Application of transcription factor BnaMYB52 and coding gene thereof in regulating oil content and lignin content of rape

Abstract

The invention discloses application of a transcription factor BnaMYB52 in regulation and control of oil content and lignin content of rape seeds. The amino acid sequence of the transcription factor BnaMYB52 is shown as SEQ ID NO.5, or other amino acid sequences which are derived from the amino acid sequence shown as SEQ ID NO.5 through substitution and / or deletion and / or addition of one or more amino acid residues and have the same protein function. An agrobacterium tumefaciens-mediated genetic transformation method is used for performing overexpression and gene editing on the BnaMYB52 gene respectively, and it is found that the BnaMYB52 gene negatively regulates and controls the oil content of rape seeds and positively regulates and controls the lignin content. The method disclosed by the invention has very important application prospects in high-oil-content breeding of the rape and quality improvement of the rape cake meal.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and seed and seedling cultivation, and specifically relates to a rapeseed MYB gene family gene ( BnaMYB52 The application of the gene and its encoded protein in breeding new rapeseed varieties, especially in creating rapeseed germplasm with high oil content and low lignin content. Background Art

[0003] Rapeseed meal is rich in methionine, cysteine ​​and antioxidant substances, and is a high-quality animal feed. Lignin is an anti-nutrient, and its presence reduces the nutritional value of rapeseed meal to animals. Therefore, studying the functional genes that affect the synthesis of oil and lignin can further increase the oil content of rapeseed, improve the quality of rapeseed meal, and increase the benefits of rapeseed cultivation.

[0004] The Arabidopsis genome contains 126 R2R3-MYB members, which can be clustered into 25 subgroups, including MYB52 Clustered into S21 subgroup, MYB52 and MYB54 The closest relative is MYB52 (Dubos et al 2010). Previous studies have shown that MYB52 and ERF4 interact (at the protein level) in Arabidopsis, competitively binding PMEI6, PMEI14 and SBT1.7 , thereby regulating the formation of seed coat mucilage (Shi et al 2018, Ding et al 2021). Another study showed that HbMYB52 When the gene is overexpressed in Arabidopsis, the formation of secondary wall in the stem is affected (Qiu Jian et al. 2016). MYB52 The gene is also involved in the regulation of various adversities. The soybean roots were treated with ABA, low temperature (4°C), sodium chloride and PEG respectively. GmMYB52 The expression level of MYB52 Participate in the response to abiotic stress (Xu Ling et al 2017). According to the published database of the Brassica napus genome (http: / / cbi.hzau.edu.cn / bnapus / ), Blast analysis showed that there are four MYB52The homologous genes of BnaA09G0615900ZS are located on chromosomes A09 (BnaA09G0615900ZS), A08 (BnaA08G0259100ZS) and C08 (BnaC08G0471400ZS and BnaC08G0242900ZS) respectively. The transcriptome database of Brassica napus Zhongshuang 11 (http: / / yanglab.hzau.edu.cn / ) was used for analysis. BnaA09G0615900ZS and BnaC08G0471400ZS were highly expressed in the siliques and stems 30 days after flowering; while BnaA08G0259100ZS and BnaC08G0242900ZS were only highly expressed in the stems. This indicates that BnaA09G0615900ZS and BnaC08G0259100ZS and BnaC08G0242900ZS are highly expressed in the stems. MYB52 Homologous genes may have functional differentiation.

[0005] In the early stage, our research group used the seed husk rate of rapeseed related populations for association analysis and identified a husk rate QTL on chromosome A09 (the husk rate was significantly negatively correlated with oil content). Through comprehensive analysis of candidate genes, MYB52 As an important candidate gene. MYB52 In terms of gene function research, a previous study was conducted by Yu Ruilu (2022) in which the Arabidopsis myb52 mutant overexpressed MYB52 The gene can restore the mutant seed epidermal mucilage to wild-type levels and affect the seed germination rate, but this study did not test it in rapeseed. MYB52 Functional studies were conducted, and the oil content of seeds was not measured. MYB52 It is involved in many important biological processes such as seed coat mucilage, secondary wall development, fiber composition, husk rate, and stress response, but its genetic and molecular mechanisms need to be further studied.

