Inducer for promoting exosome secretion and application of exosome

Abstract

The invention relates to the technical field of biology, in particular to an inducer for promoting exosome secretion and application of an exosome. The inducer comprises the following three components: N-methyldopamine hydrochloride, quercetin and ascorbic acid, has the advantages of stable effect and simplicity in use, can increase the yield of exosomes by at least 3-5 times when the umbilical cord mesenchymal stem cells in a good state are subjected to induction culture, and has a remarkable effect of promoting the secretion of the exosomes in the stem cells. In addition, the engineering exosome which is derived from the umbilical cord mesenchymal stem cells and simultaneously contains miR-125b-5p, miR-126-3p, miR-146a and miR-542-3p is prepared through an electroporation transfection technology, animal experiment results show that the engineering exosome has a wound repairing effect, and the comprehensive application of an inducer and an electrotransformation technology has relatively high application value; popularization and application are facilitated.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an inducer for promoting exosome secretion and the application of exosomes. Background Art

[0002] The information disclosed in this background section is intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] The skin is the first line of defense for the body, and it has the function of resisting the invasion of pathogenic microorganisms into the human body. When facing acute or chronic skin damage caused by mechanical, pathological and other factors, the first thing to consider is how to promote wound healing and accelerate the process of skin repair. Exosomes derived from stem cells have shown great clinical application value in the healing of chronic and refractory wounds.

[0004] Exosomes are nanometer-sized extracellular vesicles with a lipid bilayer membrane structure, containing a variety of bioactive substances such as lipids, proteins and nucleic acids. Although exosomes have great potential for application in a variety of diseases such as skin repair, the low yield of exosomes and the difficulty in large-scale production are still urgent problems to be solved. At present, methods to increase the yield of exosomes include 3D culture, genetic engineering, and changing the culture environment (such as hypoxia, acidic pH), etc. Although they may increase the yield to a certain extent, they have not been applied on a large scale in exosome production due to the need for additional control devices and complex pretreatment steps.

[0005] Exosome secretion inducers can enhance the secretion of exosomes by stem cells. Patent document 1 CN114836375A records an exosome secretion inducer, an induction medium and its application, but the inducer recorded in document 1 is limited to inducing embryonic stem cells, induced pluripotent stem cells and mesenchymal stem cells to produce sufficient exosomes and is used to improve the condition of senescent cells and / or protect neurons; Patent document 2 CN117377754A discloses a promoter and application method for promoting the production of exosomes by adipose-derived mesenchymal stem cells, but the promoter recorded in document 2 is limited to the production of exosomes by adipose-derived mesenchymal stem cells.

[0006] The secretion-promoting ability of the exosome secretion inducers currently used is limited, and there has not yet been any application of small molecule compounds as inducers combined with cell culture conditions in the exosome production process of umbilical cord mesenchymal stem cells. Summary of the invention

[0007] In view of the shortcomings of the prior art, the first object of the present invention is to provide an inducer for promoting exosome secretion. The exosome secretion inducer is a group of small molecule compounds that can promote the secretion of exosomes by umbilical cord mesenchymal stem cells: N-methyldopamine hydrochloride, quercetin and ascorbic acid, which can significantly increase the exosome production of umbilical cord mesenchymal stem cells, thereby greatly reducing the production cost of exosomes.

[0008] The second object of the present invention is to provide a method for promoting exosome secretion using the above-mentioned inducer.

[0009] The third object of the present invention is to provide a method for preparing electro-transfected miRNA exosomes.

[0010] The fourth object of the present invention is to provide electro-transfected miRNA exosomes prepared by the above method.

[0011] The fifth object of the present invention is to provide the application of the above-mentioned electro-transfected miRNA exosomes.

[0012] To achieve the above object, the present invention adopts the following technical solutions:

[0013] An inducer for promoting exosome secretion, the inducer comprising the following components: N-methyldopamine hydrochloride at a concentration of 70-100 μmol / L, quercetin at a concentration of 50-70 μmol / L and ascorbic acid at a concentration of 30-60 μmol / L; wherein the molar ratio of N-methyldopamine hydrochloride, quercetin and ascorbic acid is (7-10): (5-7): (3-6).

[0014] A method for promoting exosome secretion using the above inducer, the method comprising the following steps:

[0015] The 4th generation umbilical cord mesenchymal stem cells with an adhesion coverage rate of 60% to 70% were induced and cultured for 24 hours using exosome secretion induction medium, and the exosome secretion induction medium was removed. The cells were cultured in a stem cell serum-free medium for 24 hours to obtain a cell culture supernatant, which was centrifuged to precipitate exosomes.

