A nucleotide composition for detecting gene variation and a high-throughput sequencing library constructed therefrom

Abstract

The present invention discloses a nucleotide composition for detecting gene variation and a high-throughput sequencing library constructed therefrom, belonging to the technical field of gene detection. The nucleotide composition provided by the present invention is based on probe differential ligation, and is used to detect variation in a target template, wherein there is at least one base variation between the target template and the non-target template, and includes a blocking probe, a connecting probe one, and a connecting probe two: the blocking probe specifically binds to the non-target template; the target template is provided with an unconnected connecting probe one and a connecting probe two, and the connecting probe one and the connecting probe two specifically bind to the target template, and are respectively located on both sides of the target template variation site, and the base complementary to the target template variation site is located on the connecting probe one or the connecting probe two. The nucleotide composition of the present invention can detect variation information as low as 0.1% in a nucleic acid sample, and the high-throughput sequencing library constructed therefrom does not require high-depth sequencing, the amount of sequencing data is small, and the number of detectable sites is greatly increased.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a nucleotide composition for detecting gene variation and a high-throughput sequencing library constructed therefrom. Background Art

[0002] Liquid biopsy technology, which detects free circulating tumor DNA (ctDNA) based on high-throughput sequencing (next-generation sequencing, NGS, also known as second-generation sequencing) technology, is expected to improve the diagnosis and treatment of tumors.

[0003] Compared with tissue biopsy, liquid biopsy has the advantages of low operation requirements, less trauma, easy frequent sampling, and small sampling deviation. Generally speaking, in cancer patients, apoptosis and tumor cell necrosis are the main sources of ctDNA. The content of ctDNA in body fluids such as blood, urine, and cerebrospinal fluid is very low, usually accounting for less than 1% of the extracellular DNA (cell free DNA, cfDNA).

[0004] NGS can sequence thousands of sites at a time and can be applied to tumor screening, targeted drug selection, drug resistance identification, treatment effect evaluation, etc. However, due to the sequencing library construction process and sequencing platform, the detection limit of NGS is generally 2%. The library construction method based on unique molecular identifier (UMI) can increase the detection sensitivity of NGS to 0.1%, but this usually requires an ultra-high sequencing depth of more than 25000X, which limits the application of UMI-NGS technology in detecting low-frequency variants below 1%.

[0005] In addition to UMI-NGS, other commonly used methods for low-frequency variant detection include allele retardation amplification system (ARMS) and digital PCR technology. The detection sensitivity of ARMS and digital PCR technology can reach 0.1%, but they can only detect a limited number of variant sites, and the detection throughput is difficult to improve.

[0006] Therefore, the market is in urgent need of a high-throughput sequencing technology that does not require high sequencing depth but can detect low-frequency variants below 1%. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a nucleotide composition for detecting allele variation based on probe differential ligation.

[0008] The present invention provides a nucleotide composition for detecting gene variation, which is used to detect variation in a target template, wherein the target template and a non-target template have at least one base variation, and the nucleotide composition comprises a blocking probe, a ligation probe 1 and a ligation probe 2, wherein:

[0009] The blocking probe is designed based on the non-target template and binds specifically to the non-target template;

[0010] The target template is provided with unconnected ligation probe one and ligation probe two, which specifically bind to the target template and are respectively located in the downstream complementary region and upstream complementary region of the target template variation site, and the base complementary to the target template variation site is located on ligation probe one or ligation probe two.

[0011] Furthermore, the ligation probe 1, the ligation probe 2 and the corresponding parts of the target template variation site are completely complementary and paired, and the blocking probe sequence and the non-target template sequence are completely complementary and paired.

[0012] Furthermore, the ligation probe and the blocking probe are designed based on the principle of thermodynamics. The Gibbs free energy of binding between the blocking probe and the non-target template (G 阻滞 ) Gibbs free energy of binding to the ligated probe and non-target template (G 连接 ) 阻滞_连接 It can be -9.5 to -8.5 kcal / mol, -8.5 to -7.5 kcal / mol, -7.5 to -6.5 kcal / mol, -6.5 to -5.5 kcal / mol, -5.5 to -4.5 kcal / mol, -4.5 to -3.5 kcal / mol, -3.5 to -2.5 kcal / mol, -2.5 to -1.5 kcal / mol, -1.5 to -0.5 kcal / mol. Preferably, ΔG 阻滞_连接 The Gibbs free energy of the binding of the ligation probe to the non-target template refers to the sum of the Gibbs free energy of the binding of the ligation probe 1 to the non-target template and the Gibbs free energy of the binding of the ligation probe 2 to the non-target template.

[0013] Furthermore, ligation probe one and ligation probe two are reverse complementary to the target template and are adjacent end to end, that is, after ligation probe one and ligation probe two specifically bind to different regions of the target template respectively, they are disconnected at the complementary base of the mutation site, and the complementary base is located at the 3′ end of ligation probe one or at the 5′ end of ligation probe two.

[0014] Furthermore, the side of ligation probe 1 and ligation probe 2 away from the variation site carries a library adapter sequence. In an embodiment of the present invention, the 5' end of ligation probe 1 and the 3' end of ligation probe 2 respectively carry a library adapter sequence.

[0015] Furthermore, the 5' end of the second ligation probe is phosphorylated for use in a ligation reaction catalyzed by a ligase.

[0016] The present invention also provides a method for constructing a second-generation sequencing library capable of detecting low-frequency variations without relying on high-depth sequencing, comprising the following steps:

[0017] (1) hybridizing a sample DNA to be tested, a blocking probe, a ligation probe 1, and a ligation probe 2, and performing a ligation reaction after the hybridization, wherein the sample DNA to be tested contains a target template and a non-target template;

[0018] (2) Performing sample index PCR amplification on the ligation product obtained in step (1) to construct a high-throughput sequencing library.