[0006] The present invention cloned rape BnaMYB52 Gene, with 35S Promoter start BnaMYB52 The high expression of the gene resulted in rapeseed seeds with significantly reduced oil content and significantly increased lignin content. BnaMYB52 The mutant of the gene obtained rapeseed seeds with significantly increased oil content and significantly reduced lignin content. BnaMYB52 The gene plays an important role in regulating the accumulation of oil content and lignin synthesis in rapeseed seeds, and has important application prospects in creating rapeseed germplasm with high oil content and high-quality cake. Summary of the invention

[0007] The first object of the present invention is to provide a transcription factor BnaMYB52 Application in regulating seed oil content and lignin content.

[0008] BnaMYB52 The gene has one copy each on rapeseed chromosomes A08 and A09, and two copies on rapeseed chromosome C08, which are BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 (BnaC08G0199000WE). The nucleotide sequences of the gene are shown in the sequence listing SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectively, and consist of 729 bp, 744 bp, 744 bp and 729 bp; the protein sequences encoded by the gene are shown in the sequence listing SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, respectively, and encode 242, 247, 247 and 242 amino acids, respectively.

[0009] The applicant used Agrobacterium-mediated genetic transformation to transform BnaMYB52 The overexpression vector driven by the constitutive promoter was transformed into the genome of rapeseed to obtain BnaMYB52 Overexpressed rapeseed germplasm, and gene editing technology using CRISPR / Cas9 BnaMYB52 Then, the oil content and lignin content of seeds of overexpression and mutant transformed materials were measured and it was found that BnaMYB52 Negatively regulates rapeseed seed oil content and positively regulates lignin content.

[0010] The second object of the present invention is to provide a method for creating rapeseed germplasm with high oil content and low lignin content.

[0011] To achieve the above purpose, the applicant uses Agrobacterium-mediated genetic transformation to transform the gene containing the transcription factor BnaMYB52 The CRISPR / Cas9 gene editing vector encoding the gene was transformed into the rapeseed genome, and the CRISPR / Cas9 gene editing technology was used to obtain BnaMYB52 Rapeseed varieties with missing gene functions.

[0012] Wherein, the transcription factor BnaMYB52 The method for constructing a CRISPR / Cas9 gene editing vector encoding a gene includes the following steps: 1) According to BnaMYB52 Screen gene editing targets and design primers using gene and homologous gene sequences; 2) Using the pCBC-DT1T2 plasmid as a template, perform PCR amplification using the designed primers; 3) Ligate the PCR product with the pKSE401 plasmid; 4) Transform competent E. coli, screen positive clones and sequence them. The vector with the correct sequence is BnaMYB52 CRISPR / Cas9 gene editing vector.

[0013] Furthermore, the sequence of the gene editing target is: sgRNA1:ATAACGCTGTAAAAACCAT; sgRNA2: GCTGCGACGATTGGTTATGA.

[0014] The primer sequences are: DT1-BsF: ATATATGGTCTCGATTG ATAACGCTGTTAAAAACCAT GTT DT1-F0: TG ATAACGCTGTTAAAAACCAT GTTTTAGAGCTAGAAATAGC DT2-R0: AAC TCATAACCAATCGTCGCAGC CAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAAC TCATAACCAATCGTCGCAGC CAA.