[0016] Furthermore, the centrifugation adopts the following steps: (1) taking the cell culture supernatant, centrifuging at 2000g for 10 min at room temperature to obtain a supernatant;

[0017] (2) centrifuging the supernatant obtained in step (1) at 10,000 g for 30 min at room temperature and collecting the supernatant;

[0018] (3) centrifuging the supernatant obtained in step (2) at 110,000 g for 70 min, mixing the obtained precipitate with sterile phosphate buffer to obtain a crude exosome product;

[0019] (4) The crude exosomes obtained in step (3) were centrifuged at 110,000 g for 70 min to obtain the umbilical cord mesenchymal stem cell exosomes.

[0020] Furthermore, the method adopts the following steps: human umbilical cord mesenchymal stem cells with a confluence of 60% to 70% are replaced with a culture medium containing an exosome secretion inducer for exosome secretion induction culture for 24 hours, then the induction culture medium is removed, and the culture supernatant is recovered after culturing for 24 hours with a stem cell culture medium, and the umbilical cord mesenchymal stem cell exosomes are separated and purified by ultracentrifugation. The human umbilical cord mesenchymal stem cells mentioned above refer to the 4th generation stem cells obtained in (1) with good growth status, and the stem cells with a confluence of 60% to 70% are in the logarithmic growth phase, with frequent cell proliferation and secretion activities; the culture medium containing the exosome secretion inducer refers to a stem cell culture medium containing 70-100 μmol / L N-methyldopamine hydrochloride, 50-70 μmol / L quercetin and 30-60 μmol / L ascorbic acid, and the stem cell culture medium refers to the mesenchymal stem cell culture medium additive and the mesenchymal stem cell serum-free culture medium mentioned in (1) with a volume ratio of 1:18.

[0021] A method for preparing electro-transfected miRNA exosomes, the preparation method comprising the following steps:

[0022] (1) Resuspend the umbilical cord mesenchymal stem cell exosomes obtained above in electrofection buffer to obtain a concentration of 1×10 12 particles / mL of exosome suspension;

[0023] (2) using nuclease-free water to prepare miR-125b-5p mimic, miR-126-3p mimic, miR-146a mimic and miR-542-3p mimic into a miRNA solution with a concentration of 20 μmol / L; the gene sequence of the miR-125b-5p is shown in SEQ ID No.1; the gene sequence of the miR-126-3p is shown in SEQ ID No.2; the gene sequence of the miR-542-3p is shown in SEQ ID No.3; the gene sequence of the miR-146a-5p is shown in SEQ ID No.4;

[0024] (3) The exosome suspension obtained in step (1) and the miRNA solution obtained in step (2) are mixed at a volume ratio of 1:1, electro-transfected, and the precipitate is obtained after centrifugation, and resuspended in DPBS phosphate buffer solution to obtain electro-transfected miRNA exosomes.

[0025] Furthermore, in step (3), the conditions of the electrotransfection are: 1000V, 10ms, 1 electric shock.

[0026] Furthermore, in step (3), after the electro-transfection is completed, the exosome suspension needs to be placed at 37° C. to recover for 5 minutes.

[0027] Furthermore, in step (3), the centrifugation conditions are: 4°C, 110,000g for 70 min.

[0028] Furthermore, the preparation method adopts the following steps: resuspending the mesenchymal stem cell exosomes with an electrotransfection buffer (bio-rad) and adjusting its concentration to obtain an exosome suspension of a predetermined concentration, and dissolving a miRNA mimic (miRNAmimic) with the same sequence as the above-mentioned miRNA with nuclease-free water to prepare a solution of a predetermined concentration, mixing the exosome suspension with the miRNA solution, and performing transfection with an electrotransfection instrument (bio-rad). After the transfection is completed, the exosome suspension is placed at 37°C to recover for 5 minutes, and then subjected to ultracentrifugation at 110,000×g for 70 minutes, and the supernatant is removed and resuspended in PBS to obtain a stem cell exosome suspension introduced with miRNA, and the particle number is adjusted to 1×10 12 particles / mL and then stored at -80℃ for future use.

[0029] The concentration of the exosome suspension is 1×10 9 particles / mL~1×10 12 particles / mL, measured by NTA particle size analyzer. The miRNA mimic (miRNAmimic) is a miRNA mimic synthesized by chemical methods in the form of dry powder, and the sequence of the miRNA mimic is the same as miR-125b-5p, miR-126-3p, miR-146a and miR-542-3p. Before use, add an appropriate amount of DEPC water to dilute the concentration of the miRNA mimic to 20μmol / L, and the electrotransfection conditions are 1000V voltage, 10ms time constant, and 1 electric shock transfection. The effectiveness of the transfection is verified by using Stem-loop RT-qPCR, reverse transcription kit (Takara), and the change of miRNA content before and after transcription is detected by absolute quantitative method.

