SNP (Single Nucleotide Polymorphism) molecular marker primer combination for molecular identification of areca catechu germplasm resources and application thereof

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker primer combination for molecular identification of soft fiber areca seed resources and application of the SNP molecular marker primer combination, and belongs to the technical field of SNP molecular markers. Genetic background correlation analysis of fruit fiber phenotypic characteristics is carried out based on constructed areca seed core germplasm resources, SNP molecular marker primers are developed according to areca seed fiber specific sites, and the SNP molecular marker primer development comprises four pairs of specific primers; the invention also provides a method for detecting the germplasm resource of the areca catechu by using the SNP molecular marker primer. The method can be used for rapidly and accurately detecting the genotype of the germplasm resource of the areca catechu at low cost and high throughput. The four pairs of specific primers can be used for identifying the germplasm resources of the soft-fiber areca catechu, and have important application significance on scientifically protecting the diversity of the germplasm resources of the areca catechu, researching genetic protection and genetic evolution of the areca catechu resources and genetic breeding of the areca catechu.

Description

Technical Field

[0001] The invention belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker primer combination and application thereof for molecular identification of soft fiber betel nut germplasm resources. Background Art

[0002] Betel nut (Areca catechu L.) is a perennial evergreen tree belonging to the genus Areca of the palm family. It ranks first among China's "Four Major Southern Medicines" and has the effects of reducing edema, opening up joints, strengthening the spleen and regulating the middle, and is a commonly used medicinal material in traditional Chinese medicine.

[0004] Traditional betel nut fiber phenotypic identification relies on breeders’ rich experience in investigation and cultivation, and is also easily affected by environmental and human factors. The identification results are prone to errors, and the efficiency of target gene selection is low. The basic research on betel nut germplasm resources is relatively weak, and there is a lack of systematic comparison and research on the diversity of germplasm resources. At present, the identification and evaluation of betel nut fiber is limited to sensory, physiological and biochemical measurements and texture characteristics (Kang Xiaoning, Wang Shiping, Dai Jiahui, Ma Jinshuang, Ji Jianbang, Wang Haican. Study on the dynamic changes of fruit morphology, texture and peel components during the growth period of betel nut. Fresh-keeping and processing), especially the molecular identification method of soft fiber betel nut germplasm resources has not been reported. With the emergence and utilization of molecular marker technology, its direct and convenient advantages have made the application value and prospects of this technology attract much attention. In the field of betel nut molecular breeding, it is of great significance to the evaluation and innovative utilization of betel nut germplasm resources by developing molecular markers closely linked to the target genes of betel nut fiber and developing their functional specific molecular markers to select the target genes for breeding. Summary of the invention

[0005] In view of the deficiencies of the above-mentioned prior art, the present invention provides a SNP molecular marker primer combination for molecular identification of soft fiber betel nut germplasm resources and its application. The SNP molecular marker primer combination is composed of 4 pairs of specific primers, which can be used to identify soft fiber betel nut germplasm resources and has guiding significance for the breeding of soft and hard fiber important quality betel nut and the screening of germplasm resources. The technical process of the present invention is as follows Figure 1 .

[0006] The specific technical solutions are as follows:

[0007] The first aspect of the present invention provides a SNP molecular marker primer combination for molecular identification of soft fiber betel nut germplasm resources, which consists of 4 pairs of specific primers. The nucleotide sequences of the 4 pairs of specific primers are as follows:

[0008] PA40374 upstream primer: TTAGGCTCAACCCTGAATGG;

[0009] PA40374 downstream primer: GGTGTCCACACCAATTCTCC;

[0010] PA40381 upstream primer: TGAAGATGTTTTTCCCGAGG;

[0011] PA40381 downstream primer: AGCTCTAAGCACCTGGGTCA;

[0012] PA40383 upstream primer: TGCCACTTAACGCAGACTTG;

[0013] PA40383 downstream primer: CAAGTCCCTGCCTACGGATA;

[0014] PA40688 upstream primer: AGTACCCACCATGCCACAAT;

[0015] PA40688 downstream primer: GATCCAAGGGAACAGATCCA.

[0016] The second aspect of the present invention provides an application process of the SNP molecular marker primer combination in the molecular identification of soft fiber betel nut germplasm resources, comprising the following steps:

[0017] (1) Extracting DNA from samples to be analyzed: Collecting betel nut leaves or betel nut fruits and extracting genomic DNA;

[0018] (2) PCR amplification reaction: using the above four pairs of specific primers to perform PCR amplification reaction on the genomic DNA in step (1);

[0019] (3) Detection of PCR amplification products: The PCR amplification products were electrophoresed on a 1.5% agarose gel containing 10% Goldview nucleic acid dye in 0.5× TBE buffer at 110 V for 40 min. The gel running results were photographed and recorded in a gel imaging system;

[0020] (4) Detection of PCR amplification products: The PCR amplification products are subjected to genome sequencing.

