Polyethylene glycol complexing agent as well as preparation method and application thereof

Abstract

The invention discloses a polyethylene glycol complexing agent as well as a preparation method and application thereof and belongs to the technical field of medicines. The polyethylene glycol complexing agent comprises the following components in percentage by mass: 1-2% of mesenchymal stem cell source exosome modified by miRNA-138-5p, 1-2% of mesenchymal stem cell source exosome modified by miRNA-21, 1-2% of mesenchymal stem cell source exosome modified by lncGm36569, 1-2% of mesenchymal stem cell source exosome modified by mRNA of SNARE family protein, 1-2% of mesenchymal stem cell source exosome modified by mRNA of SNARE family protein and the balance of water. 1-2% of mesenchymal stem cell source exosome modified by mRNA (messenger Ribonucleic Acid) of syntachilin, and the balance of polyethylene glycol. The polyethylene glycol complexing agent disclosed by the invention can reconstruct spinal cord continuity and improve a spinal cord injury microenvironment, so that a neurological function is recovered.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and specifically relates to a polyethylene glycol compound and a preparation method and application thereof. Background Art

[0002] Spinal cord injury caused by various reasons (such as traffic accidents, falls from heights, and violent trauma) is a catastrophic disease in clinical practice today. Complete spinal cord injury can lead to paraplegia (quadriplegia or paraplegia of the lower limbs), which means that paraplegic patients are confined to bed or wheelchairs for life, and are accompanied by serious or even fatal complications (such as central nervous system pain, bedsores, deep vein thrombosis of the lower limbs, aspiration pneumonia, urinary tract infection, etc.). In addition, paraplegic patients also impose huge living and economic burdens on their families. Therefore, it is very necessary and urgent to find effective therapeutic drugs and intervention methods to treat spinal cord injury.

[0003] At present, the main clinical treatments for spinal cord injury include drug therapy, surgical treatment and rehabilitation therapy. Drug therapy mainly includes corticosteroids, neurotrophic drugs, opioid receptor antagonists, central skeletal muscle relaxants, etc., but these drugs are mostly used to relieve various complications caused by spinal cord injury, and have little effect on spinal cord reconstruction and functional recovery. The surgical treatment procedures vary according to the injury situation, mainly including spinal reduction and fixation, spinal canal decompression and bone graft fusion. This type of spinal reconstruction surgery mainly targets vertebral fracture and dislocation itself, and has limited effect on spinal cord reconstruction after injury. Rehabilitation therapy includes exercise therapy, hydrotherapy, extracorporeal shock wave therapy, neuromodulation technology and exoskeleton rehabilitation robots. These rehabilitation treatments improve the quality of life of patients by remobilizing limbs, promoting muscle and bone function recovery and inducing neural plasticity.

[0004] However, the above treatments have little effect on spinal cord reconstruction and functional recovery. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a polyethylene glycol complex and a preparation method and application thereof. The polyethylene glycol complex of the present invention can reconstruct the continuity of the spinal cord, improve the microenvironment of spinal cord injury, and thus restore nerve function.

[0006] To this end, the present invention provides the following technical solutions.

[0007] In a first aspect, the present invention provides a polyethylene glycol complex, comprising, by mass percentage: 1-2% of mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, 1-2% of mesenchymal stem cell-derived exosomes modified with miRNA-21, 1-2% of mesenchymal stem cell-derived exosomes modified with lncGm36569, 1-2% of mesenchymal stem cell-derived exosomes modified with mRNA of SNARE family protein, 1-2% of mesenchymal stem cell-derived exosomes modified with mRNA of syntaphilin, and the remainder being polyethylene glycol.

[0008] In a possible embodiment, the relative molecular mass of polyethylene glycol is 400 to 1500;

[0009] Optionally, the molecular weight of the polyethylene glycol is 400, 600, 1000 or 1500.

[0010] In one possible embodiment, the SNARE family protein includes at least one of Syntaxin-7 and Snap47.

