewer components than shown in the figure, or a combination of certain components, or different components, for example, it may also include input and output devices, network access devices, buses, etc.

[0218] The processor 60 may be a central processing unit (CPU), or other general-purpose processors, digital signal processors (DSP), application-specific integrated circuits (ASIC), field-programmable gate arrays (FPGA) or other programmable logic devices, discrete gate or transistor logic devices, discrete hardware components, etc. A general-purpose processor may be a microprocessor or any conventional processor, etc.

[0219] In some embodiments, the memory 61 may be an internal storage unit of the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence, such as a hard disk or memory of the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence. In other embodiments, the memory 61 may also be an external storage device of the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence, such as a plug-in hard disk, a smart memory card (Smart Media Card, SMC), a secure digital (Secure Digital, SD) card, a flash card (Flash Card), etc. equipped on the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence. Further, the memory 61 may also include both the internal storage unit of the antigen site prediction device 6 based on the B cell receptor heavy chain CDR3 coding sequence and an external storage device. The memory 61 is used to store an operating system, an application program, a boot loader (BootLoader), data and other programs, such as the program code of the computer program, etc. The memory 61 may also be used to temporarily store data that has been output or is to be output.

[0220] An embodiment of the present application further provides a computer-readable storage medium, wherein the computer-readable storage medium stores a computer program, and when the computer program is executed by a processor, the steps in any of the above method embodiments are implemented.

[0221] An embodiment of the present application provides a computer program product. When the computer program product is executed on an electronic device, the electronic device implements the steps in any of the above method embodiments.

[0222] If the integrated unit is implemented in the form of a software functional unit and sold or used as an independent product, it can be stored in a computer-readable storage medium. Based on this understanding, the present application implements all or part of the processes in the above-mentioned embodiment method, which can be completed by instructing the relevant hardware through a computer program, and the computer program can be stored in a computer-readable storage medium, and the computer program can implement the steps of the above-mentioned various method embodiments when executed by the processor. Among them, the computer program includes computer program code, and the computer program code can be in source code form, object code form, executable file or some intermediate form. The computer-readable medium may at least include: any entity or device capable of carrying the computer program code to the terminal device, a recording medium, a computer memory, a read-only memory (ROM, Read-Only Memory), a random access memory (RAM, Random Access Memory), an electric carrier signal, a telecommunication signal and a software distribution medium. For example, a USB flash drive, a mobile hard disk, a magnetic disk or an optical disk. In some jurisdictions, according to legislation and patent practice, computer-readable media cannot be electric carrier signals and telecommunication signals.

[0223] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0224] Those of ordinary skill in the art will appreciate that the units and algorithm steps of each example described in conjunction with the embodiments disclosed herein can be implemented in electronic hardware, or a combination of computer software and electronic hardware. Whether these functions are performed in hardware or software depends on the specific application and design constraints of the technical solution. Professional and technical personnel can use different methods to implement the described functions for each specific application, but such implementation should not be considered to be beyond the scope of this application.

[0225] In the embodiments provided in the present application, it should be understood that the disclosed antigen site prediction device and method based on the B cell receptor heavy chain CDR3 coding sequence can be implemented in other ways. For example, the above-described antigen site prediction device embodiment based on the B cell receptor heavy chain CDR3 coding sequence is only schematic. For example, the division of the units is only a logical function division. There may be other division methods in actual implementation, such as multiple units or components can be combined or integrated into another system, or some features can be ignored or not executed. Another point is that the coupling or direct coupling or communication connection between each other shown or discussed can be an indirect coupling or communication connection through some interfaces, devices or units, which can be electrical, mechanical or other forms.

[0226] The units described as separate components may or may not be physically separated, and the components shown as units may or may not be physical units, that is, they may be located in one place or distributed on multiple network units. Some or all of the units may be selected according to actual needs to achieve the purpose of the solution of this embodiment.

[0227] The embodiments described above are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, a person skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application, and should all be included in the protection scope of the present application.

Claims

1. A primer composition for amplifying a human B cell receptor heavy chain CDR3 coding sequence, characterized in that: include: A first primer set and a second primer set; wherein the first primer set is an upstream primer set, comprising at least one human IGHCDR3 upstream primer; The second primer set is a downstream primer set, comprising at least one human IGH CDR3 downstream primer; The first primer set and the second primer set can bind to nucleic acid of human B cells respectively.

2. The primer composition for amplifying the human B cell receptor heavy chain CDR3 coding sequence according to claim 1, characterized in that: The first primer set consists of 7 primers covering functional gene fragments and pseudogene fragments of human IGHV; The second primer set consists of 9 primers covering human IGHJ functional gene fragments and pseudogene fragments.

3. The primer composition for amplifying the human B cell receptor heavy chain CDR3 coding sequence according to claim 2, characterized in that: The gene sequences of the 7 primers covering the functional gene fragments and pseudogene fragments of human IGHV in the first primer set are shown in SEQ ID NOs: 1-7 respectively; The gene sequences of the 9 primers in the second primer set covering human IGHJ functional gene fragments and pseudogene fragments are shown in SEQ ID NOs: 8-16, respectively.

4. A method for constructing a CDR3 repertoire based on multiplex PCR amplification, characterized in that: include: Obtaining mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequences isolated from human peripheral blood; Extracting and obtaining genomic nucleic acid based on mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequence separated from the human peripheral blood; Combining the genomic nucleic acid with the primer combination according to any one of claims 1 to 3 to perform multiplex PCR amplification to obtain an amplification product of the human B cell receptor heavy chain CDR3 coding sequence; The amplified products of the human B cell receptor heavy chain CDR3 coding sequence were analyzed to complete the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire.