[0030] The electrotransfected miRNA exosomes prepared by the above method. The exosomes obtained by combining the exosomes with specific miRNA can promote angiogenesis, thereby accelerating wound healing. The exosomes produced by the present invention are suitable for use in cosmetic surgery, skin repair and other related products.

[0031] The application of the above-mentioned electro-transfected miRNA exosomes, the electro-transfected miRNA exosomes can be used in the field of wound repair.

[0032] Furthermore, the wound dressing containing the electro-transfected miRNA exosomes can be used in the field of wound repair.

[0033] Furthermore, the preparation method of the wound dressing containing the electro-transfected miRNA exosomes comprises the following steps:

[0034] Under sterile conditions, 0.05-5% recombinant collagen, 0.05-5% sodium hyaluronate, 0.1%-50% sodium alginate, and 0.5%-10% polyethylene glycol solution were weighed according to the volume ratio, and 10% of 1×10 12 particles / mL of exosome solution, and sterile water is added to make up the volume, mixed at room temperature, stirred until dissolved, and filtered through a 0.22 μm filter membrane for sterilization to obtain the wound dressing.

[0035] Beneficial effects: (1) The present invention first proposes a group of secretion inducers for promoting the production of exosomes by umbilical cord mesenchymal stem cells, comprising three components: N-methyldopamine hydrochloride, quercetin and ascorbic acid, which are stable and easy to use. They only need to be added to the basal culture medium for umbilical cord mesenchymal stem cell culture. When umbilical cord mesenchymal stem cells in good condition are induced and cultured, the production of exosomes can be increased by at least 3 times, which has a significant effect of promoting the secretion of exosomes in stem cells. When umbilical cord mesenchymal stem cells with good adhesion are cultured using the culture medium containing the exosome secretion inducer provided by the present invention, the production of exosomes (i.e., the secretion amount) can be as high as 1800 cells / cell or more, which is more than 3 times that of no inducer.

[0036] (2) The present invention prepares umbilical cord mesenchymal stem cell-derived exosomes containing miR-125b-5p, miR-126-3p, miR-146a and miR-542-3p by electroporation transfection technology. Based on the synergistic effects of stem cell exosomes, miR-125b-5p, miR-126-3p, miR-146a and miR-542-3p in inhibiting inflammation, promoting angiogenesis and re-epithelialization, animal experimental results show that such exosomes have a healing and repairing effect on rat skin wounds. On the 8th day after use, more than 80% of the rats can ensure that the wounds are completely healed without scars. Therefore, such exosomes have high application value in the field of skin repair and related products and are suitable for promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings, wherein:

[0038] Figure 1 This is a diagram showing the identification results of umbilical cord mesenchymal stem cell surface markers detected by flow cytometry;

[0039] Figure 2 This is a cell morphology diagram under an optical microscope;

[0040] Figure 3 TEM image of exosomes;

[0041] Figure 4 This is the expression result diagram of specific protein components on the surface of exosomes;

[0042] Figure 5 This is the identification result diagram of the particle size and concentration of exosomes;

[0043] Figure 6 This is the result diagram of the fluorescence quantitative detection of miRNA;

[0044] Figure 7 This is the result of the cytotoxicity test. Figure 7 A in the middle is a statistical chart of cell survival rate. Figure 7 B is the OD of the cell 450 Statistical results chart;

[0045] Figure 8 This is a graph showing blood compatibility test results;

[0046] Fig. 9 This is the result of the wound repair experiment. Fig. 9 A in the middle is a wound repair phenotype diagram. Fig. 9 Middle B is a statistical chart of wound healing rate;

[0047] Fig.10 This is the statistical result diagram of collagen deposition rate;

[0048] Fig.11 This is a statistical result diagram of TNF-α content in rat wound tissue;

[0049] Fig.12 This is a statistical graph of the IL-6 content in rat wound tissue. DETAILED DESCRIPTION

[0050] The following description further describes the specific details of the present invention for a full understanding of the present invention. The terms used in the description of the present invention are only used to illustrate the advantages and features of the present invention and are not intended to limit the present invention.

[0051] Unless otherwise defined, all professional and scientific terms used in the present invention have the same meanings as those understood by technicians in the technical field of the present invention. Unless otherwise specified, the drugs or reagents used in the present invention are used in accordance with the product instructions or the conventional methods of use in the field. The technical solution of the present invention is further described according to the drawings and specific embodiments of the specification.