[0011] In one possible embodiment, the mesenchymal stem cell-derived exosomes are exosomes secreted from autologous mesenchymal stem cells.

[0012] In a possible embodiment, the content, by mass percentage, includes: 1.86% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1.71% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.49% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.99% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1.94% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 91.02% of polyethylene glycol.

[0013] In a possible embodiment, the content, by mass percentage, includes: 1.86% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 2% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.99% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.07% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family protein, 1.94% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 91.14% of polyethylene glycol.

[0014] In a possible embodiment, the content is calculated by mass percentage: 1.84% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1.69% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.97% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.31% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family protein, 1.92% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 91.27% of polyethylene glycol;

[0015] In a possible embodiment, the content, by mass percentage, includes: 1.24% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1.14% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.00% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.99% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1.94% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 92.69% of polyethylene glycol.

[0016] In a second aspect, the present invention provides a method for preparing a polyethylene glycol complex, comprising the following steps:

[0017] Polyethylene glycol, mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, mesenchymal stem cell-derived exosomes modified with miRNA-21, mesenchymal stem cell-derived exosomes modified with lncGm36569, mesenchymal stem cell-derived exosomes modified with mRNA of SNARE family protein, and mesenchymal stem cell-derived exosomes modified with mRNA of syntaphilin were mixed evenly according to the mass percentage.

[0018] In a third aspect, the present invention provides a use of a polyethylene glycol complex in a drug for treating a nervous system injury disease;

[0019] Optionally, the nervous system injury disease is one or more of spinal cord injury, brain injury or peripheral nerve injury.

[0020] In a fourth aspect, the present invention provides a use of a polyethylene glycol complex in a drug for treating one or more of the following conditions caused by spinal cord injury: spinal cord neuron or axon membrane rupture, inflammatory response, oxidative stress, ischemia, cell apoptosis, cell ferroptosis, and glial scar formation.

[0021] The technical solution of the present invention has the following advantages:

[0022] 1. A polyethylene glycol complex, comprising, by mass percentage: 1-2% of mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, 1-2% of mesenchymal stem cell-derived exosomes modified with miRNA-21, 1-2% of mesenchymal stem cell-derived exosomes modified with lncGm36569, 1-2% of mesenchymal stem cell-derived exosomes modified with mRNA corresponding to SNARE family proteins, 1-2% of mesenchymal stem cell-derived exosomes modified with mRNA of syntaphilin, and the remainder being polyethylene glycol.

[0023] When miRNA-138-5p-modified mesenchymal stem cell-derived exosomes were applied to the site of spinal cord injury, miRNA-138-5p inhibited the inflammatory response and resisted oxidative stress through the NLRP3 / Caspase-1 inflammatory response pathway and the Nrf2 / keap1 oxidative stress pathway to target secondary injury of the spinal cord; when miRNA-21-modified mesenchymal stem cell-derived exosomes were applied to the site of spinal cord injury, miRNA-21 regulated the size of astrocytes and the formation of glial scars after spinal cord injury by interacting with the bone morphogenetic protein (BMP) and JAK-STAT signaling pathways. In addition, in damaged neural tissue, overexpression of miRNA-21 promoted the expression of angiogenesis-related molecules, including angiopoietin-1 (Ang-1), Tie-2 (Ang-1 receptor), and vascular endothelial growth factor (VEGF). And miRNA-21 promoted angiogenesis by increasing the expression of metalloproteinase-13 (MMP-13) and p-ERK1 / 2. Finally, miRNA-21 can also play an anti-apoptotic role by downregulating the expression of PTEN, Spry2 and PDCD4; lncGm36569 modified mesenchymal stem cell derived exosomes are applied locally at the site of spinal cord injury, and lncGm3656 inhibits neuronal cell ferroptosis through the miRNA-5627-5p / FSP1 axis, thereby alleviating neuronal dysfunction. The mechanism of membrane repair of axons after spinal cord injury is to produce vesicles in the form of endocytosis through the inner membrane of the axon. These vesicles will move to the section in a directional manner and tightly bind to the broken end. These vesicles are tightly arranged to prevent harmful substances from continuing to enter the cytoplasm, and the vesicle membranes that contact each other fuse with each other, eventually forming an orderly arranged cell membrane to achieve effective connection of the damaged axon membrane. In this process, the fusion of vesicles depends on the SNARES complex formed by SNARE family proteins and the large amount of energy provided by mitochondria to complete smoothly. The mRNA corresponding to the SNARE family proteins modified mesenchymal stem cell derived exosomes are applied at the site of spinal cord injury, which can increase the number of SNARE family proteins at the broken end of the nerve axon and increase the rate of vesicle membrane fusion. The application of syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes at the site of spinal cord injury can increase the level of syntaphilin protein at the axon stump, thereby docking a large number of mitochondria to provide sufficient energy for the vesicle membrane fusion process at the axon stump.