[0019] Furthermore, the sample DNA to be tested may be cfDNA or gDNA, derived from plasma, serum, blood, urine, sweat, saliva, semen, pleural effusion, ascites, feces, puncture specimens or paraffin-embedded tissue (FFPE) specimens.

[0020] Furthermore, in step (1), DNA ligase is added to carry out a ligation reaction.

[0021] Furthermore, the construction method of the above high-throughput sequencing library is specifically as follows:

[0022] (1) Denaturing the DNA of the sample to be tested;

[0023] (2) adding a hybridization buffer, a ligation probe 1, a ligation probe 2, and a blocking probe to the sample DNA to be tested, mixing them evenly, and then performing hybridization to obtain a hybridization mixture;

[0024] (3) Mix ligation buffer A, ligation buffer B and ligase evenly, add the above hybridization mixture, mix well, and perform ligation reaction;

[0025] (4) Add UDI index and the above-mentioned ligation product, mix well, and perform PCR reaction;

[0026] (5) Purify the PCR amplification product to obtain the final high-throughput sequencing library.

[0027] In the present invention, according to the difference in binding free energy, when the target template, non-target template, blocking probe and ligation probe are present in the same system for hybridization reaction, the non-target template binds to the blocking probe, and the target template binds to the ligation probe. After the ligation probe 1 and the ligation probe 2 bind to the target template, they can be connected by the subsequent DNA ligase to form a complete ligation probe. The ligation probe 1 and the ligation probe 2 respectively carry library adapter sequences, which can be complementary paired with the subsequent index primers, so as to be amplified to form a complete sequencing library.

[0028] The above nucleotide composition or the constructed high-throughput sequencing library can be used to detect low-frequency variations (variations as low as 0.1%). When a kit for detecting low-frequency variations is prepared, it includes the above nucleotide composition or high-throughput sequencing library.

[0029] A low-frequency variation detection method of the present invention constructs the above-mentioned high-throughput sequencing library for the sample to be tested, enriches the target template (variant DNA), and sequences the enriched target template to obtain variation information.

[0030] Furthermore, when sequencing a high-throughput sequencing library, the sequencing depth is 100X-1000X.

[0031] The advantages of the present invention for detecting gene mutations are: (1) the detection sensitivity of high-throughput sequencing (next generationsequencing, NGS) technology is increased from 2% to 0.1%; (2) because the proportion of the target template is amplified, the detection method of the present invention does not require high-depth sequencing, the amount of sequencing data is small, and the desktop sequencing platform is endowed with the ability to carry out tumor liquid biopsy; (2) compared with the traditional probe hybridization capture library construction method, the present method is simple to operate, does not require DNA shearing and end repair processes, and significantly shortens the time for library construction and gene mutation detection; (3) for the technical platform for enrichment of variant molecules, most of the existing technologies use quantitative PCR technology, and each tube has a small number of sites (only 1-5 sites). If the sites are increased, they need to be tested separately, resulting in an increase in the consumption of sample volume, and for tumor patients, it is difficult to draw a large amount of blood. The present invention belongs to the field of NGS technology, and each tube can detect sites from hundreds to thousands, and the requirement for sample volume is lower.

[0032] By means of the above scheme, the present invention has at least the following advantages:

[0033] The present invention introduces a blocking probe into the nucleotide composition, and the blocking probe and the connecting probe competitively bind to the target template or the non-target template, thereby effectively enriching the variant molecules (target template) and increasing the proportion of variant alleles in the library, thereby improving the sensitivity of detection and being able to detect variants as low as 0.1%.

[0034] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0036] Figure 1 Schematic diagram of the nucleotide composition of the present invention. DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0038] In the following embodiments, the method for constructing a high-throughput sequencing library comprises the following steps:

[0039] (1) Nucleic acid denaturation: Denature the cfDNA or gDNA sample. The denaturation program is set as: 95°C, 2 min; 25°C, hold.

[0040] (2) Nucleic acid hybridization: Add 1.5 μL of hybridization buffer, 0.75 μL of the mixture of ligation probe 1 and ligation probe 2, and 0.75 μL of blocking probe to the PCR tube containing the sample. After mixing evenly, put it into the PCR instrument and start the hybridization program. The hybridization program is set as follows: 95°C, 30 sec; 60°C, 16 hrs; 60°C, hold.

[0041] (3) Probe ligation: Add 3 μL of ligation buffer A, 3 μL of ligation buffer B, and 1 μL of ligase-65 to a new centrifuge tube and mix well. Keep the PCR tube on the PCR instrument, lower the temperature of the PCR instrument to 54°C, add 7 μL of the prepared ligation mixture to the PCR tube, mix well, and run the ligation program. The ligation program settings are: 54°C, 15 min; 98°C, 5 min; 4°C, hold.

[0042] (4) Nucleic acid amplification: Add 25 μL 2X HiFi PCR Master Mix, 5 μL UDIindex and 20 μL of the above ligation product to a new PCR tube. After mixing evenly, put it into the PCR instrument for PCR reaction. The PCR reaction program is set as follows: 98℃, 2min; (98℃, 15sec; 60℃, 30sec; 72℃, 30sec)X 30cycles; 72℃, 2min; 4℃, hold.

[0043] (5) Purify the PCR amplification product to obtain the final sequencing library.

[0044] The temperature and time of each reaction in the above steps can be adjusted according to the amount of DNA input, the enzymes used in each reaction, the buffer and the reaction system. The temperature and time of each reaction in the above steps are only used as examples and are not intended to limit the scope of the present invention. It should be understood that modifications or deformations of the technical solution without departing from the creative concept of differential probes ligation (DPL) also fall within the scope of protection of the present invention.