[0021] Furthermore, the PCR amplification reaction procedure described in step (2) is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; extension at 72°C for 5 min.

[0022] Furthermore, the PCR amplification reaction system described in step (2) is: 20 ng of betel nut genomic DNA, 2 μL of each of 5 pmol / μL upstream and downstream primers, 15 μL of 2×Taq PCR MasterMix, and ddH2O to make up the total volume to 30 μL.

[0023] Furthermore, the genome sequencing described in step (3) is conventional Sanger first generation sequencing.

[0024] Beneficial effects of the present invention:

[0025] The present invention conducts genetic background association analysis of fruit fiber phenotypic characteristics based on the constructed betel nut core germplasm resources, develops SNP molecular markers based on betel nut fiber specific sites, and develops 4 pairs of specific primers. The present invention also provides a method for detecting soft fiber betel nut germplasm resources using SNP molecular marker primers, which can detect the genotype of soft fiber betel nut germplasm resources quickly, accurately, at low cost, and with high throughput. The 4 pairs of specific primers of the present invention can be used to identify soft fiber betel nut germplasm resources, which has important application significance for scientifically protecting the diversity of betel nut germplasm resources, studying the genetic protection and genetic evolution of betel nut resources, and betel nut genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a technical process step diagram of the present invention;

[0027] Figure 2 Manhattan plot of genome-wide association analysis of traits and variant loci for the MLM model;

[0028] Figure 3 This is the gel imaging image of the detection of betel nut PCR amplification product;

[0029] Figure 4 The sequence alignment and SNP typing results of primer sequencing of PA40374, a: FMHF; b: other 20 materials;

[0030] Figure 5 The sequence alignment and SNP typing results of PA40381 primer sequencing, a: sample with low elasticity; b: sample with high elasticity;

[0031] Figure 6 The sequence alignment and SNP typing results of PA40383 primer sequencing, a: low hardness sample; b: high hardness sample;

[0032] Figure 7 The PA40688 primer sequencing sequence alignment and SNP typing results, a: sample with low protopectin content; b: sample with high protopectin content.

[0033] Table 1 Analysis of phenotypic traits of betel nut fiber DETAILED DESCRIPTION

[0034] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0035] Example 1 Development of SNP molecular marker specific primers

[0036] (1) Evaluation of betel nut phenotypic traits: The fiber phenotypic traits of 235 betel nut fruits were analyzed (Table 1);

[0037] (2) Evaluation of the population structure and genetic diversity of betel nut: Based on the SLAF simplified genome sequencing technology, the constructed betel nut germplasm resource population was sequenced to obtain SNP markers;

[0038] (3) GWAS analysis of the genetic background of betel nut fruit fiber traits: Based on the association analysis between the betel nut fruit fiber phenotypic traits in the above step (1) and the SNP markers obtained in step (2), the SNP loci significantly associated with the fruit fiber traits were obtained;

[0039] (4) Development of specific primers ( Figure 2 ): Based on the SNP sites significantly associated with the fruit fiber traits in step (3) above, 4 pairs of primers with high specificity and polymorphism were designed and screened. The nucleotide sequences of the 4 pairs of primers are as follows:

[0040] PA40374 upstream primer: TTAGGCTCAACCCTGAATGG;

[0041] PA40374 downstream primer: GGTGTCCACACCAATTCTCC;

[0042] PA40381 upstream primer: TGAAGATGTTTTTCCCGAGG;

[0043] PA40381 downstream primer: AGCTCTAAGCACCTGGGTCA;

[0044] PA40383 upstream primer: TGCCACTTAACGCAGACTTG;

[0045] PA40383 downstream primer: CAAGTCCCTGCCTACGGATA;

[0046] PA40688 upstream primer: AGTACCCACCATGCCACAAT;

[0047] PA40688 downstream primer: GATCCAAGGGAACAGATCCA.

[0048] Table 1 Phenotypic characteristics of fiber of 235 betel nut fruits

[0049]

[0050]

[0051]

[0052]

[0053]

[0054] Example 2 Application of molecular identification of important qualities of betel nut germplasm resources fruit fiber

[0055] (1) Collect different types of betel nut germplasm resources from different regions as experimental materials for the verification of SNP molecular markers;

[0056] (2) Extracting DNA from samples to be analyzed: The total DNA of the betel nut samples of the experimental materials mentioned above was extracted using the modified CTAB method;

[0057] (3) PCR amplification was performed using the four pairs of specific primers obtained in Example 1:

[0058] PCR amplification reaction: using the DNA of 21 samples of betel nut samples BDKP, BSDF, BSMQ, etc. extracted in step (2) as amplification template, and using the 4 pairs of specific primers developed in step (3) as amplification primers, PCR amplification was performed. The PCR reaction system: 20 ng of betel nut genomic DNA, 2 μL of each of 5 pmol / μL upstream and downstream primers, 15 μL of 2×Taq PCR Master Mix, and ddH2O to make up the total volume to 30 μL. The PCR reaction amplification program was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 30 sec, and 35 cycles; 72°C extension for 5 min, and storage at 4°C.