[0024] Polyethylene glycol is inexpensive, stable, non-toxic, and has complete biocompatibility, water solubility, and in situ sustained release. In the present invention, polyethylene glycol plays a role in the sustained release of exosomes in the polyethylene glycol complex, ensuring that the polyethylene glycol complex continuously releases the modified exosomes at the site of spinal cord injury to perform the corresponding functions. Polyethylene glycol dehydrates the cell membrane of neurons or axons, causing the protein and lipid structural elements to decompose each other, thereby eliminating membrane rupture. In addition, polyethylene glycol can also promote membrane resealing by reducing the surface tension of the neuron or axon membrane and enhancing membrane fluidity, which is a condition that is conducive to the resealing of the neuron or axon membrane. Polyethylene glycol immediately seals and gradually eliminates membrane damage, reducing Ca 2+ PEG enters neurons or axons through membrane ruptures and interacts with mitochondria, inhibiting the formation of mitochondrial permeability transition pores and related oxidative stress, thereby preventing the reaction with O 2- There is a further increase in membrane permeability associated with H2O2 production.

[0025] In summary, the above components work synergistically to restore the continuity of spinal nerve fibers by inhibiting inflammation, anti-oxidation, angiogenesis, inhibiting cell apoptosis, inhibiting cell ferroptosis, inhibiting glial scar formation, and promoting vesicle membrane fusion and repair at the axonal ends, thereby restoring the neural function below the spinal cord injury plane. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 Magnetic resonance imaging (MRI) images of beagle dogs in treatment group 1 and control group 1 two months after surgery;

[0028] Figure 1 A in the figure is the nuclear magnetic T2-weighted image of the beagle dog in the treatment group 1, and B is the nuclear magnetic T2-weighted image of the beagle dog in the control group 1;

[0029] Figure 2 Diffusion tensor imaging (DTI) images of beagle dogs in treatment group 1 and control group 1 two months after surgery;

[0030] Figure 2 A in the figure is the DTI image of the beagle dogs in treatment group 1, and B is the DTI image of the beagle dogs in control group 1;

[0031] Figure 3Electrophysiological examination images of beagle dogs in control group 2 and treatment group 2 before and after spinal cord injury;

[0032] Figure 3 A is the electrophysiological examination image of the beagle dogs in treatment group 2 before injury, B is the electrophysiological examination image of the beagle dogs in treatment group 2 2 months after spinal cord injury and surgery, C is the electrophysiological examination image of the beagle dogs in control group 2 before injury, and D is the electrophysiological examination image of the beagle dogs in control group 2 2 months after spinal cord injury and surgery;

[0033] Figure 4 Transmission electron microscopy images of exosomes;

[0034] Figure 5 The results of Western blotting analysis of exosomes. DETAILED DESCRIPTION