[0052] Example 1

[0053] Inducing and culturing umbilical cord mesenchymal stem cells to secrete exosomes comprises the following steps:

[0054] (1) Preparation of umbilical cord mesenchymal stem cells

[0055] After obtaining the fresh umbilical cord, rinse it with DPBS under sterile conditions and cut it into 1-2 cm umbilical segments. Then, peel off the umbilical cord outer membrane and remove the umbilical artery and umbilical vein. After being fully rinsed with DPBS, cut the umbilical cord mesenchyme into pieces and transfer it to a sterile centrifuge tube. Use type I collagenase to digest and culture it to obtain primary cultured human umbilical cord mesenchymal stem cells (UC-MSC).

[0056] The sterile conditions are provided by the clean area and the ultra-clean workbench; the type I collagenase exists in the form of an enzyme solution with a concentration of 1.0 mg / mL; the volume ratio of type I collagenase to umbilical cord tissue block is 1:1; the digestion process is carried out in a cell culture incubator at a digestion temperature of 37°C and a digestion CO 2 The concentration is 5%, and the digestion time is 3 to 7 hours. After the digestion is completed, the digested cell suspension is inoculated into a cell culture dish filled with culture medium for culture. The culture medium for stem cell culture (Dakowei-6914511) includes mesenchymal stem cell serum-free culture medium (Dakowei-CAT#6914511) and mesenchymal stem cell culture medium supplement, and the volume ratio of the mesenchymal stem cell serum-free culture medium and the mesenchymal stem cell culture medium supplement is 1:19.

[0057] (2) Identification of UC-MSCs

[0058] When the cells in step (1) were passaged to the second generation, the surface markers of the primary UC-MSCs obtained were identified by flow cytometry. The cells were mixed with mouse anti-human FITC-CD90, APC-CD105, PE-CD73, PE-CD45, PE-CD34 and FITC-HLA-DR antibodies respectively. The specific steps were as follows: the primary UC-MSC pellet was resuspended in PBS, and the cells were counted and diluted to 1×10 7 / mL, add 100 μL of cell suspension to the flow tube, and 66 μL of the above-mentioned (BD) flow cytometry antibody mixture was added to the cells and mixed thoroughly by pipetting. The cells were incubated in a dark room at 4°C for 30 min. Mouse anti-human PE / FITC-IgG1 was used as a parallel control to detect the immune phenotype of UC-MSCs by flow cytometry. Figure 1 This is the identification result diagram of umbilical cord mesenchymal stem cell surface markers (CD molecules) detected by flow cytometry. The results show that UC-MSC express CD73, CD90 and CD105, and do not express CD34, CD45 and HLA-DR antigens, which is consistent with the typical phenotype of umbilical cord mesenchymal stem cells.

[0059] When the cells reached the third generation, the cell morphology was observed using an inverted microscope. Figure 2 This is a cell morphology picture under an optical microscope. The results show that the stem cells are long spindle-shaped, grow polygonally attached to the wall, proliferate well, and have no differentiation phenomenon, which is consistent with the typical morphology of umbilical cord mesenchymal stem cells.

[0060] (3) Exosome secretion inducers and methods of use

[0061] The exosome secretion induction medium (YDEV medium) for efficient production of exosomes from umbilical cord mesenchymal stem cells was prepared, and the ingredients included: basal medium (Dako-6914511) and exosome secretion inducer. The ingredients of the exosome secretion inducer: N-methyldopamine hydrochloride at a concentration of 70-100 μmol / L, quercetin at a concentration of 50-70 μmol / L, and ascorbic acid at a concentration of 30-60 μmol / L, and the above concentrations are the concentrations in the entire culture system. As a control, basal medium / serum-free medium without the addition of exosome secretion inducer was used for cell culture.

[0062] The 4th generation umbilical cord mesenchymal stem cells with an adherence coverage rate of 60% to 70% were induced and cultured for 24 hours using YDEV medium and basic medium without induction agent. Then, the experimental group (induced group) removed the YDEV medium and cultured with stem cell serum-free medium for 24 hours; the control group was cultured with stem cell medium for 24 hours, and then replaced with stem cell serum-free medium for 24 hours. The exosomes in the culture supernatant of umbilical cord mesenchymal stem cells were collected and the content of exosomes was identified.

[0063] (4) Preparation and identification of exosomes

[0064] ① Preparation of exosomes

[0065] The cell culture supernatant obtained from the induction group and the control group obtained in step (3) was taken respectively, centrifuged at 2000g for 10 minutes at room temperature to remove cells and other large particles, and the supernatant was collected; the supernatant was centrifuged for a second time at 10000g for 30 minutes at room temperature to remove impurities such as cell debris and microvesicles, and the supernatant was collected; the supernatant was ultracentrifuged for a third time at 110,000g for 70 minutes, the precipitate was collected, and the precipitate was mixed with sterile PBS (phosphate buffer) and resuspended to obtain crude exosomes of mesenchymal stem cells; the crude exosomes were centrifuged for a fourth time at 110,000g for 70 minutes to precipitate the exosomes, and the precipitate was collected, which was the umbilical cord mesenchymal stem cell exosomes. The precipitate was diluted with DPBS (Dublin phosphate buffer) to obtain a relatively pure exosome solution.