[0045] Example 1

[0046] This example uses the hotspot mutation detection of lung cancer-related genes and the Illumina high-throughput sequencing platform as an example.

[0047] 1. Probe design and synthesis

[0048] For the hotspot mutation sites of lung cancer-related genes, blocking probes and ligation probes were designed and synthesized according to the thermodynamic principle, wherein the 5' end of ligation probe 2 was phosphorylated. The hotspot mutation sites of lung cancer-related genes and the corresponding probes involved in the embodiments of the present invention are shown in Table 1 and Table 2, respectively.

[0049] Table 1 Hotspot mutation sites of lung cancer and corresponding probe numbers involved in the embodiments of the present invention

[0050]

[0051]

[0052] Table 2 Probe sequence information

[0053]

[0054]

[0055]

[0056]

[0057] The probe in this embodiment can be applied to second-generation sequencing platforms of different brands, including but not limited to Illumina, ThermoFisher, and BGI.

[0058] 2. Preparation of samples to be tested

[0059] The samples tested in the embodiment of the present invention include 24 unknown plasma samples and 4 cfDNA standards. The unknown samples were tested simultaneously using DPL technology and control technology (ARMS PCR technology). The cfDNA standard contains 6 single-base variants (SNVs), 1 deletion and 1 insertion site, and its variation frequencies are 1%, 0.5%, 0.1% and 0% respectively after digital PCR calibration, and the DPL technology is used for 3 repeated tests.

[0060] 3. Extraction of free DNA from plasma samples

[0061] 1. Separate the plasma from 10 mL of freshly collected whole blood within 4 hours, centrifuge at 1600 g for 20 minutes at 4°C, and transfer the supernatant plasma to a new centrifuge tube. Centrifuge at 16000 g for 10 minutes to remove residual cells, and transfer the supernatant plasma to a 15 mL centrifuge tube.

[0062] 2. Add 160 μL of proteinase K and 400 μL of sample lysis buffer to the 15 mL centrifuge tube containing plasma, vortex and mix the tube, and incubate at 60°C for 20 minutes.

[0063] 3. While incubating, add free DNA lysis / binding solution and nanomagnetic beads in turn to another centrifuge tube (add 5 mL of free DNA lysis / binding solution and 60 μL of nanomagnetic beads to each reaction) to prepare a nanomagnetic bead binding solution of appropriate reaction volume and mix well.

[0064] 4. After the incubation, equilibrate the centrifuge tube to room temperature, add the prepared nanomagnetic bead binding solution to the lysed plasma sample, and invert 10 times to mix.

[0065] 5. Oscillate the centrifuge tube at 1000 rpm for 10 minutes, then place it on a magnetic rack and let it stand for 5 minutes to allow the solution in the tube to clarify.

[0066] 6. Carefully discard the supernatant, remove the centrifuge tube from the magnetic stand, add 1 mL of washing solution, and vortex to resuspend the nanomagnetic beads.

[0067] 7. Transfer the resuspended nanomagnetic bead solution into a new 1.5 mL centrifuge tube and place it on a magnetic rack for 2 minutes to allow the solution in the tube to clarify.

[0068] 8. Carefully discard the supernatant, remove the centrifuge tube from the magnetic rack, add 1 mL of washing solution, and vortex to resuspend the nanomagnetic beads. After a short centrifugation, place it on the magnetic rack and let it stand for 2 minutes until the solution in the tube is clear.

[0069] 9. Carefully discard the supernatant, remove the centrifuge tube from the magnetic rack, add 1 mL of freshly prepared secondary washing solution, and vortex to resuspend the nanomagnetic beads. After a short centrifugation, place it on the magnetic rack and let it stand for 2 minutes until the solution in the tube is clear.

[0070] 10. Carefully discard the supernatant including the residual liquid at the bottom of the tube, place the centrifuge tube on the magnetic rack, open the lid for 3 minutes and let it dry at room temperature.

[0071] 11. Remove the centrifuge tube from the magnetic rack, add 45 μL of elution buffer, shake the centrifuge tube thoroughly to resuspend the nanomagnetic beads, and let it stand at room temperature for 5 minutes.

[0072] 12. After briefly centrifuging the centrifuge tube, place it on a magnetic rack for 2 minutes to allow the solution in the tube to clarify. Collect 43 μL of supernatant (cfDNA) and store it in another clean centrifuge tube.

[0073] 13. Take 1 μL of cfDNA and use Qubit to measure the concentration of cfDNA. The concentrations of cfDNA of 24 cases are shown in Table 3.

[0074] Table 3 Qubit assay results of free DNA concentration in 24 plasma samples

[0075]

[0076]

[0077] 4. Library Construction and High-Throughput Sequencing

[0078] DNA denaturation

[0079] 1. Take 30 ng of cfDNA sample and place it in a 0.2 mL low-adsorption centrifuge tube and make up to 30 μL with 0.1X TE.

[0080] 2. Mix well, centrifuge briefly, put into PCR instrument, and start the following PCR program: 95℃, 2min; 25℃, ∞.

[0081] Hybridization reaction

[0082] 1. Take out the PCR tube from the PCR instrument and add 1.5 μL of hybridization buffer, 0.75 μL of ligation probe and 0.75 μL of blocking probe to the PCR tube.

[0083] 2. Mix well, centrifuge briefly, put into PCR instrument, and start the following PCR program: 95℃, 30s; 60℃, 16h; 60℃, ∞.

[0084] Ligation reaction

[0085] 1. Prepare the ligation mixture in a new centrifuge tube, and add 3 μL ligation buffer A, 3 μL ligation buffer B and 1 μL ligase-65 to each reaction.

