Application of pore protein PorA in improving ammonia nitrogen utilization capacity of methane-oxidizing bacteria

Abstract

The invention discloses an application of pore protein PorA in improving ammonia nitrogen utilization capacity of methane-oxidizing bacteria. The amino acid sequence of the pore protein PorA is as shown in SEQ ID NO. 1. The nucleotide sequence of the coding gene porA of the pore protein PorA is as shown in SEQ ID NO. 2. The invention also relates to an application of the pore protein PorA in the aspect of improving the utilization capability of Methyluvimicrobium burylate ammonium nitrogen, and particularly relates to an application of the pore protein PorA in the aspect of improving the utilization capability of Methyluvimicrobium burylate ammonium nitrogen. The porous protein is inactivated, so that the methane-oxidizing bacterium Methyluvimicrobiuretic can grow by utilizing ammonium nitrogen, the cost of fermenting and culturing the bacterium is reduced, and the porous protein has important significance on industrial application of the bacterium.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for improving the ammonia nitrogen utilization ability of methane oxidizing bacteria Methylotuvimicrobiumburyatense and application thereof. Background Art

[0002] Methane-oxidizing bacteria can grow with methane as the only carbon source and energy source. They are widely distributed in wetlands, lakes, oceans and other environments, and play an important role in the earth's methane cycle. Since the last century, the role of this type of microorganism in methane bioconversion and methane pollution elimination has received much attention. Methane bioconversion refers to the use of methane-oxidizing bacteria to convert methane to produce products such as single-cell proteins, degradable plastics, carotenoids and ectoine. Methane pollution elimination is the use of methane-oxidizing bacteria to eliminate methane emissions from point sources such as landfills and sewage treatment systems, reducing the amount of methane entering the atmosphere.

[0003] Although there have been many commercial attempts at methane bioconversion and many engineering efforts at methane elimination, there is currently a lack of sustained success in both areas. The reason for this is that economy is one of the important limiting factors. One way to improve economy is to reduce the cost of large-scale cultivation of methane oxidizing bacteria. From the perspective of culture medium raw materials, the form of nitrogen source affects the fermentation cost. Since methane oxidizing bacteria are generally sensitive to ammonium nitrogen, nitrate nitrogen is usually used as the nitrogen source for the bacteria. However, in terms of price, potassium nitrate is about 5 times higher than ammonium chloride. If ammonium nitrogen can be used instead of nitrate nitrogen, the cultivation cost of methane oxidizing bacteria will be reduced.

[0004] Methylotuvimicrobium buryatense is a type of methane-oxidizing bacteria with industrial application value. This type of methane-oxidizing bacteria grows fast, is alkaliphilic, resistant to pollution, and resistant to impurities in natural gas (PNAS, 2023, https: / / doi.org / 10.1073 / pnas.2310046120). In recent years, this type of bacteria has been developed into an important model strain and a chassis host for metabolic engineering. However, this type of bacteria is very sensitive to ammonium nitrogen and can usually only be cultured with nitrate nitrogen. If this type of bacteria can make better use of ammonium nitrogen, it will reduce the cost of large-scale cultivation, which is of great significance for its industrial application.

[0005] The invention provides a method for improving the ammonia nitrogen utilization ability of methane oxidizing bacteria Methylotuvimicrobiumburyatense by inactivating porins and an application of the method in fermentation culture. Summary of the invention

[0006] Purpose of the invention: The present invention aims to solve the problem that methanotrophic bacteria Methylotuvimicrobium buryatense is sensitive to ammonium nitrogen. The present invention provides a method for improving its ammonia nitrogen utilization ability by inactivating porins and its application.

[0007] In order to solve the above technical problems, the present invention discloses the following technical solutions:

[0008] In a first aspect, the present invention discloses a porin PorA and a gene encoding the porin PorA that affects the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense.

[0009] Porin PorA, the amino acid sequence is shown in SEQ ID NO.1.

[0010] The pore protein PorA encoding gene porA has a nucleotide sequence as shown in SEQ ID NO.2.

[0011] In a second aspect, the present invention discloses the use of the porin PorA in improving the ammonium nitrogen utilization capacity of Methylotuvimicrobiumburyatense.

[0012] The inactivation of the porin PorA can improve the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense.

[0013] The inactivation of the porin PorA can be achieved by gene knockout, gene mutation or gene silencing of porA.

[0014] The gene encoding the porin PorA is used to improve the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense. The ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense is improved by gene knockout, gene mutation or gene silencing of porA.

[0015] The application of substances that achieve inactivation of porin PorA by gene knockout, gene mutation or gene silencing in improving the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense.

[0016] In summary, the present invention provides a method for improving the ammonia nitrogen utilization ability of methanotrophic bacteria Methylotuvimicrobiumburyatense by inactivating porins and its application.