[0066] ②Identification of exosomes

[0067] Transmission electron microscopy (TEM) was used for analysis. The analysis method was as follows: 10 μL of sample was added dropwise on a copper grid to precipitate for 1 min, the floating liquid was removed by filter paper, 10 μL of uranyl acetate (phosphotungstic acid) was added dropwise on the copper grid to precipitate for 1 min, the floating liquid was removed by filter paper, and the sample was dried at room temperature for several minutes. The sample was imaged by electron microscopy at 80 kV to obtain the transmission electron microscopy imaging results. Figure 3 The TEM image of exosomes shows that the electron microscopic image of exosomes obtained by culturing umbilical cord mesenchymal stem cells with YDEV medium shows that the produced exosomes have a typical vesicle-like structure (usually a saucer-shaped or hemispherical shape with a depression on one side).

[0068] Western blot was used to analyze the expression of exosome surface specific proteins CD9, CD63, and CD81. Figure 4 This is the expression result diagram of specific protein components on the surface of exosomes. The results show that the extracted exosomes express specific surface markers CD9, CD63 and CD81.

[0069] NTA was used to identify the concentration of exosomes: 20 μL of the collected exosome solutions from the induced group and the control group were taken, diluted to 100 μL with PBS, added to the nanoparticle tracking analyzer (NTA), and operated according to the instrument technical manual to obtain the corresponding exosome particle size and concentration. The results are shown in Table 1 and Figure 5 As shown, Figure 5 This is an identification result diagram of the particle size and concentration of exosomes. The results show that the particle size of the obtained exosome solution is concentrated in the range of 50-80nm, which is consistent with the particle size range of exosomes secreted by umbilical cord mesenchymal stem cells (30-150nm), proving that exosomes have been obtained.

[0070] Table 1 Particle size and concentration of exosomes identified by NTA

[0071] Serial number Mean particle size / nm Mode particle size / nm Particle concentration / mL l 83.5 70.1 8.22e+10 2 98.7 75.3 1.07e+11 3 71.6 63.5 1.40e+11 4 85.6 69.4 1.12e+11

[0072] Using YDEV medium to induce umbilical cord mesenchymal stem cells can obtain more exosomes (1800 / cell), which is more than three times the number of exosomes ( / cell) obtained by culturing cells without induction medium, indicating that YDEV medium can significantly increase the production of exosomes produced by umbilical cord mesenchymal stem cells compared with stem cell medium. On the other hand, compared in terms of composition, YDEV medium only includes three components, which can significantly reduce the production cost of exosomes.

[0073] Example 2

[0074] (1) A method for preparing miRNA-loaded exosomes by electrofection, wherein the specific steps are as follows:

[0075] The umbilical cord mesenchymal stem cell exosomes obtained in Example 1 were resuspended in 1 mL of electrotransfection buffer (purchased from bio-rad), and the concentration of mesenchymal stem cell exosomes was detected by NTA, and the concentration was adjusted until a concentration of 1×10 12 The exosome suspension was prepared at 1000 μmol / mL. At the same time, miR-125b-5p mimic, miR-126-3pmimic, miR-146a mimic and miR-542-3p mimic (all purchased from Sangon Biotech (Shanghai) Co., Ltd.) were dissolved in nuclease-free water to prepare miRNA solutions with a concentration of 20 μmol / L. The exosome suspension and miRNA solution were mixed in equal volumes and transfected using an electrotransfection instrument (purchased from bio-rad). The transfection conditions were: 1000V, 10ms, and 1 electric shock. After the electric shock, the exosome suspension was placed at 37°C to recover for 5 minutes, and then ultracentrifuged at 4°C and 110,000g for 70 minutes. After the supernatant was removed, it was resuspended in DPBS phosphate buffer solution to obtain a stem cell exosome suspension introduced with the target miRNA. The particle number was adjusted to 1×10 12 particles / mL and stored at -80℃ for later use.