[0086] 2. Mix the centrifuge tube evenly and centrifuge it instantly. Keep the PCR tube on the PCR instrument, lower the temperature of the PCR instrument to 54°C, open the PCR tube cover, and add 7μL of the prepared ligation mixture.

[0087] 3. Use a pipette to pipette the ligation reaction solution in the PCR tube to mix well, and adjust the PCR instrument to enter the ligation reaction program: 54℃, 15min; 98℃, 5min; 4℃, hold.

[0088] PCR amplification

[0089] 1. After the ligation reaction is completed, add 25μL 2X HiFi PCR Master Mix, 5μL UDI index and 20μL of the above ligation product to a new PCR tube. Use different UDI indexes for different samples.

[0090] 2. Mix well, centrifuge briefly, put into PCR instrument, and start the following PCR program: 98℃, 2min; (98℃, 15sec; 60℃, 30sec; 72℃, 30sec)X 30cycles; 72℃, 2min; 4℃, hold.

[0091] Library purification

[0092] 1. Add 60 μL of Ampure XP Beads pre-equilibrated to room temperature to the PCR tube containing the amplified product, mix well, and incubate at 25°C for 5 minutes.

[0093] 2. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0094] 3. Slowly add 200 μL of freshly prepared 80% ethanol along the wall of the centrifuge tube, let it stand for 30 seconds, and use a pipette to discard the supernatant.

[0095] 4. Repeat the above steps once.

[0096] 5. Place the centrifuge tube on the magnetic rack and use a 10μL pipette to remove a small amount of residual ethanol, being careful not to absorb the magnetic beads.

[0097] 6. Dry the magnetic beads at room temperature for 2-5 minutes until the ethanol evaporates completely.

[0098] 7. Remove the PCR tube, add 21 μL TE Solution to the PCR tube, suspend and mix the magnetic beads, and incubate at 25°C for 5 minutes.

[0099] 8. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to carefully transfer 20 μL of supernatant to a new 0.2 mL PCR tube for storage.

[0100] High-throughput sequencing

[0101] After the DNA library passed QC, 2x150bp paired-end sequencing was performed on the Illumina NovaSeq 6000 high-throughput sequencing platform, with an average sequencing depth of 1000X.

[0102] 5. Bioinformatics Data Analysis

[0103] The raw data generated by NovaSeq was removed from the machine, low-quality data was filtered, and the genome reference was compared to identify the genetic variation of the target site. The test results of the standard and plasma samples are shown in Table 4 and Table 5, respectively.

[0104] Table 4 Results of 3 repeated tests of 4 standards with known mutation frequencies

[0105]

[0106] Note: + indicates that the test result of the site is positive, - indicates that the test result of the site is negative.

[0107] Table 5 Plasma sample test results

[0108]

[0109] From the results in Table 4, it can be seen that this protocol can stably detect SNVs and INDELs with a mutation frequency as low as 0.1% for 30 ng of cfDNA standard, with a sensitivity and specificity of 100%.

[0110] As can be seen from the data in Table 5, 24 plasma samples were tested using both DPL and control techniques. For 23 of the samples, the results of the two methods were completely consistent, including 10 wild-type and 13 variants. For one sample, sample No. 6, the control technique detected EGFR L858R; in addition to detecting the EGFR L858R mutation, the DPL technique of the present invention also detected the EGFR G719A mutation. We used digital PCR technology to verify the G719A site of this sample. The digital PCR results showed that the mutation frequency of G719A was 0.12%.

[0111] The above results show that the present invention only requires an average low sequencing depth of 1000X to stably detect gene mutations with a mutation frequency as low as 0.1%.