[0015] The beneficial effects of the present invention are: The present invention first discovered BnaMYB52 The gene regulates the oil content and lignin content of seeds. The gene can be used to promote the accumulation of oil content in rapeseed seeds and obtain high-oil-content rapeseed germplasm. At the same time, the lignin content in rapeseed meal can be reduced, and the nutritional value and palatability of rapeseed meal to animals can be improved. The present invention has very important application prospects in the breeding of high-oil-content rapeseed and the improvement of rapeseed meal quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Picture 1 : BnaA09.MYB52 Detection of gene overexpression plants. (a) PCR identification of T0 generation overexpression transgenic plants; (b) BnaA09.MYB52 qRT-PCR detection of overexpressing plants, the values ​​in Figure b are mean ± SD.

[0017] Picture 2 :rape BnaMYB52 Identification of mutants. sgRNA1 and sgRNA2 are located in genes BnaMYB52 The exon region of BnaMYB52Four homologous genes matched, while sgRNA2 only matched BnaA09.MYB52 and BnaC08.MYB52- 1 match. bnamyb52-1 and bnamyb52-2 Both BnaMYB52 Edited homozygous quadruple mutant.

[0018] Picture 3 :rape BnaMYB52 Phenotypic identification of oil content and lignin content of overexpression and mutant materials. (a) Analysis of oil content of rapeseed seeds using near infrared. (b) Determination of seed lignin content. * indicates that the t Testing P <0.05, ** indicates that the t Testing P <0.01. DETAILED DESCRIPTION

[0019] The present invention is further defined below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in the reference book "Molecular Cloning: A Laboratory Guide" (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods recommended in the operating manual provided by the manufacturer.

[0020] Description of sequence listing: Sequence Listing SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 are genes cloned from Brassica napus Westar BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 The nucleotide sequences of (BnaC08G0199000WE) are 729 bp, 744 bp, 744 bp and 729 bp in length respectively.

[0021] Sequence Listing SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 are genes isolated from Brassica napus Westar BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1(BnaC08G0420000WE) and BnaC08.MYB52-2 The protein sequences encoded by (BnaC08G0199000WE) encode 242, 247, 247 and 242 amino acids, respectively.

[0022] Example 1 Rape BnaA09.MYB52 Gene cloning MYB52 Gene, encoding MYB DOMAIN protein, belongs to the MYB gene family. MYB52 There are four copies in rapeseed, one copy each on chromosomes A08 and A09, and two copies on chromosome C08, which are BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 (BnaC08G0199000WE). Among them, BnaA09.MYB52 and BnaC08.MYB52-1 The nucleotide sequences of the two proteins have the highest similarity, as shown in SEQ ID NO:2 and SEQ ID NO:3 in the sequence listing, and the amino acid sequences are shown in SEQ ID NO:6 and SEQ ID NO:7. BnaA09.MYB52 The nucleotide sequence is 744 bp in length and the gene encodes 247 amino acids.

[0023] (1) RNA extraction Total RNA was extracted using TansZol (catalog number ET101) from Quanshijin Company. Brassica napus 40DAF seeds were ground in liquid nitrogen, and 100 mg of the ground sample was transferred to a 1.5 mL centrifuge tube, and 1 mL of TransZol was added. The sample was mixed thoroughly by inverting several times and allowed to stand at room temperature for 5 minutes. 0.2 mL of chloroform was added, and the sample was shaken vigorously for 15 seconds and incubated at room temperature for 3 minutes. The sample was centrifuged at 10,000 × g and 4°C for 15 minutes. At this time, the sample was divided into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). The colorless aqueous phase was transferred to a new centrifuge tube, 0.5 mL of isopropanol was added, the sample was mixed by inverting, and the sample was incubated at room temperature for 10 minutes. The sample was centrifuged at 10,000 × g and 4°C for 10 minutes. The supernatant was removed and a gelatinous precipitate was formed on the side and bottom of the tube. 1 mL of 75% ethanol (prepared with DEPC-treated water) was added and vortexed vigorously. 7,500 × g Centrifuge at 4℃ for 5 minutes; discard the supernatant and dry the precipitate at room temperature; dissolve the precipitate in 50-100 μL RNA dissolution solution; incubate at 55℃ for 10 minutes. Take 1 μL of the extracted total RNA to measure the RNA concentration under Nanodrop, and identify the RNA purity based on 1.8<OD260 / OD280<2.0. At the same time, take 1 μL for 1% agrose electrophoresis to detect integrity.