[0035] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0036] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0037] The polyethylene glycol 600 in the following examples is a sterile liquid stock solution provided by Sigma; the mesenchymal stem cell-derived exosomes are exosomes secreted from autologous umbilical cord mesenchymal stem cells; miRNA-138-5p (upstream primer Seq_1AGCTGGTGTTGTGAATCAGGCCG, downstream primer Seq_2TGGTGTCGTGGAGTCG), miRNA-21 (upstream primer Seq_3ATGGCTGTACCACCTTGTCGGATA, downstream primer Seq_4AGCATGCCTGCTATTGTCTTCCCA), lncGm36569 (upstream primer Seq_5TCATTTCTCTGCCGCTTCCA, downstream primer Seq_6AAAGAGCTCCTGTTTTCTGTACC), SN The mRNA corresponding to the ARE family protein Syntaxin-7 (upstream primer Seq_7CGGAATTCCCATGTCTTACACTCCA, downstream primer Seq_8AATGCGGCCGCTCAGTGGTTCAATC), the mRNA corresponding to SNAP47 (upstream primer Seq_9AAGCTTATGAGTTCTGATATGCGTGTCC, downstream primer Seq_10CTCGAGCTACATCAGCTTTCTCATACGC), and the mRNA of syntaphilin (upstream primer Seq_11GCCCTCCACCTCTCCCTC, downstream primer Seq_12GCGAAGGCTTCCATGGTTTG) are all commercially available products (purchased from Anornor Biotechnology).

[0038] The method for obtaining mesenchymal stem cell-derived exosomes is to collect exosomes secreted by umbilical cord mesenchymal stem cells from the culture medium by ultracentrifugation. Simply put, the complete culture medium is centrifuged at 800g for 10 minutes at 4°C, at 3000g for 30 minutes, and further centrifuged at 10000g for 1 hour, and then the supernatant is filtered using a 0.22μm filter to remove cells and debris. The supernatant was ultracentrifuged twice at 120000g for 2 hours each time. The mesenchymal stem cell exosome pellet was resuspended in 200μL phosphate-buffered saline to obtain an exosome suspension. Transmission electron microscopy and Western blot analysis were used to verify the formation of exosomes. Figure 4 Transmission electron microscope image. Figure 5 Western blot analysis showed that the specific markers CD63 and CD81 on the surface of exosomes were highly expressed (Calnexin is a recombinant human calnexin, which is an internal reference for Western blot analysis). The above identification results showed that the exosomes derived from mesenchymal stem cells were successfully collected.

[0039] Exo-Fect gene transfection technology was used to prepare the corresponding nucleic acid-modified mesenchymal stem cell-derived exosomes. Briefly, miRNA-138-5p, miRNA-21, lncGm36569, mRNA corresponding to SNARE family proteins, and syntaphilin mRNA were mixed with mesenchymal stem cell-derived exosome suspension ((50-300) μg / 500 μL) and Exo-Fect reagent (Biomars, Beijing), PBS buffer at 2:5:1:7 (v / v / v / v), and heated at 37°C for 10 minutes. Then, it was mixed with Exo-Quick reagent (Biomars, Beijing) at a ratio of 5:1 (v / v) on ice for 30 minutes, and finally centrifuged at 13000g for 5 minutes at 4°C. The supernatant and precipitate were separated, and the corresponding modified mesenchymal stem cell-derived exosomes were collected and resuspended in phosphate-buffered saline.

[0040] Example 1

[0041] This embodiment provides a polyethylene glycol complex, the formula is as follows:

[0042] miRNA-138-5p modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3×10 9 1.86 g of miRNA-21 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 3×10 9 1.71 g, lncGm36569 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 3×10 9 1.49 g of SNARE family protein mRNA (the mass ratio of Syntaxin-7 mRNA and SNAP47 mRNA is 1:1) modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles is 3×10 9 1.99 g of syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3 × 10 9 The amount of each) was 1.94 g, and the amount of polyethylene glycol 600 was 91.11 g.

[0043] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol complex, comprising: taking the raw materials according to the above-mentioned formula and mixing them evenly under sterile conditions.