[0112] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention. Sequence Listing <110> Shanghai Pulmonary Hospital, Yuer Gene Technology (Suzhou) Co., Ltd., Shanghai Yuer Gene Technology Co., Ltd. <120> A nucleotide composition for detecting gene variation and a high-throughput sequencing library constructed therefrom <160> 96 <170> SIPOSequenceListing 1.0 <210> 1 <211> 49 <212> DNA <213> (Artificial sequence) <400> 1 ctacacgacg ctcttccgat ctgcatgtca agatcacaga ttttgggcg 49 <210> 2 <211> 44 <212> DNA <213> (Artificial sequence) <400> 2 ctacacgacg ctcttccgat ctcctccacc gtgcagctca tcat 44 <210> 3 <211> 52 <212> DNA <213> (Artificial sequence) <400> 3 ctacacgacg ctcttccgat cttgagaaag ttaaaattcc cgtcgctatc aa 52 <210> 4 <211> 43 <212> DNA <213> (Artificial sequence) <400> 4 ctacacgacg ctcttccgat ctagcctacg tgattggcca gcg 43 <210> 5 <211> 50 <212> DNA <213> (Artificial sequence) <400> 5 ctacacgacg ctcttccgat ctctgaattc aaaaagatca aagtgctggc 50 <210> 6 <211> 42 <212> DNA <213> (Artificial sequence) <400> 6 ctacacgacg ctcttccgat ctggcactct tgcctacgcc at 42 <210> 7 <211> 47 <212> DNA <213> (Artificial sequence) <400> 7 ctacacgacg ctcttccgat ctgtccctca ttgcactgta ctcctcg 47 <210> 8 <211> 50 <212> DNA <213> (Artificial sequence) <400> 8 ctacacgacg ctcttccgat ctcagtgtta cttacctgtc ttgtctttgc 50 <210> 9 <211> 47 <212> DNA <213> (Artificial sequence) <400> 9 ctacacgacg ctcttccgat cttgggaccc actccatcga gatttct 47 <210> 10 <211> 49 <212> DNA <213> (Artificial sequence) <400> 10 ctacacgacg ctcttccgat ctgtagactg ttccaaatga tccagatct 49 <210> 11 <211> 42 <212> DNA <213> (Artificial sequence) <400> 11 ctacacgacg ctcttccgat cttgcgcttt tcccaacacc at 42 <210> 12 <211> 50 <212> DNA <213> (Artificial sequence) <400> 12 ctacacgacg ctcttccgat ctggtctctc atggcactgt actcttcttt 50 <210> 13 <211> 49 <212> DNA <213> (Artificial sequence) <400> 13 ctacacgacg ctcttccgat ctcacgagat cctctctctg aaatcacta 49 <210> 14 <211> 54 <212> DNA <213> (Artificial sequence) <400> 14 ctacacgacg ctcttccgat ctgagtattt catgaaacaa atgaatgatg cacg 54 <210> 15 <211> 46 <212> DNA <213> (Artificial sequence) <400> 15 ctacacgacg ctcttccgat ctaattccag tggccatcaa agtgtc 46 <210> 16 <211> 48 <212> DNA <213> (Artificial sequence) <400> 16 ctacacgacg ctcttccgat ctcatacgtg atggctatac gtgatggc 48 <210> 17 <211> 48 <212> DNA <213> (Artificial sequence) <400> 17 ctacacgacg ctcttccgat ctgactaccg agctactttt ccagaagt 48 <210> 18 <211> 46 <212> DNA <213> (Artificial sequence) <400> 18 ctacacgacg ctcttccgat ctttgctgat tttggtcttg ccagaa 46 <210> 19 <211> 45 <212> DNA <213> (Artificial sequence) <400> 19 ctacacgacg ctcttccgat ctggccgcca ggtcttgatg tactt 45 <210> 20 <211> 51 <212> DNA <213> (Artificial sequence) <400> 20 ctacacgacg ctcttccgat ctgctttacg caaataagta agaaggtctc t 51 <210> twenty one <211> 40 <212> DNA <213> (Artificial sequence) <400> twenty one ctacacgacg ctcttccgat ctccccgcca tgagctccat 40 <210> twenty two <211> 45 <212> DNA <213> (Artificial sequence) <400> twenty two ctacacgacg ctcttccgat ctatccagtt cgtcctgttc agagt 45 <210> twenty three <211> 46 <212> DNA <213> (Artificial sequence) <400> twenty three ctacacgacg ctcttccgat cttcactttg actcaccggt ggatgc 46 <210> twenty four <211> 47 <212> DNA <213> (Artificial sequence) <400> twenty four ctacacgacg ctcttccgat ctatggtctt tgagtatatg cggcaca 47 <210> 25 <211> 51 <212> DNA <213> (Artificial sequence) <400> 25 ctacacgacg ctcttccgat ctgcttacct gaggaactta ttcaggtctc t 51 <210> 26 <211> 44 <212> DNA <213> (Artificial sequence) <400> 26 ctacacgacg ctcttccgat ctctcccagg acaggcacaa acat 44 <210> 27 <211> 44 <212> DNA <213> (Artificial sequence) <400> 27 ctacacgacg ctcttccgat ctatgatggt gaggatgggc ctct 44 <210> 28 <211> 42 <212> DNA <213> (Artificial sequence) <400> 28 ctacacgacg