[0024] (2) Synthesis of cDNA The reverse transcription was performed using the All-Gold EasyScript® One-Step gDNA Removal and cDNASynthesis SuperMix (Catalog No. AE311). Using 1 μg of total RNA as the template, 1 μL of Anchored Oligo (dT) 18 Primer, 10 μL of 2×ES Reaction Mix, 1 μL of EasyScript® RT / RI Enzyme Mix, 1 μL of gDNA Remover, and RNase-free Water were added to 20 μL. The above system was gently mixed and placed at 42°C for 30 minutes. This step is to synthesize the first-strand cDNA and remove gDNA. Heat at 85°C for 5 seconds to inactivate EasyScript® RT / RI and gDNARemover. Add 180 μL of RNase-free Water to dissolve the synthesized cDNA and set aside.

[0025] (3) BnaA09.MYB52 Gene amplification The above cDNA was used as template and the forward primer sequence was BnaA09.MYB52-pCAMBIA2306-F: 5' ACGGGGGACGAGCTCGGTACC ATGATGTGTAGTCGAGGACAT3', reverse primer sequence is BnaA09.MYB52-pCAMBIA2306-R: 5' TTGGTCGACTCTAGAGGATCC ACATAAACTCTGAGAGGCA 3', amplified BnaA09.MYB52 Full-length CDS fragment (stop codon removed). PCR amplification was performed using I-5™ 2×High-Fidelity Master Mix (TSINGKE Biologica technology). The PCR amplification system is as follows: 2×I-5™ 2×High-Fidelity Master Mix 25 μL Primer Forward (10 μmoL / L)2.5 μL Primer Reverse (10 μmoL / L)2.5 μL cDNA3 μL ddH2O17 μL PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 30 sec, 34 circles; total extension at 72°C for 5 min.

[0026] The amplified product was detected by agarose gel electrophoresis, and 729 bp was obtained. BnaA09.MYB52 The full-length CDS sequence was recovered using the Tiangen Agarose Gel Recovery Kit (http: / / www.tiangen.com / ).

[0027] Example 2 BnaA09.MYB52 Construction of gene overexpression transformation vector (1) Use fast restriction endonuclease Kpn I and Bam HI double restriction enzyme digestion vector pCAMBIA2306, double restriction enzyme digestion system is as follows: 5×Fast digestion buffer:10 μL Kpn I: 1 μL Bam HI: 1 μL Recovered product / plasmid: 20 μL ddH2O: 18 μL The enzyme digestion reaction was carried out in a 37°C water bath for 3 hours. The enzyme digestion product was recovered using the Tiangen DNA purification kit.

[0028] (2) The gene CDS fragment was ligated into the vector 35S-pCAMBIA2306, which contains a constitutive expression promoter and an antibiotic marker.

[0029] The connection method is as follows: BnaA09.MYB52 Amplified fragment: 6 μL Fragments recovered after vector digestion: 1 μL Exnase II (Vazyme): 1 μL 5×CE II buffer: 2 μL Ligation reaction conditions: 37°C for 30 min.

[0030] (3) Transformation into E. coli DH5α: Pipette 10 µL of the ligation product and add it to 50 µL of DH5α competent cells, mix by pipetting, and place on ice for 30 min; place in a 42°C water bath for 1.5 min, and place on ice for 3 min; add 400 µL of liquid LB medium without antibiotics, and activate it in a shaker at 37°C, 150 r / min for 45-60 min; pipette 200 µL of the activated bacterial solution and spread it on a solid LB medium with corresponding resistance, and invert and culture at 37°C for 12-16 h. After screening the positive clones, extract the plasmid for restriction enzyme digestion identification, and select 3 positive clones for sample sequencing. The analysis results show that BnaA09.MYB52 The CDS sequence of the gene was successfully connected to the vector, and the plant expression vector 35S-pCAMBIA2306 for the transformed plant was successfully constructed. - BnaA09.MYB52.