[0044] Example 2

[0045] This embodiment provides a polyethylene glycol complex, the formula is as follows:

[0046] miRNA-138-5p modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3×10 9 1.86 g of miRNA-21 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 3.5×10 9 2 g, lncGm36569 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 4×10 9 1.99 g of SNARE family protein mRNA (the mass ratio of Syntaxin-7 mRNA and SNAP47 mRNA is 1:1) modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles is 1.6×10 9 1.07 g of syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3 × 10 9 The amount of each) was 1.94 g, and the amount of polyethylene glycol 600 was 91.14 g.

[0047] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol complex, comprising: taking the raw materials according to the above-mentioned formula and mixing them evenly under sterile conditions.

[0048] Example 3

[0049] This embodiment provides a polyethylene glycol complex, the formula is as follows:

[0050] miRNA-138-5p modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3×10 9 1.86 g of miRNA-21 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 3×10 9 1.71 g, lncGm36569 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 4×10 9 1.99 g of SNARE family protein mRNA (the mass ratio of Syntaxin-7 mRNA and SNAP47 mRNA is 1:1) modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles is 2×10 9 1.33 g of syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3 × 10 9 The amount of each) was 1.94 g, and the amount of polyethylene glycol 600 was 92.36 g.

[0051] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol complex, comprising: taking the raw materials according to the above-mentioned formula and mixing them evenly under sterile conditions.

[0052] Example 4

[0053] This embodiment provides a polyethylene glycol complex, the formula is as follows:

[0054] miRNA-138-5p modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 2×10 9 1.24 g of miRNA-21 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 2×10 9 1.14 g, lncGm36569 modified mesenchymal stem cell derived exosomes (the total number of vesicle particles was 2×10 9 1 g of SNARE family protein mRNA (the mass ratio of Syntaxin-7 mRNA and SNAP47 mRNA is 1:1) modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles is 3×10 9 1.99 g of syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes (the total number of vesicle particles was 3 × 10 9 The content of 1.94 g of each component and 92.69 g of polyethylene glycol 600 were used.

[0055] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol complex, comprising: taking the raw materials according to the above-mentioned formula and mixing them evenly under sterile conditions.

[0056] Experimental Example 1

[0057] This experimental example investigates the effect of the polyethylene glycol complex of Example 1 of the present invention in treating spinal cord injury in animals, comprising the following steps:

[0058] 1. Material preparation:

[0059] 1.1 Animal selection and grouping: 8 6-month-old female beagle dogs were randomly divided into treatment group 1 and control group 1, with 4 dogs in each group. The treatment group 1 included P1, P2, P3, and P4, and the control group 1 included C1, C2, C3, and C4.

[0060] 1.2 Experimental drugs: Drugs in treatment group 1: the polyethylene glycol complex in Example 1, wherein the mesenchymal stem cell-derived exosomes are exosomes secreted by autologous mesenchymal stem cells; Drugs in control group 1: normal saline.

[0061] 2. Model construction: A complete spinal cord transection model at the 10th thoracic vertebra (T10) level was constructed in beagle dogs in control group 1 and treatment group 1.

[0062] 3. Treatment group 1 was treated with local instillation of the polyethylene glycol complex (2 ml) of Example 1 at the stump of the spinal cord, and control group 1 was treated with 2 ml of normal saline.

[0063] 4. Postoperative observation: cBBB scoring was performed one day before establishing the T10 level spinal cord complete transection model and on days 0, 4, 7, 14, 21, 28, 42, and 56 after surgery (for cBBB scoring standards, see "Adaptation of the Basso-Beattie-Bresnahan locomotive rating scale for use in a clinical model of spinal cord injury in dogs", Rachel B. Song, D. Michele Basso, Ronaldo C. da Costa, Lesley C. Fisher, Xiaokui Mo, Sarah A. Moore, Journal of Neuroscience Methods 268 (2016) 117-124).

[0064] The cBBB scoring results are shown in Table 1.

[0065] Magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI) were performed two months after surgery to detect the continuity of spinal nerve fibers. The test results are shown in Figure 1 .