ctcttccgat ctggctcata gggcaccacc at 42 <210> 29 <211> 40 <212> DNA <213> (Artificial sequence) <400> 29 ctacacgacg ctcttccgat ctgctcatgg tggggggcagt 40 <210> 30 <211> 45 <212> DNA <213> (Artificial sequence) <400> 30 ctacacgacg ctcttccgat ctagggcaag ttcactacag caaga 45 <210> 31 <211> 44 <212> DNA <213> (Artificial sequence) <400> 31 ctacacgacg ctcttccgat ctgccttgag gcctttctta cccc 44 <210> 32 <211> 45 <212> DNA <213> (Artificial sequence) <400> 32 ctacacgacg ctcttccgat ctctccaatt caggacccac acgat 45 <210> 33 <211> 43 <212> DNA <213> (Artificial sequence) <400> 33 ggccaaactg ctgggtgcgg agatcggaag agcacacgtc tga 43 <210> 34 <211> 43 <212> DNA <213> (Artificial sequence) <400> 34 gcagctcatg cccttcggct agatcggaag agcacacgtc tga 43 <210> 35 <211> 48 <212> DNA <213> (Artificial sequence) <400> 35 aacatctccg aaagccaaca aggaaagatc ggaagagcac acgtctga 48 <210> 36 <211> 43 <212> DNA <213> (Artificial sequence) <400> 36 ggccagcgtg gacaaccccc agatcggaag agcacacgtc tga 43 <210> 37 <211> 41 <212> DNA <213> (Artificial Sequence) <400> 37 ctccggtgcg ttcggcacag atcggaagag cacacgtctg a 41 <210> 38 <211> 51 <212> DNA <213> (Artificial Sequence) <400> 38 cagctccaac taccacaagt ttatattcag atcggaagag cacacgtctg a 51 <210> 39 <211> 49 <212> DNA <213> (Artificial Sequence) <400> 39 tgacctgctg tgtcgagaat atccaaagat cggaagagca cacgtctga 49 <210> 40 <211> 55 <212> DNA <213> (Artificial Sequence) <400> 40 tgatgtttca ataaaaggaa ttccataact tcagatcgga agagcacacg tctga 55 <210> 41 <211> 50 <212> DNA <213> (Artificial Sequence) <400> 41 ctgtagctag accaaaatca cctatttaga tcggaagagc acacgtctga 50 <210> 42 <211> 48 <212> DNA <213> (Artificial Sequence) <400> 42 aattctttgt cccactgtaa tctgcagatc ggaagagcac acgtctga 48 <210> 43 <211> 43 <212> DNA <213> (Artificial Sequence) <400> 43 ctgctccaac caccaccagt agatcggaag agcacacgtc tga 43 <210> 44 <211> 49 <212> DNA <213> (Artificial Sequence) <400> 44 tccagctgta tccagtatgt ccaacaagat cggaagagca cacgtctga 49 <210> 45 <211> 52 <212> DNA <213> (Artificial Sequence) <400> 45 agcaggagaa agattttcta tggagtcaca gatcggaaga gcacacgtct ga 52 <210> 46 <211> 48 <212> DNA <213> (Artificial Sequence) <400> 46 tcatggtggc tggacaacaa aaatgagatc ggaagagcac acgtctga 48 <210> 47 <211> 47 <212> DNA <213> (Artificial Sequence) <400> 47 gagggaaaac acatccccca aagcagatcg gaagagcaca cgtctga 47 <210> 48 <211> 46 <212> DNA <213> (Artificial Sequence) <400> 48 ggtgtgggct ccccatatgt ctcagatcgg aagagcacac gtctga 46 <210> 49 <211> 56 <212> DNA <213> (Artificial Sequence) <400> 49 tatatttcag tttattgttc tgagaaatac ctaagatcgg aagagcacac gtctga 56 <210> 50 <211> 58 <212> DNA <213> (Artificial Sequence) <400> 50 acatgtatga taaagaatac tatagtgtac acaacagatc ggaagagcac acgtctga 58 <210> 51 <211> 43 <212> DNA <213> (Artificial Sequence) <400> 51 ccctacagac gtgcgggtgg agatcggaag agcacacgtc tga 43 <210> 52 <211> 51 <212> DNA <213> (Artificial Sequence) <400> 52 tccctccatc agttccagga taatgtatag atcggaagag cacacgtctg a 51 <210> 53 <211> 42 <212> DNA <213> (Artificial Sequence) <400> 53 caggatgaac cggggcagga gatcggaaga gcacacgtct ga 42 <210> 54 <211> 43 <212> DNA <213> (Artificial Sequence) <400> 54 acacttcagg cagcgtctgg agatcggaag agcacacgtc tga 43 <210> 55 <211> 50 <212> DNA <213> (Artificial Sequence) <400> 55 agtggttttc ctccaaatac tgacagcaga tcggaagagc acacgtctga 50 <210> 56 <211> 44 <212> DNA <213> (Artificial Sequence) <400> 56 gggacctcaa ccgcttcctc cagatcggaa gagcacacgt ctga 44 <210> 57 <211> 53 <212> DNA <213> (Artificial Sequence) <400> 57 atgcttcatg tattcaaaga ccatgatgag agatcggaag agcacacgtc tga 53 <210> 58 <211> 45 <212> DNA <213> (Artificial Sequence) <400> 58 gcacctcaaa gctgttccgt ccagatcgga agagcacacg tctga 45 <210> 59 <211> 43 <212> DNA <213> (Artificial sequence) <400> 59 ggttcatgcc