[0031] (4) Introduce the correctly constructed recombinant plasmid vector into the Agrobacterium strain GV3101, select the positive single clone and store it in a -80℃ refrigerator. The introduction method is as follows: a. Clean the electric rotating cup: first wash it with pure water, then wash it with ultrapure water, pour it out, then wash it with anhydrous ethanol (blowing it with a 1 mL pipette tip), pour out the anhydrous ethanol, and place it on a clean bench to dry; b. Take 50 μL of Agrobacterium competent GV3101; c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent medium. Mix by gently pipetting to avoid bubbles. d. Place the washed and dried electric rotating cup in ice to pre-cool, and then pour the above mixture into the cup wall; e. Adjust the electroporator to 1800 V; f. Take the electroporation cup out of the ice and clean the outer wall of the electroporation cup with absorbent paper; g. Place the electric rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, it is successful. h. After successful electroporation, add 400 μL of antibody-free LB to the electroporation cup, pipette and mix, and transfer to a sterile centrifuge tube; i. Activate at 28℃ for about 1h, apply 100 μL onto a plate containing the corresponding resistance, seal with sealing film, invert and incubate at 28℃ for 2 days, and perform spot detection.

[0032] (5) Agrobacterium colony detection Select colonies and culture them in double-antibody LB at 28°C for 1 hour. Take an appropriate amount of bacterial solution for PCR detection and save the positive Agrobacterium bacterial solution.

[0033] Example 3 BnaMYB52- Construction of CRISPR vectors Using the sgRNA-Cas9 system of Chen Qijun's team from the College of Life Sciences of China Agricultural University to create rapeseed BnaMYB52 Mutants. The experimental steps are as follows: (1) Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / and select the target sgRNA1: ATAACGCTGTTAAAAACCAT and sgRNA2: GCTGCGACGATTGGTTATGA, which are located in the gene BnaA09.MYB52 and BnaC08.MYB52-1 The second exon region of BnaA08.MYB52 and BnaC08.MYB52-2 Only sgRNA1 is located in the second exon of the gene. Therefore, sgRNA1 can target all BnaMYB52 Gene ， While sgRNA2 can target BnaA09.MYB52 and BnaC08.MYB52-1 .

[0034] (2) Primer design DT1-BsF: ATATATGGTCTCGATTG ATAACGCTGTTAAAAACCAT GTT DT1-F0: TG ATAACGCTGTTAAAAACCAT GTTTTAGAGCTAGAAATAGC DT2-R0: AAC TCATAACCAATCGTCGCAGC CAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAAC TCATAACCAATCGTCGCAGC CAA (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100 times as the template. DT1-BsF and DT2-BsR are normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20 times. The amplification system is: 2×I-5™ 2×High-Fidelity Master Mix: 25 μL DT1-BsF (10 μmol / L): 2 μL DT2-BsR (10 μmol / L): 2 μL DT1-F (0.5 μmol / L): 2 μL DT2-R0 (0.5 μmol / L): 2 μL pCBC-DT1T2 plasmid: 3 μL ddH2O: 14 μL PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 sec, annealing at 56°C for 25 sec, extension at 72°C for 25 sec, 34 circles; total extension at 72°C for 5 min.

[0035] (4) Purify and recover the PCR product and establish the following restriction-ligation system: PCR fragment: 2 μL pKSE401: 2 μL 10×NEB T4 Buffer:1.5 μL 10×BSA: 1.5 μL BsaI (NEB): 1 μL T4 Ligase (NEB): 1 μL ddH2O: 6 μL Reaction conditions: 5 h at 37°C, 5 min at 50°C, 10 min at 80°C (5) Transformation of E. coli DH5α: Take 5 μL of the competent cells for transformation, screen with Kan plate, identify the positive clones by PCR and sequence them. The vector with the correct sequence is BnaMYB52 CRISPR vectors.