[0017] Beneficial effects:

[0018] The invention discloses a porin affecting the efficiency of methanotrophic bacteria Methylotuvimicrobium buryatense in taking up ammonium ions. Inactivating the porin can make the methanotrophic bacteria Methylotuvimicrobium buryatense grow by utilizing ammonium nitrogen, thereby reducing the cost of fermenting and culturing the microorganism, which is of great significance for the industrial application of the microorganism. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0020] Figure 1 A method for screening 5GB1C mutants with stronger ammonia nitrogen utilization ability.

[0021] Figure 2 The growth ability of strains WT, △porA and △porA-Com using ammonium salt as nitrogen source was tested.

[0022] Figure 3 3D structural simulation of PorA.

[0023] Figure 4 The growth ability of strain △porA was tested in shake flasks with ammonium chloride addition.

[0024] Figure 5 The strain △porA was used to test the accumulation of harmful products in the ammonia nitrogen process. DETAILED DESCRIPTION

[0025] The invention firstly screens a methanotrophic bacterium Methylotuvimicrobium buryatense mutant capable of tolerating ammonium nitrogen by random transposon insertion mutation, and then determines the role of the porin gene porA by gene knockout and complementation experiments.

[0026] Example 1

[0027] like Figure 1As shown in the reference (AEM, 2013. https: / / doi:10.1128 / AEM.02478-13), the transposon random insertion library of strain Methylotuvimicrobium buryatense 5GBC1 was constructed using the pSC123 plasmid carrying the Himar1 mariner transposon. Methylotuvimicrobium buryatense 5GBC1 is a model strain of methanotrophic bacteria, and its source is reference (AEM, 2015. https: / / doi:10.1128 / AEM.03795-14). The mutants were spotted on NMS2 medium and NMS2N (NMS2+8mM NH 4 Cl) medium. The starting strain can only grow on NMS2 plates but not on NMS2N plates. A mutant that can grow on NMS2N was screened using this method and named 5G-P. Referring to the method in the reference (AEM, 2007, https: / / doi.org / 10.1128 / AEM.02973-06), the position of the transposon insertion in the mutant 5G-P was determined by the chromosome walking method, and the gene that was inserted and inactivated was named porA. Note that the mutant 5G-P can also be repeatedly obtained by genetic engineering means by the method of "Example 2".

[0028] Example 2

[0029] To verify that the inactivation of porA would improve the ability of strain 5GBC1 to utilize ammonium nitrogen, we used the pheS AG The marker-free knockout system for genes was used to knock out porA based on strain 5GBC1 to obtain strain ΔporA (Frontiers in Microbiology, 2020, https: / / doi.org / 10.3389 / fmicb.2020.00441). The specific steps are as follows: a 450-bp fragment downstream of the target region to be deleted is used as a direct repeat (DR) sequence and added to the front of the PZ box (the PZ box contains the tac promoter, RBSmmoX, and the synthetic pheS AGAnd zeo resistance gene). Then, the left and right homologous arms (LF, RF) were fused in the order of LF-DR-PZ-RF by overlapping PCR. After the fused DNA fragments were purified and recovered, they were transformed into 5GB1C competent cells by electroporation (Frontiers in Microbiology, 2020, https: / / do i.org / 10.3389 / fmicb.2020.00441). Transformants in which DR and PZ expression cassettes were successfully recombined into the target region were screened by bleomycin, and then the transformants obtained in the first step were reversely screened by p-Cl-Phe, and the scarless knockout strains were obtained by PCR identification. The fragment LF was amplified by primer LF-F (GCAGAAGAAGAACGGCAAAT) and primer LF-R (AAAAGGC GACACTTGGTTTTGAAAACGGCCTCAAA); the fragment DR was amplified by primer DR-F (AGGCCGTTTTCAAAACCAAG TGTCGCCTTTTTAAGTA) and primer DR-R (TGTCAACAGCTCATTTCAGAGTGAGTATAAAGGGAGTATGTCG), the fragment PZ was amplified by primer PZ-F (CTCTGAAATGAGCTGTTGACA) and primer PZ-R (TCAGTCCTGCTCCTCGGCCA C), and the fragment RF was amplified by primer RF-F (GTGGCCGAGGAGCAGGACTGACTAGAAACGAATGATCGCATC) and primer RF-R (TACGGCGTGGATGCTGCTTAT).