[0066] Table 1 cBB scores of treatment group 1 and control group 1

[0067]

[0068] Day -1 in Table 1 refers to the day before the T10 level spinal cord complete severance model was constructed. As shown in Table 1, the motor function of the hind limbs after spinal cord injury was normal. Day 0 refers to the day when the T10 level spinal cord complete severance model was constructed, at which time the hind limbs were completely paralyzed. Surgical treatment was performed on the day of complete spinal cord severance.

[0069] Figure 1 A in the figure is the nuclear magnetic T2-weighted image of the beagle dog in the treatment group 1, and B is the nuclear magnetic T2-weighted image of the beagle dog in the control group 1; Figure 2 A in the figure is the DTI image of the beagle dogs in treatment group 1, and B is the DTI image of the beagle dogs in control group 1.

[0070] Depend on Figure 1 From A and B in Figure 1, we can see that the spinal cord continuity of the control group 1 was not restored, while the spinal cord of the treatment group 1 was restored. Figure 2 As shown in A and B, there was no fiber bundle connection at the severed end of the spinal cord in the control group 1, while fused fiber bundles were seen across the injured area in the treatment group 1 after surgery.

[0071] From Table 1, Figure 1 and Figure 2It can be seen that the motor function recovery of beagles in treatment group 1 was better than that in control group 1, and it was statistically significant (P<0.05 on 56 days after surgery).

[0072] The above research results show that the use of the polyethylene glycol complex of the present invention can quickly reconnect severed spinal nerve fibers and restore the motor and sensory functions below the spinal cord injury level in a short period of time.

[0073] Experimental Example 2

[0074] This experimental example investigates the effects of the polyethylene glycol complex of Example 2 of the present invention and the positive control drug pure polyethylene glycol in treating spinal cord injury in animals, and comprises the following steps:

[0075] 1. Material preparation:

[0076] 1.1 Animal selection and grouping: 8 6-month-old female beagle dogs were randomly divided into treatment group 2 and control group 2, with 4 dogs in each group. The treatment group 2 consisted of P1', P2', P3', and P4', and the control group 2 consisted of C1', C2', C3', and C4'.

[0077] 1.2 Experimental drugs: Drugs in treatment group 2: the polyethylene glycol complex in Example 2, wherein the mesenchymal stem cell-derived exosomes are exosomes secreted from autologous mesenchymal stem cells; Drugs in control group 2: PEG-600.

[0078] 2. Model construction: A complete spinal cord transection model at the 10th thoracic vertebra (T10) level was constructed in beagle dogs in control group 2 and treatment group 2.

[0079] 3. Treatment group 2 was treated with local instillation of the polyethylene glycol complex (2 ml) of Example 2 at the stump of the spinal cord, and control group 2 was treated with 2 ml of PEG-600.

[0080] 4. Postoperative observation: cBBB scoring was performed on the day before surgery and on days 0, 4, 7, 14, 21, 28, 42, and 56 after surgery (for cBBB scoring standards, see “Adaptation of the Basso-Beattie-Bresnahan locomotor rating scale for use in a clinical model of spinal cord injury in dogs”, Rachel B. Song, D. Michele Basso, Ronaldo C. da Costa, Lesley C. Fisher, Xiaokui Mo, Sarah A. Moore, Journal of Neuroscience Methods 268 (2016) 117-124).

[0081] The cBBB scoring results are shown in Table 2.

[0082] Table 2 cBB scores of treatment group 2 and control group 2

[0083]

[0084] 5. Electrophysiological examination (MEP, motor evoked potential) was performed on beagle dogs before spinal cord injury and two months after spinal cord injury and surgery. The results are shown in Figure 2 .

[0085] Figure 3 A is the electrophysiological examination image of the beagle dogs in treatment group 2 before injury, B is the electrophysiological examination image of the beagle dogs in treatment group 2 two months after injury and surgery, C is the electrophysiological examination image of the beagle dogs in control group 2 before injury, and D is the electrophysiological examination image of the beagle dogs in control group 2 two months after injury and surgery.