[0036] (6) Introduce the correctly constructed recombinant plasmid vector into the Agrobacterium strain GV3101, select the positive single clone and store it in a -80℃ refrigerator. The introduction method is as follows: a. Clean the electric rotating cup: first wash it with pure water, then wash it with ultrapure water, pour it out, then wash it with anhydrous ethanol (blowing it with a 1 ml pipette tip), pour out the anhydrous ethanol, and place it on a clean bench to dry; b. Take 50 μl of competent Agrobacterium GV3101; c. Take 1 μl of the correctly constructed recombinant plasmid and add it to 50 μl of competent medium. Mix by gently pipetting to avoid bubbles. d. Place the washed and dried electric rotating cup in ice to pre-cool, and then pour the above mixture into the cup wall; e. Adjust the electroporator to 1800 V; f. Take the electroporation cup out of the ice and clean the outer wall of the electroporation cup with absorbent paper; g. Place the electric rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, it is successful. h. After successful electroporation, add 400 μl of antibody-free LB to the electroporation cup, pipette a few times, and transfer to a sterile centrifuge tube; i. Activate at 28℃ for about 2 hours, apply 100 μl to the plate containing double antibody, seal with sealing film, invert and incubate at 28℃ for 2 days, and detect by spot picking.

[0037] (7) Agrobacterium colony detection Select colonies and culture them in double-antibody LB at 28°C for 2 hours. Take an appropriate amount of bacterial solution for PCR detection and save the positive Agrobacterium bacterial solution.

[0038] Example 4 Genetic transformation experiment (1) Genetic transformation of rapeseed For the constructed BnaA09.MYB52 Overexpression vectors and BnaMYB52 -CRISPR vector for genetic transformation of rapeseed, using Agrobacterium-mediated genetic transformation method, the receptor used for rapeseed transformation in the present invention is Brassica napus Westar, the specific operation process is detailed in reference: An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus . (2) Identification of overexpression transformed cells The genomic DNA of the obtained rapeseed overexpression transformed plant was extracted, and the insertion of the exogenous gene fragment was detected by PCR. The overexpression backbone vector in the present invention was 35S-pCAMBIA2306. The primer pCAMBIA2306-R (5'-CATGGTGGCAAATTCTGATCC-3') was designed on the vector backbone. PCR was performed by matching the vector backbone primer with the exogenous fragment primer (the sequence of BnaA09.MYB52-pCAMBIA2306-F is shown in Example 1). The transgenic seedlings were detected at the PCR level ( Picture 1 a). PCR system: Taq polymerase Mix 5 µL; pCAMBIA2306-R (10 μmol / L) 0.5 µL; BnaA09.MYB52-pCAMBIA2306-F (10 μmol / L) 0.5 µL; gDNA 1 µL; ddH2O 3 µL. PCR conditions: 94℃ total denaturation 5 min; 94℃ denaturation 30 sec, 58℃ annealing 30 sec, 72℃ extension 1 min, 34 circles; 72℃ total extension 5 min.