[0076] The accession numbers (miRBase database) and mature gene sequences (SEQ ID No. 1-4) of the miRNAs used are as follows:

[0077] miR-125b-5p: MIMAT0000423 UCCCUGAGACCCUAACUUGUGA (SEQ ID No. 1);

[0078] miR-126-3p: MIMAT0000445 UCGUACCGUGAGUAAAUAAUGCG (SEQ ID No. 2);

[0079] miR-542-3p: MIMAT0003389 UGUGACAGAUUGAUAACUGAAA (SEQ ID No. 3);

[0080] miR-146a-5p: MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU (SEQ ID No. 4).

[0081] (2) The contents of each miRNA component (miR-125b-5p, miR-126-3p, miR-146a and miR-542-3p) obtained in step (1) were detected by using Stem-loop RT-qPCR: RNA in exosomes was extracted using RIPA lysis buffer; amplification detection was performed using Takara reverse transcription fluorescence quantitative detection kit, primers and probes, and the content difference before and after transfection was calculated using absolute quantitative method and amplified CT. Figure 6 This is the result of fluorescence quantitative detection of miRNA.

[0082] Primers and probes for miR-125b-5p:

[0083] RT Neck Loop Primer:

[0084] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCACAA (SEQ ID No. 5);

[0085] Forward primer: AACAGTGTCCCTGAGACCCTA (SEQ ID No. 6);

[0086] Reverse primer: GTCGTATCCAGTGCAGGGT (SEQ ID No. 7); Taqman probe: FAM-CTTGTGAGTCGTAT-MGBNFQ (SEQ ID No. 8);

[0087] Primers and probes for miR-126-3p:

[0088] RT Neck Loop Primer:

[0089] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT (SEQ ID No. 9);

[0090] Forward primer: AACCATGTCGTACCGTGAGTA (SEQ ID No. 10);

[0091] Reverse primer GTCGTATCCAGTGCAGGGT (SEQ ID No. 11); Taqman probe FAM-TAATGCGGTCGTAT-MGBNFQ (SEQ ID No. 12);

[0092] Primers and probes for miR-542-3p:

[0093] RT Neck Loop Primer:

[0094] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTCAG (SEQ ID No. 13);

[0095] Forward primer AACACGTGTGTGACAGATGATTGAT (SEQ ID No. 14);

[0096] Reverse primer GTCGTATCCAGTGCAGGGT (SEQ ID No. 15); Taqman probe FAM-ACTGAAAGTCGTAT-MGBNFQ (SEQ ID No. 16);

[0097] Primers and probes for miR-146a-5p:

[0098] RT Neck Loop Primer:

[0099] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA (SEQ ID No. 17);

[0100] Forward primer: AAGCGACCTGAGAACTGAATTC (SEQ ID No. 18); reverse primer: GTCGTATCCAGTGCAGGGT (SEQ ID No. 19); Taqman probe: FAM-ATGGGTTGTCGTAT-MGBNFQ (SEQ ID No. 20).

[0101] Example 3

[0102] (1) A method for preparing and applying engineered exosome wound dressings, comprising the following specific steps:

[0103] Under sterile conditions, 0.05-5% recombinant collagen (Yisheng Bio-92616ES50), 0.05-5% sodium hyaluronate, 0.1%-50% sodium alginate, and 0.5%-10% polyethylene glycol solution were weighed according to the volume ratio, and 10% of the 1×10 12 particles / mL of the exosome solution, and sterile water was added to make up the volume, mixed at room temperature, stirred until dissolved, and filtered through a 0.22 μm filter membrane to obtain the wound dressing.

[0104] (2) Cytotoxicity test

[0105] NIH-3T3 cells were cultured at an initial density of 1.5 × 10 3 The cells were inoculated into 96-well plates (accurately determined by hemocytometer). 2 ) After incubation for 24 hours, the original DMEM complete medium was removed from the experimental group and replaced with the wound dressing sample leaching solution of engineered exosomes, while the control group continued to maintain the complete growth medium environment. Thereafter, the cells in the experimental group and the control group were incubated at 24h, 48h and 72h, respectively. At the specified time intervals, the leaching solution was removed from the experimental group, and the culture medium was removed from the control group. Then, a mixture containing 10μL CCK-8 solution and 100μL fresh complete cell culture medium was added to each well and incubated for further 1h. The absorbance value of each well was measured at a wavelength of 450nm using an ELISA reader using the CCK-8 method, and the cell survival rate was calculated based on this. Figure 7 This is the result of the cytotoxicity test. Figure 7 A in the middle is a statistical chart of cell survival rate. Figure 7 B is the OD of the cell 450 Statistical results: The experimental results show that the cell survival rate of the experimental group exceeds 95%, which is no different from that of the control group. Compared with the control group, the cells in the experimental group all showed good growth, indicating that the experimental group has good cell compatibility. In addition, the optical density values ​​(OD 450 value) gradually increased, which was similar to the trend of the control group, indicating that the cell proliferation trend was good, further proving that the wound dressing of engineered exosomes had excellent biological tissue compatibility.