gcccatgcag agatcggaag agcacacgtc tga 43 <210> 60 <211> 50 <212> DNA <213> (Artificial sequence) <400> 60 actatgtcga aaagtgtttc tgtcatcaga tcggaagagc acacgtctga 50 <210> 61 <211> 45 <212> DNA <213> (Artificial sequence) <400> 61 gcctcacaac ctccgtcatg tgagatcgga agagcacacg tctga 45 <210> 62 <211> 43 <212> DNA <213> (Artificial sequence) <400> 62 gatgtgtggg cctttggggt agatcggaag agcacacgtc tga 43 <210> 63 <211> 46 <212> DNA <213> (Artificial sequence) <400> 63 gaagcagaag gtgggagaac tgaagatcgg aagagcacac gtctga 46 <210> 64 <211> 50 <212> DNA <213> (Artificial sequence) <400> 64 gggaagacaa gttcatgtac tttgagtaga tcggaagagc acacgtctga 50 <210> 65 <211> twenty three <212> DNA <213> (Artificial sequence) <400> 65 cagattttgg gctggccaaa ctg 23 <210> 66 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 66 cagctcatca cgcagctcat gc 22 <210> 67 <211> 29 <212> DNA <213> (Artificial sequence) <400> 67 ggaattaagagaagcaacatctccgaaag 29 <210> 68 <211> 20 <212> DNA <213> (Artificial sequence) <400> 68 cctacgtgat ggccagcgtg 20 <210> 69 <211> 18 <212> DNA <213> (Artificial sequence) <400> 69 aagtgctggg ctccggtg 18 <210> 70 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 70 ctacgccacc agctccaact ac 22 <210> 71 <211> 25 <212> DNA <213> (Artificial sequence) <400> 71 actgtactcc tcttgacctg ctgtg 25 <210> 72 <211> 30 <212> DNA <213> (Artificial sequence) <400> 72 cctgtcttgt ctttgctgat gtttcaataa 30 <210> 73 <211> 27 <212> DNA <213> (Artificial sequence) <400> 73 ccatcgagatttcactgtagctagacc 27 <210> 74 <211> 26 <212> DNA <213> (Artificial sequence) <400> 74 atgatccaga tccaattctt tgtccc 26 <210> 75 <211> 20 <212> DNA <213> (Artificial sequence) <400> 75 ccaacaccac ctgctccaac 20 <210> 76 <211> 28 <212> DNA <213> (Artificial sequence) <400> 76 actgtactct tcttgtccag ctgtatcc 28 <210> 77 <211> 27 <212> DNA <213> (Artificial sequence) <400> 77 ctctgaaatc actgagcagg agaaaga 27 <210> 78 <211> 25 <212> DNA <213> (Artificial sequence) <400> 78 tgaatgatgc acatcatggt ggctg 25 <210> 79 <211> 27 <212> DNA <213> (Artificial sequence) <400> 79 gccatcaaag tgttgaggga aaacaca 27 <210> 80 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 80 tacgtgatgg ctggtgtggg ct 22 <210> 81 <211> 30 <212> DNA <213> (Artificial sequence) <400> 81 cttttccaga aggtatattt cagtttattg 30 <210> 82 <211> 27 <212> DNA <213> (Artificial sequence) <400> 82 gtcttgccag agacatgtat gataaag 27 <210> 83 <211> 25 <212> DNA <213> (Artificial sequence) <400> 83 gtcttgatgt actcccctac agacg 25 <210> 84 <211> 25 <212> DNA <213> (Artificial sequence) <400> 84 taagaaggtc tcctccctcc atcag 25 <210> 85 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 85 atgagctcca gcaggatgaa cc 22 <210> 86 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 86 ctgttcagag cacacttcag gc 22 <210> 87 <211> twenty three <212> DNA <213> (Artificial sequence) <400> 87 accggtggat gaagtggttt tcc 23 <210> 88 <211> twenty three <212> DNA <213> (Artificial sequence) <400> 88 tatatgcggc acggggacct caa 23 <210> 89 <211> 30 <212> DNA <213> (Artificial sequence) <400> 89 cttattcagg tctccatgct tcatgtattc 30 <210> 90 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 90 ggcacaaaca cgcacctcaa ag 22 <210> 91 <211> 19 <212> DNA <213> (Artificial sequence) <400> 91 tgggcctccg gttcatgcc 19 <210> 92 <211> twenty four <212> DNA <213> (Artificial sequence) <400> 92 gcaccaccac actatgtcga aaag 24 <210> 93 <211> 18 <212> DNA <213> (Artificial sequence) <400> 93 ggggcagcgc ctcacaac 18 <210> 94 <211> twenty two <212> DNA <213> (Artificial sequence) <400> 94 ctacagcaag tgatgtgtgg gc 22 <210> 95 <211> 25 <212> DNA <213> (Artificial sequence) <400> 95 ctttcttacc cagaagcaga aggtg 25 <210> 96 <211> 20 <212> DNA <213> (Artificial sequence) <400> 96 cccacacgac gggaagacaa 20