[0039] qRT-PCR was performed on the transgenic positive seedlings of rapeseed obtained by PCR to detect the gene expression. RNA was extracted from the leaves of the transformed individual plants and cDNA was synthesized (the method was the same as in Example 1). Quantitative primers were designed using Primer 5 software, and the product size was between 80-250 bp. After design, BLAST comparison was performed with the reference sequence to ensure the specificity of primers BnMYB52-RT-F (5'-ACCGCAAGCACTATCAGTTATCC-3') and BnMYB52-RT-R (5'-GTTGTGATTGTGGCTGTGTTCAG-3'). BnaACTIN7-L (5'-CGCGCCTAGCAGCATGAA-3') and BnaACTIN7-R (5'-GTTGGAAAGTGCTGAGAGATGCA-3') were used as internal reference primers for rapeseed qRT-PCR (see Zhou et al 2012: BnMs3 is required for tapetal differentiation and degradation, microsporeseparation, and pollen-wall biosynthesis in Brassica napus ). The reaction system is: cDNA diluted 10 times: 6.9 μL Primer 1 (10 μM): 0.3 μL Primer 2 (10 μM): 0.3 μL 2×TransStart® Green qPCR SuperMix: 7.5 μL The reaction program was as follows: 94°C for 30 s, 94°C for 10 s, 60°C for 15 s, and 72°C for 30 s, for 45 cycles; a melting curve was drawn. qRT-PCR was performed in a Bio-Rad CFX96 Real-Time System.

[0040] The results were standardized according to the internal reference primers, and the quantitative variation between different replicates was determined by delta-deltaathreshold cycle relative quantification (2 -ΔΔCT ) method. Finally, the relative expression levels of rapeseed overexpression transformed plants OE-1 and OE-2 were obtained by analysis ( Picture 1 b).

[0041] (3) Identification of CRISPR-transformed strains The obtained rapeseed CRISPR transformed individual plants were sequenced to screen rapeseed mutants. First, the Cas9 protein was identified using primers Cas9-570-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-570-R (5'-TAGTGATCTGCCGTGTCTC-G-3'), and the target gene was specifically amplified and sequenced for the Cas9 protein positive individual plants. The method for specific amplification of the target gene is: specific amplification using primers MYB52(A8)-CRISPR-F (5'-GAGATGGTTTAATCAACTGGATCC-3') and MYB52(A8)-CRISPR-R (5'-CATCAGGTTCTACTCGAATGCAC-3') BnaA08.MYB52 ; MYB52(A9)-CRISPR-F (5'-GAATCCTAGAATTAACCGAAACCC-3') and MYB52(A9)-CRISPR-R (5'-ATAAGAAGTTGCAGACTTGTTGCA-3') specific amplification BnaA09.MYB52 ; MYB52(C8-1)-CRISPR-F (5'-TCCTAGAATTAACCGAAACCCGT-3') and MYB52(C8-1)-CRISPR-R (5'-CACACAAGCAAGCATGTGCATAT-3') specific amplification BnaC08.MYB52-1; MYB52(C8-2)-CRISPR-F (5'-AGATGGTTTAATCAACTGGATCCT-3') and MYB52(C8-2)-CRISPR-R (5'-GATGTCTGTCCTTCTACTTGCCA-3') specific amplification BnaC08.MYB52-2 , the amplification method is as follows: The PCR system was as follows: 2×Taq Master Mix 20 μL, DNA template 2 μL, F primer 1.6 μL, R primer 1.6 μL, supplemented with ddH2O to 40 μL. PCR conditions: 94℃ total denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, 32 circles; 72℃ total extension for 5 min.

[0042] The PCR products of the amplified target fragments were sequenced, and the sequencing results were analyzed using the DSDecode online website (http: / / skl.scau.edu.cn / dsdecode / ) to analyze the editing of the target site. The sequencing results showed that BnaMYB52 Two independent mutant lines in which all four homologous genes were edited ( bnamyb52-1 and bnamyb52-2 ; Picture 2 ).

[0043] Example 5 Phenotypic Analysis of Overexpression and Mutant Materials ① Determination of rapeseed seed oil content using near infrared analyzer The quality of rapeseed seeds harvested at maturity was analyzed using a near-infrared analyzer to obtain seed oil content data. The measuring instrument was provided by the National Rapeseed Engineering Technology Research Center of Huazhong Agricultural University. For detailed operation procedures, please refer to the reference: Establishment of math models of NIRS analysis for oil and protein contents in seed of Brassica napus .