5. The method for constructing a CDR3 repertoire based on multiplex PCR amplification according to claim 4, characterized in that: The mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence obtained from human peripheral blood and separated include: Human peripheral blood was collected and diluted with PBS in equal proportions; Mixing the blood diluted with PBS in equal proportion with the human lymphocyte separation solution, and centrifuging to obtain a first centrifuge solution; Aspirate PBMCs from the first centrifuge solution, add PBS, mix well, and continue centrifugation to obtain a second centrifuge solution; Using a pipette to blow up the bottom cells in the second centrifugation solution, washing and collecting the mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence; The method of extracting genomic nucleic acid from mononuclear cells containing human B cell receptor heavy chain CDR3 coding sequence separated from human peripheral blood comprises: Adding the obtained mononuclear cells containing the human B cell receptor heavy chain CDR3 coding sequence to a mixture of proteinase K and Buffer AL, incubating and adding ethanol to obtain a first mixture; Use a DNA Mini column to absorb the first mixed solution, add Buffer AW1 and centrifuge to obtain the first DNA Mini column; Mix the first DNA Mini column and Buffer AW2 and centrifuge to obtain a second DNA Mini column; Repeat the elution of the second DNA Mini column with Buffer AE to obtain genomic nucleic acid.

6. The method for constructing a CDR3 repertoire based on multiplex PCR amplification according to claim 4, characterized in that: In the step of combining the genomic nucleic acid with the primer composition according to any one of claims 1 to 3 for multiplex PCR amplification to obtain the amplified product of the human B cell receptor heavy chain CDR3 coding sequence, the reaction system of the multiplex PCR amplification comprises: 25 μl of PCR premix, 0.2 μl*7 of the first primer set, 0.15 μl*9 of the second primer set, 1 μg of the genomic nucleic acid, and ddH2O supplemented to a total of 50 μl of the reaction system; In the step of combining the genomic nucleic acid with the primer composition according to any one of claims 1 to 3 to perform multiplex PCR amplification to obtain an amplified product of the human B cell receptor heavy chain CDR3 coding sequence, the multiplex PCR amplification reaction procedure comprises: Pre-denaturation at 94°C for 3 min; Denaturation at 94°C for 1 min, annealing at 56°C for 3 min, and extension at 72°C for 1 min were performed for 40 cycles; The final extension was carried out at 72°C for 10 min.

7. The method for constructing a CDR3 repertoire based on multiplex PCR amplification according to claim 6, characterized in that: The amplified product of the human B cell receptor heavy chain CDR3 coding sequence obtained by the analysis completes the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire, including: Prepare a 2% agarose gel and add Gold View Type I nucleotide stain to obtain a first gel; The first gel was allowed to stand for 30 minutes, and after the first gel solidified, it was placed in an electrophoresis tank, and electrophoresis buffer was added; Add the products of the multiplex PCR amplification to the sample wells of the first gel using a micropipette, and perform electrophoresis using an electrophoresis instrument; When bromophenol blue moved to 1 cm from the front of the gel, electrophoresis was stopped; Take out the gel, put it in a gel imaging analyzer to obtain the PCR product band, and save the first gel image; The amplified product of the human B cell receptor heavy chain CDR3 coding sequence obtained by the analysis completes the identification of the CDR3 nucleic acid sequence and the construction of the CDR3 repertoire, and also includes: Based on the first gel image, extract the target PCR band between 200-300 bp; Weigh the target PCR band, add 3 times the volume of Buffer QG to incubate and dissolve; Add an equal volume of isopropanol, mix well, and transfer to the adsorption column; Add Buffer PE to the adsorption column to elute the target substance; Prepare agarose gel, mix loading dye and purified DNA, and perform electrophoresis; After electrophoresis, the gel is taken out to obtain the purified DNA product band and save the second gel image; Based on the purified DNA product bands, a CDR3 repertoire was constructed.

8. A method for determining the sequence information of a human B cell receptor heavy chain CDR3 coding sequence, characterized in that: include: Obtaining a CDR3 repertoire based on the method according to any one of claims 4 to 7; Based on the CDR3 repertoire, sequencing of the human B cell receptor heavy chain CDR3 coding sequence is performed; Based on the results of sequencing the human B cell receptor heavy chain CDR3 coding sequence, the sequence information of the human B cell receptor heavy chain CDR3 coding sequence is confirmed.

9. A method for predicting antigenic sites based on the B cell receptor heavy chain CDR3 coding sequence, characterized in that: include: Based on the method of claim 8, obtaining sequence information of a human B cell receptor heavy chain CDR3 coding sequence, wherein the sequence information of the CDR3 coding sequence has a first antigen key point set; Acquire an antigen structure simulation model of a standard antigen, wherein the antigen structure simulation model includes a second antigen key point set of the standard antigen; Acquire a first antigen key point set, and match the first antigen key point set with a second antigen key point set of a standard antigen to obtain a successful matching result; Calculating the affinity simulation value of the second antigen key point set and the first antigen key point set; According to the affinity simulation value, the antigen site prediction result is obtained.

10. A kit, characterized in that: The kit contains the primer combination according to any one of claims 1 to 3, which is used to detect the coding sequence of human B cell receptor heavy chain CDR3.

Images