[0086] Depend on Figure 3 It can be seen that the electrophysiological amplitudes of the control group 2 and the treatment group 2 before injury were similar, both of which were normal amplitudes; two months after injury and surgery, the spinal cord electrical signal conduction of the control group 2 and the treatment group 2 was restored to a certain extent, but the MEP waveform amplitude of the treatment group 2 was significantly higher than that of the control group 2.

[0087] From Table 2 and Figure 3 It can be seen that the motor function of the beagle dogs in the control group 2 was restored to a certain extent, and the spinal cord electrical signal conduction was partially restored, but the motor function and electrical signal conduction recovery of the beagle dogs in the treatment group 2 were better than those in the control group 2, and it was statistically significant (P<0.05 on 56 days after surgery).

[0088] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the scope of protection of the invention.

Claims

1. A polyethylene glycol complex, characterized in that: Calculated in mass percentage, it includes: 1-2% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1-2% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1-2% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1-2% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1-2% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and the balance is polyethylene glycol.

2. The polyethylene glycol complex according to claim 1, characterized in that The relative molecular mass of polyethylene glycol is 400-1500; Optionally, the molecular weight of the polyethylene glycol is 400, 600, 1000 or 1500.

3. The polyethylene glycol complex according to claim 1, characterized in that The SNARE family proteins include at least one of Syntaxin-7 and Snap47.

4. The polyethylene glycol complex according to any one of claims 1 to 3, characterized in that Mesenchymal stem cell-derived exosomes are exosomes secreted by autologous mesenchymal stem cells.

5. The polyethylene glycol complex according to any one of claims 1 to 3, characterized in that In terms of mass percentage, they include: 1.86% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1.71% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.49% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.99% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1.94% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 91.02% of polyethylene glycol.

6. The polyethylene glycol complex according to any one of claims 1 to 3, characterized in that: In terms of mass percentage, they include: 1.86% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 2% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.99% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.07% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1.94% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 91.14% of polyethylene glycol.

7. The polyethylene glycol complex according to any one of claims 1 to 3, characterized in that In terms of mass percentage, the content includes: 1.84% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1.69% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.97% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.31% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1.92% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 91.27% of polyethylene glycol; or In terms of mass percentage, they include: 1.24% of mesenchymal stem cell-derived exosomes modified by miRNA-138-5p, 1.14% of mesenchymal stem cell-derived exosomes modified by miRNA-21, 1.00% of mesenchymal stem cell-derived exosomes modified by lncGm36569, 1.99% of mesenchymal stem cell-derived exosomes modified by mRNA of SNARE family proteins, 1.94% of mesenchymal stem cell-derived exosomes modified by mRNA of syntaphilin, and 92.69% of polyethylene glycol.

8. A method for preparing the polyethylene glycol complex according to any one of claims 1 to 7, characterized in that: The following steps are involved: Polyethylene glycol, mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, mesenchymal stem cell-derived exosomes modified with miRNA-21, mesenchymal stem cell-derived exosomes modified with lncGm36569, mesenchymal stem cell-derived exosomes modified with mRNA of SNARE family protein, and mesenchymal stem cell-derived exosomes modified with mRNA of syntaphilin were mixed evenly according to the mass percentage.

9. Use of the polyethylene glycol complex according to any one of claims 1 to 7 or the polyethylene glycol complex prepared according to the preparation method according to claim 8 in drugs for treating diseases of nervous system damage; Optionally, the nervous system injury disease is one or more of spinal cord injury, brain injury or peripheral nerve injury.

10. Use of the polyethylene glycol complex according to any one of claims 1 to 7 or the polyethylene glycol complex prepared according to the preparation method according to claim 8 in a drug for treating one or more of the following conditions caused by spinal cord injury: membrane rupture of spinal neurons or axons, inflammatory response, oxidative stress, ischemia, apoptosis, ferroptosis, and glial scar formation.

Images