[0030] The low transcription site (160485) in the genome of 5GB1C was used as the integration site for porA complementation, and porA was further integrated into the chromosome of ΔporA by homologous double exchange to obtain the complementation strain ΔporA-Com. The specific steps are as follows: using the total DNA of strain 5GB1C as a template, the upstream and downstream homologous arms CLF and CRF of the complementation site and the porA gene fragment CPA containing the original promoter region were amplified, and pAWP89 was used as a template to amplify the kanamycin resistance gene fragment KAN (AEM, 2015, http: / / dx.doi.org / 10.1128). These four fragments were fused in the order of CLF, CPA, KAN, and CRF, and the recovered fragments were transferred into the competent cells of strain ΔporA by electroporation. The target strain was screened by kanamycin, and PCR and sequencing were performed to verify it. The fragment CLF was amplified by primers CLF-F (GGTGTCGATGGCATGCTCAA) and CLF-R (CA AGGCGAAGTTGAAGGCGC); the fragment CPA was amplified by primers CPA-F (GCGCCTTCAACTTCGCCTTGACCGTCGT GAACCCATTCAT) and CPA-R (TGCTCGATGAGTTTTTCTAACTAGAAACGAATGATCGCAT), the fragment KAN was amplified by primers KAN-F (TTAGAAAAACTCATCGAGCA) and KAN-R (CGCGTATAGCTTGCCGGAAG), and the fragment CRF was amplified by primers CRF-F (CTTCCGGCAAGCTATACGCGATCGATCTCCGCGATAATCT) and CRF-R (GTTACAGGCGTTACGTTACGTT).

[0031] like Figure 2 As shown, strain ΔporA can utilize 1 mM and 2 mM NH in AMS2 medium (except for the change in nitrogen source, the other components of the medium are the same as NMS2 medium, with ammonium chloride as the nitrogen source). 4 Cl growth, while the original strain 5GBC1 and the complemented ΔporA-Com had difficulty growing. These results indicate that inactivation of porA can improve the ability of strain 5GBC1 to utilize ammonium nitrogen.

[0032] The structure of PorA was simulated and predicted by AlphaFold 3. Figure 3 The results show that PorA has typical features of porins, consisting of 16 β-strands arranged in a β-barrel and organized as trimers. From a cross-section perpendicular to the structure, the interior of the channel is hourglass-shaped, with the narrowest part being the "constriction zone" and the outer ring forming the structure.

[0033] Example 3: Inactivation of the porin encoding gene porA improves the ability of Methylotuvimicrobium buryatense5GBC1 to utilize ammonium nitrogen

[0034] To verify whether the porA knockout strain ΔporA can obtain higher biomass by utilizing ammonium nitrogen, the strain ΔporA was cultured in AMS2 medium at 30°C and 180 rpm in a shake flask overnight, and then inoculated into 50 mL AMS2 liquid medium at 1% at 30°C and 180 rpm, supplemented with 0.5 mM NH every 6 h. 4 Cl, replace the gas in the shake flask every 12 hours. Figure 4 As shown, under continuous supplementation of NH 4 Under the condition of Cl, strain ΔporA can continue to grow, which shows that ammonium nitrogen can be used instead of nitrate nitrogen for fermentation culture of strain ΔporA, which is of great significance to reducing the cost of fermentation culture of Methylotuvimicrobiumburyatense.

[0035] Example 4: Inactivation of the porin encoding gene porA reduces the accumulation of harmful products

[0036] Methane-oxidizing bacteria can convert ammonia into harmful substances such as hydroxylamine, nitrite and nitrous oxide. In order to detect whether these harmful substances will be reduced after the inactivation of the porA gene, the starting strain Methylotuvimicrobium buryatense5GBC1 and the knockout strain ΔporA were placed in NMS2 culture at 30°C and 180rpm overnight to the exponential phase, and then the cells were collected by centrifugation and transferred to AMS2 culture medium at 30°C and 180rpm overnight to detect the accumulated hydroxylamine, nitrite and nitrous oxide content (method reference Analytical Chemistry, 1955, https: / / doi.org / 10.1021 / ac60106a054 and PNAS, 2016, https: / / doi.org / 10.1073 / pnas.1611051113). Figure 5 As shown, compared with the starting strain, the accumulation of nitrite in the culture supernatant of the strain ΔporA was reduced by about 60%, the accumulation of hydroxylamine was reduced by about 50%, and the accumulation of nitrous oxide was reduced by about 50%.

[0037] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A porin protein PorA that affects the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense, characterized in that: The amino acid sequence is shown in SEQ ID NO.

1.

2. The PorA encoding gene porA according to claim 1, characterized in that The nucleotide sequence is shown in SEQ ID NO.

2.

3. Use of the PorA according to claim 1 in improving the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense.

4. The use according to claim 3, characterized in that: Inactivation of the porin PorA can improve the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense.

5. Use of the porin PorA encoding gene porA according to claim 2 in improving the ammonium nitrogen utilization ability of Methylotuvimicrobiumburyatense, characterized in that: Improving the ammonium nitrogen utilization ability of Methylotuvimicrobium buryatense can be achieved by gene knockout, gene mutation or gene silencing of porA.

6. Application of substances that inactivate the porin PorA by gene knockout, gene mutation or gene silencing in improving the ammonium nitrogen utilization capacity of Methylotuvimicrobium buryatense.

Images