[0106] (3) Blood compatibility test

[0107] The blood was centrifuged at 1000r / min for 5min, and then 5mL of fresh red blood cells were collected and resuspended in 98mL PBS (10mM, pH 7.4). In the experimental group setting, the sterilized engineered exosomes were introduced into the PBS solution containing the above-mentioned fresh red blood cell suspension, and then incubated at a constant temperature of 37°C for 3h. In order to evaluate the experimental effect, a negative control group was set up, that is, the same operation was performed in a PBS solution without hydrogel; at the same time, a positive control group was set up, that is, red blood cells were cultured in deionized water. After the experiment, it was centrifuged again at 1000r / min for 5min, and the supernatant was separated and collected. The absorbance value of the supernatant was accurately measured at a wavelength of 540nm using an enzyme marker for subsequent analysis. In the positive control group, since pure water is used as an osmotic solution, its osmotic pressure is significantly lower than that of the internal environment of red blood cells. According to the principle of osmosis, red blood cells will actively absorb a large amount of distilled water. This process causes the cell volume to expand rapidly, which in turn causes damage to the cell membrane and even rupture. This destruction process released intracellular hemoglobin and other key components into the external environment, triggering a hemolytic reaction. The absorbance of the supernatant was quantified at a specific wavelength (540 nm) using an ELISA reader, and the hemolysis rate of each group was calculated based on this. Figure 8 This is a graph showing the results of the blood compatibility test. The results show that the hemolysis rates of both the PBS group and the experimental group were maintained below 3%. This low hemolysis rate indicator strongly proves that the prepared dressing exhibits excellent blood compatibility.

[0108] (4) Rat wound repair experiment

[0109] Four-week-old SD rats (SPF grade, purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd.) were fed with high-fat diet (purchased from Beijing Ke'ao Xieli Feed Co., Ltd.) for 4 weeks, and then fasted for 12 h but not water, and given an intraperitoneal injection of 40 mg / kg streptozotocin (STZ, Sigma). The fasting blood glucose level in the tail vein blood of the rats was monitored to be >7.1 mmol / L. After a week of continuous stability, the rats were anesthetized by intraperitoneal injection of 80 mg / kg of sodium pentobarbital (Sigma), and a circular skin with a diameter of 1 cm was excised from the back to construct a skin defect model. After the model was constructed, the rats were randomly divided into 4 groups, with 6 rats in each group.

[0110] Modeling group (Control): This modeling group is a non-treatment group, and no treatment is done on the skin wounds of rats. The liquid dressing is changed every 72 hours, and the wound diameter is measured to observe the wound healing.

[0111] Treatment group: Use dressings containing electro-transfected miRNA exosomes. Apply the liquid dressing evenly on the wound surface at room temperature to fully cover it.

[0112] Fig. 9 This is the result of the wound repair experiment. Fig. 9 A in the middle is a wound repair phenotype diagram. Fig. 9 Figure B is a statistical chart of wound healing rate. The results show that compared with the modeling group, at each detection time point, the wound diameter of the experimental group was smaller than that of the modeling group, and the healing speed was faster than that of the modeling group. The dressing containing electro-transfected miRNA exosomes has a more significant effect in accelerating wound healing. The longer the time, the more obvious the healing effect of the experimental group, and its initial inflammatory response is also significantly reduced.

[0113] (5) Collagen deposition detection

[0114] The wound tissues of the two groups of experimental subjects (modeling group and treatment group) on the 9th day of the experiment were analyzed by Masson staining sections, and the collagen deposition in the sections of each group was quantified and statistically analyzed using ImageJ software. Fig.10 The figure is a statistical result of collagen deposition rate, and the results show that the wound dressing of engineered exosomes exhibits a collagen deposition rate of nearly 50%, which is significantly higher than that of the modeling group by nearly 30%. Compared with the modeling group, the wound dressing of engineered exosomes prepared by the present invention has higher efficiency in promoting skin wound healing, and can effectively accelerate the deposition of collagen, thereby facilitating the repair and regeneration of wound tissue.

[0115] (6) TNF-α and IL-6 levels in rat wound tissue

[0116] On the 2nd, 5th and 9th days after the SD rat model was established, the skin wound tissue was collected. At the same time, a blank control group was set up. The rats in this group did not undergo the neck and back wound modeling process, and their skin samples were also collected as experimental controls. Before the experiment, the rats were anesthetized and securely fixed on the operating board, and the prone position was adopted to ensure that the back wound was fully exposed. Subsequently, the skin wound tissue of about 1.5 cm in length was accurately cut using sterilized surgical scissors and tweezers. The collected tissue samples were then rinsed three times in ice saline to remove blood and residues, and then gently dried with sterile paper. Under low temperature conditions, the skin tissue was finely chopped and homogenized, and then centrifuged at 12000r / min for 25min to separate the supernatant. Finally, the cytokines TNF-α and IL-6 in the supernatant were quantitatively analyzed using the corresponding kits to evaluate the potential role of these factors in the wound healing process.