[0044] The results of oil content showed that the oil content of the receptor background material Westar was 38.34±1.38, and the mutant material bnamyb52-1 and bnamyb52-2 The oil contents of OE-1 and OE-2 were 40.49±1.62% and 39.86±1.25%, respectively, while the average oil contents of seeds of OE-1 and OE-2 were 36.67±0.74% and 36.23±1.61%, respectively. Statistical analysis showed that the oil contents of the two mutants were significantly increased compared with the wild type, while the oil content of OE was significantly reduced ( Picture 3 a).

[0045] ②Measure seed lignin using a lignin content detection kit The lignin content detection kit (AKSU010M) of BOXBIO was used to extract and measure the lignin of rapeseed seeds harvested at maturity. The method was referred to the instructions of the kit. The results showed that the lignin content of the seeds of the receptor background material Westar was 15.80±1.50, and the mutant material bnamyb52-1 and bnamyb52-2 The seed lignin contents of the two mutants were 10.71±2.80% and 10.48±1.74%, respectively, while the average seed lignin contents of the OE-1 and OE-2 lines were 18.65±2.07% and 18.79±2.14%, respectively. Statistical analysis showed that the seed lignin contents of the two mutants were significantly reduced compared with the wild type, while the seed lignin content of OE was significantly increased ( Picture 3 b).

[0046] In summary, genes BnaMYB52 It plays an important role in regulating the oil content and lignin content of rapeseed seeds.

Claims

1. Transcription Factors BnaMYB52 Or its encoding gene, or the use of CRISPR / Cas9 gene editing vector or recombinant bacteria containing the gene in creating rapeseed germplasm with high oil content and low lignin content, the transcription factor BnaMYB52 The amino acid sequence is as shown in SEQ ID NO.5, or other amino acid sequences with the same protein function derived from the amino acid sequence shown in SEQ ID NO.5 by substitution and / or deletion and / or addition of one or more amino acid residues.

2. A method for creating rapeseed germplasm with high oil content and low lignin content, characterized in that: The method of using Agrobacterium-mediated genetic transformation to transform the gene containing the transcription factor described in claim 1 BnaMYB52 The CRISPR / Cas9 gene editing vector encoding the gene was transformed into the rapeseed genome, and the CRISPR / Cas9 gene editing technology was used to obtain BnaMYB52 Rapeseed varieties with missing gene functions.

3. The method for creating rapeseed germplasm with high oil content and low lignin content as claimed in claim 2, characterized in that: The transcription factor BnaMYB52 The method for constructing a CRISPR / Cas9 gene editing vector encoding a gene includes the following steps: 1) According to BnaMYB52 Screen gene editing targets and design primers using gene and homologous gene sequences; 2) Using the pCBC-DT1T2 plasmid as a template, PCR amplification was performed using the designed primers; 3) Ligate the PCR product with the pKSE401 plasmid; 4) Transform competent E. coli, screen positive clones and sequence them. The vector with the correct sequence is BnaMYB52 CRISPR / Cas9 gene editing vector.

4. The method for creating rapeseed germplasm with high oil content and low lignin content as claimed in claim 3, characterized in that: The sequences of the gene editing target are: sgRNA1: ATAACGCTGTTAAAAACCAT; sgRNA2: GCTGCGACGATTGGTTATGA.

5. The method for creating rapeseed germplasm with high oil content and low lignin content as claimed in claim 3, characterized in that: The primer sequences are: DT1-BsF: ATATATGGTCTCGATTGATAACGCTGTTAAAAACCATGTT DT1-F0: TGATAACGCTGTTAAAAACCATGTTTTAGAGCTAGAAATAGC DT2-R0: AACTCATAACCAATCGTCGCAGCCAATCTCTTAGTCGACTCTAC DT2-BsR:ATTATTGGTCTCGAAACTCATAACCAATCGTCGCAGCCAA.

Images