[0059] (4) Detection of PCR amplification products: The PCR amplification products were electrophoresed using 10% Goldview nucleic acid dye and 1.5% agarose gel in 0.5×TBE buffer at 110 V for 40 min. The gel running results were photographed and recorded in a gel imaging system;

[0060] (5) Detection of PCR amplification products: The PCR amplification products were subjected to conventional Sanger sequencing to determine the gene polymorphism sites based on the nucleotide sequence information at the corresponding positions.

[0061] Verification results of 4 pairs of specific primers: Figure 3 The PCR amplification products of some betel nut samples were used to verify the results of the four pairs of specific primers. The results showed that the four pairs of specific primers developed were suitable for identifying soft fiber betel nut germplasm resources.

[0062] The results of the 4 pairs of specific primers are as follows:

[0063] The sequencing sequence alignment and SNP typing results of the PA40374 primer pair showed that the cellulose content of the betel nut fiber index was significant in the sample FMHF. In the sequencing results of the PA40374 primer pair, there were 7 SNP sites. The PA40374 primer pair sequencing showed abundant polymorphic sites, so it can be used as a sequencing specific primer for low cellulose content ( Figure 4 ).

[0064] The sequencing sequence comparison and SNP typing results of the PA40381 primer pair showed that the PA40381 primer pair could detect the elastic strength of the betel nut fiber index lower than 3.39N / mm 2 The sample can detect 71.43%, so it can be used as a specific primer to detect the elasticity index of betel nut ( Figure 5 ).

[0065] The sequencing sequence comparison and SNP typing results of the PA40383 primer pair showed that the PA40383 primer pair could detect samples with a hardness of 249.7N lower than that of the betel nut fiber index, and the number of samples that could be detected reached 95.24%, so it can be used as a specific primer for detecting the hardness index of betel nut ( Figure 6 ).

[0066] The sequencing sequence comparison and SNP typing results of the PA40688 primer pair showed that the PA40688 primer pair could detect the protopectin content of the betel nut fiber indicator lower than 15.77%, and the detectable amount reached 76.19%, so it can be used as a specific primer for detecting the protopectin content of the betel nut fiber indicator ( Figure 7 ).

[0067] The present invention uses specific embodiments to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the specific implementation methods and application scope. In summary, the content of this specification should not be understood as a limitation on the present invention.

Claims

1. The SNP molecular marker primer combination for molecular identification of soft fiber betel nut germplasm resources consists of 4 pairs of specific primers, and the nucleotide sequences of the 4 pairs of specific primers are as follows: PA40374 upstream primer: TTAGGCTCAACCCTGAATGG; PA40374 downstream primer: GGTGTCCACACCAATTCTCC; PA40381 upstream primer: TGAAGATGTTTTTCCCGAGG; PA40381 downstream primer: AGCTCTAAGCACCTGGGTCA; PA40383 upstream primer: TGCCACTTAACGCAGACTTG; PA40383 downstream primer: CAAGTCCCTGCCTACGGATA; PA40688 upstream primer: AGTACCCACCATGCCACAAT; PA40688 downstream primer: GATCCAAGGGAACAGATCCA.

2. The application process of the SNP molecular marker primer combination described in claim 1 in the molecular identification of soft fiber betel nut germplasm resources comprises the following steps: (1) Extracting DNA from samples to be analyzed: Collecting betel nut leaves or betel nut fruits and extracting genomic DNA; (2) PCR amplification reaction: using the four pairs of specific primers of claim 1 to perform PCR amplification reaction on the genomic DNA in step (1); (3) Detection of PCR amplification products: The PCR amplification products were electrophoresed on a 1.5% agarose gel containing 10% Goldview nucleic acid dye in 0.5× TBE buffer at 110 V for 40 min. The gel running results were photographed and recorded in a gel imaging system; (4) Detection of PCR amplification products: The PCR amplification products are subjected to genome sequencing.

3. The use according to claim 2, characterized in that: The PCR amplification reaction procedure described in step (2) is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; extension at 72°C for 5 min.

4. The use according to claim 2, characterized in that: The PCR amplification reaction system described in step (2) is: 20 ng of betel nut genomic DNA, 2 μL of 5 pmol / μL upstream and downstream primers, 15 μL of 2×Taq PCR Master Mix, and ddH2O to make up the total volume to 30 μL.

5. The use according to claim 2, characterized in that: The genome sequencing described in step (3) is conventional Sanger first generation sequencing.

Images