[0117] Fig.11 This is the statistical result of TNF-α content in rat wound tissue. Fig.12The statistical results of IL-6 content in rat wound tissues show that compared with the blank control, the concentrations of TNF-α and IL-6 in the serum of the modeling group and the treatment group increased significantly. Compared with the modeling group, the treatment group showed a decrease in TNF-α and IL-6 concentrations, inhibiting the content of related inflammatory factors and promoting wound healing.

Claims

1. An inducer for promoting exosome secretion, characterized in that The inducer comprises the following components: N-methyldopamine hydrochloride, quercetin and ascorbic acid; wherein the molar ratio of N-methyldopamine hydrochloride, quercetin and ascorbic acid is (7-10): (5-7): (3-6).

2. A method for promoting exosome secretion using the inducer according to claim 1, characterized in that: The method adopts the following steps: The fourth generation umbilical cord mesenchymal stem cells with an adherence coverage rate of 60% to 70% were induced and cultured using an exosome secretion induction medium to obtain a cell culture supernatant, which was centrifuged to precipitate exosomes.

3. The method according to claim 2, characterized in that The induction culture time is 24 hours; after the induction culture, the exosome secretion induction medium needs to be removed, and the stem cell serum-free medium is used for 24 hours.

4. The method according to claim 2, characterized in that: The centrifugation comprises the following steps: (1) taking the cell culture supernatant, centrifuging at 2000 g at room temperature for 10 min to obtain a supernatant; (2) centrifuging the supernatant obtained in step (1) at 10,000 g for 30 min at room temperature and collecting the supernatant; (3) centrifuging the supernatant obtained in step (2) at 110,000 g for 70 min, mixing the obtained precipitate with sterile phosphate buffer to obtain a crude exosome product; (4) The crude exosomes obtained in step (3) were centrifuged at 110,000 g for 70 min to obtain the umbilical cord mesenchymal stem cell exosomes.

5. A method for preparing electro-transfected miRNA exosomes, characterized in that: The preparation method comprises the following steps: (1) Resuspend the umbilical cord mesenchymal stem cell exosomes obtained above in electrofection buffer to obtain a concentration of 1×10 12 particles / mL of exosome suspension; (2) using nuclease-free water to prepare miR-125b-5p mimic, miR-126-3p mimic, miR-146a mimic and miR-542-3p mimic into a miRNA solution with a concentration of 20 μmol / L; the gene sequence of the miR-125b-5p is shown in SEQ ID No.1; the gene sequence of the miR-126-3p is shown in SEQ ID No.2; the gene sequence of the miR-542-3p is shown in SEQ ID No.3; the gene sequence of the miR-146a-5p is shown in SEQ ID No.4; (3) The exosome suspension obtained in step (1) and the miRNA solution obtained in step (2) are mixed in a volume ratio of 1:1, electro-transfected, and the precipitate is obtained after centrifugation, and resuspended in DPBS phosphate buffer solution to obtain electro-transfected miRNA exosomes.

6. The method according to claim 5, characterized in that In step (3), the conditions of the electrotransfection are: 1000V, 10ms, 1 electric shock; After the electro-transfection is completed, the exosome suspension needs to be placed at 37°C to recover for 5 minutes; The centrifugation conditions are: 4°C, 110,000 g for 70 min.

7. Electrotransfected miRNA exosomes prepared by the method according to any one of claims 5 to 6.

8. The use of electro-transfected miRNA exosomes according to claim 7, characterized in that: The electro-transfected miRNA exosomes are used in the field of wound repair.

9. The use according to claim 8, characterized in that: The wound dressing containing the electrotransfected miRNA exosomes is used in the field of wound repair.

10. The use according to claim 9, characterized in that: The preparation method of the wound dressing containing the electro-transfected miRNA exosomes comprises the following steps: Under sterile conditions, 0.05-5% recombinant collagen, 0.05-5% sodium hyaluronate, 0.1%-50% sodium alginate, and 0.5%-10% polyethylene glycol solution were weighed according to the volume ratio, and 10% of 1×10 12 particles / mL of exosome solution, and sterile water was added to make up the volume, stirred at room temperature, and filtered through a 0.22 μm filter membrane for sterilization to obtain the wound dressing.

Images