Claims

1. Use of a nucleotide composition in preparing a product for detecting gene variation, characterized in that: The nucleotide composition is used to detect a variation in a target template, wherein there is at least one base variation between the target template and the non-target template, and the nucleotide composition comprises a blocking probe, a ligation probe 1 and a ligation probe 2, wherein: the blocking probe can specifically bind to the non-target template; the ligation probe 1 and the ligation probe 2 are not connected, can specifically bind to the target template respectively, and are respectively located in the downstream complementary region and the upstream complementary region of the target template variation site, and the base complementary to the target template variation site is located on the ligation probe 1 or the ligation probe 2; the nucleotide composition is used to detect a variation in the gene EGFR, KRAS, BRAF, NRAS, PIK3CA, HER2, MET, AKT1, ROS1, ALK, NTRK1, NTRK3, TP53, DDR2, MAP2K1 or PTEN; The ligation probe 1 is selected from one or more of the sequences shown in SEQ ID NO.1-32, the ligation probe 2 is selected from one or more of the sequences shown in SEQ ID NO.33-64, and the blocking probe is selected from one or more of the sequences shown in SEQ ID NO.65-96; The application is: S1. Denaturing the sample DNA to be tested; wherein the sample DNA to be tested is cfDNA; S2, adding hybridization buffer, ligation probe 1, ligation probe 2 and blocking probe to the denatured sample DNA to be tested, mixing evenly and then performing hybridization to obtain a hybridization mixture; S3, mix the ligation buffer and DNA ligase evenly, add them to the hybridization mixture in S2, mix well, and perform ligation reaction; S4, mixing the UDI index and the connection product of S3 evenly, performing PCR reaction, purifying the PCR amplification product, and obtaining a sequencing library; S5, sequencing the sequencing library of S4 to obtain variation information; wherein the sequencing depth is 100X-1000X; When the ligation probe 1 is the sequence shown in SEQ ID NO.1, the sequence of the ligation probe 2 is shown in SEQ ID NO.33, and the sequence of the blocking probe is shown in SEQ ID NO.65; When the ligation probe 1 is the sequence shown in SEQ ID NO.2, the sequence of the ligation probe 2 is shown in SEQ ID NO.34, and the sequence of the blocking probe is shown in SEQ ID NO.66; When the ligation probe 1 is the sequence shown in SEQ ID NO.3, the sequence of the ligation probe 2 is shown in SEQ ID NO.35, and the sequence of the blocking probe is shown in SEQ ID NO.67; When the ligation probe 1 is the sequence shown in SEQ ID NO.4, the sequence of the ligation probe 2 is shown in SEQ ID NO.36, and the sequence of the blocking probe is shown in SEQ ID NO.68; When the ligation probe 1 is the sequence shown in SEQ ID NO.5, the sequence of the ligation probe 2 is shown in SEQ ID NO.37, and the sequence of the blocking probe is shown in SEQ ID NO.69; When the ligation probe 1 is the sequence shown in SEQ ID NO.6, the sequence of the ligation probe 2 is shown in SEQ ID NO.38, and the sequence of the blocking probe is shown in SEQ ID NO.70; When the ligation probe 1 is the sequence shown in SEQ ID NO.7, the sequence of the ligation probe 2 is shown in SEQ ID NO.39, and the sequence of the blocking probe is shown in SEQ ID NO.71; When the ligation probe 1 is the sequence shown in SEQ ID NO.8, the sequence of the ligation probe 2 is shown in SEQ ID NO.40, and the sequence of the blocking probe is shown in SEQ ID NO.72; When the ligation probe 1 is the sequence shown in SEQ ID NO.9, the sequence of the ligation probe 2 is shown in SEQ ID NO.41, and the sequence of the blocking probe is shown in SEQ ID NO.73; When the ligation probe 1 is the sequence shown in SEQ ID NO.10, the sequence of the ligation probe 2 is shown in SEQ ID NO.42, and the sequence of the blocking probe is shown in SEQ ID NO.74; When the ligation probe 1 is the sequence shown in SEQ ID NO.11, the sequence of the ligation probe 2 is shown in SEQ ID NO.43, and the sequence of the blocking probe is shown in SEQ ID NO.75; When the ligation probe 1 is the sequence shown in SEQ ID NO.12, the sequence of the ligation probe 2 is shown in SEQ ID NO.44, and the sequence of the blocking probe is shown in SEQ ID NO.76; When the ligation probe 1 is the sequence shown in SEQ ID NO.13, the sequence of the ligation probe 2 is shown in SEQ ID NO.45, and the sequence of the blocking probe is shown in SEQ ID NO.77; When the ligation probe 1 is the sequence shown in SEQ ID NO.14, the sequence of the ligation probe 2 is shown in SEQ ID NO.46, and the sequence of the blocking probe is shown in SEQ ID NO.78; When the ligation probe 1 is the sequence shown in SEQ ID NO.15, the sequence of the ligation probe 2 is shown in SEQ ID NO.47, and the sequence of the blocking probe is shown in SEQ ID NO.79; When the ligation probe 1 is the sequence shown in SEQ ID NO.16, the sequence of the ligation probe 2 is shown in SEQ ID NO.48, and the sequence of the blocking probe is shown in SEQ ID NO.80; When the ligation probe 1 is the sequence shown in SEQ ID NO.17, the sequence of the ligation probe 2 is shown in SEQ ID NO.49, and the sequence of the blocking probe is shown in SEQ ID NO.81; When the ligation probe 1 is the sequence shown in SEQ ID NO.18, the sequence of the ligation probe 2 is shown in SEQ ID NO.50, and the sequence of the blocking probe is shown in SEQ ID NO.82; When the ligation probe 1 is the sequence shown in SEQ ID NO.19, the sequence of the ligation probe 2 is shown in SEQ ID NO.51, and the sequence of the blocking probe is shown in SEQ ID NO.83; When the ligation probe 1 is the sequence shown in SEQ ID NO.20, the sequence of the ligation probe 2 is shown in SEQ ID NO.52, and the sequence of the blocking probe is shown in SEQ ID NO.84; When the ligation probe 1 is the sequence shown in SEQ ID NO.21, the sequence of the ligation probe 2 is shown in SEQ ID NO.53, and the sequence of the blocking probe is shown in SEQ ID NO.85; When the ligation probe 1 is the sequence shown in SEQ ID NO.22, the sequence of the ligation probe 2 is shown in SEQ ID NO.54, and the sequence of the blocking probe is shown in SEQ ID NO.86; When the ligation probe 1 is the sequence shown in SEQ ID NO.23, the sequence of the ligation probe 2 is shown in SEQ ID NO.55, and the sequence of the blocking probe is shown in SEQ ID NO.87; When the ligation probe 1 is the sequence shown in SEQ ID NO.24, the sequence of the ligation probe 2 is shown in SEQ ID NO.56, and the sequence of the blocking probe is shown in SEQ ID NO.88; When the ligation probe 1 is the sequence shown in SEQ ID NO.25, the sequence of the ligation probe 2 is shown in SEQ ID NO.57, and the sequence of the blocking probe is shown in SEQ ID NO.89; When the ligation probe 1 is the sequence shown in SEQ ID NO.26, the sequence of the ligation probe 2 is shown in SEQ ID NO.58, and the sequence of the blocking probe is shown in SEQ ID NO.90; When the ligation probe 1 is the sequence shown in SEQ ID NO.27, the sequence of the ligation probe 2 is shown in SEQ ID NO.59, and the sequence of the blocking probe is shown in SEQ ID NO.91; When the ligation probe 1 is the sequence shown in SEQ ID NO.28, the sequence of the ligation probe 2 is shown in SEQ ID NO.60, and the sequence of the blocking probe is shown in SEQ ID NO.92; When the ligation probe 1 is the sequence shown in SEQ ID NO.29, the sequence of the ligation probe 2 is shown in SEQ ID NO.61, and the sequence of the blocking probe is shown in SEQ ID NO.93; When the ligation probe 1 is the sequence shown in SEQ ID NO.30, the sequence of the ligation probe 2 is shown in SEQ ID NO.62, and the sequence of the blocking probe is shown in SEQ ID NO.94; When the ligation probe 1 is the sequence shown in SEQ ID NO.31, the sequence of the ligation probe 2 is shown in SEQ ID NO.63, and the sequence of the blocking probe is shown in SEQ ID NO.95; When the ligation probe 1 is the sequence shown in SEQ ID NO.32, the sequence of the ligation probe 2 is shown in SEQ ID NO.64, and the sequence of the blocking probe is shown in SEQ ID NO.

96.

2. The use according to claim 1, characterized in that: The base complementary to the variant site is located at the 3' end of ligation probe one or the 5' end of ligation probe two.

3. The use according to claim 1, characterized in that: The side of the ligation probe 1 and the ligation probe 2 away from the variation site carries a library adapter sequence.

4. The use according to claim 1, characterized in that: The 5' end of the ligation probe 2 contains a phosphate group.

5. The use according to claim 1, characterized in that: The product is a kit for detecting allele variation.

Images