Application of epidermal protein gene SlituCP26 in prevention and treatment of prodenia litura

Abstract

The invention discloses application of an epidermal protein gene SlituCP26 in prevention and treatment of prodenia litura, and relates to the technical field of biology. The nucleotide sequence of the SlituCP26 gene is shown as SEQ ID NO: 1, the SlituCP26 gene is highly expressed in an indoxacarb resistant strain, dsRNA of the gene is prepared, the dsRNA is micro-injected into prodenia litura larvae, after injection, the expression level of the SlituCP26 gene is obviously reduced, the body type of the larvae is obviously reduced, the epidermis thickness is obviously reduced, and the sensitivity to indoxacarb is obviously improved. The invention also provides a SlituCP26 gene promoter, and the drug resistance of the prodenia litura can be detected through the difference in sequence after the promoter is amplified. According to the invention, the fact that the epidermal protein SlituCP26 gene participates in the effect of the prodenia litura on resisting insecticides and the formation process of a resistance mechanism is clear, and the epidermal protein SlituCP26 gene has theoretical significance on the development of new insecticides.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and more specifically, relates to application of a cuticle protein gene SlituCP26 in preventing and controlling Spodoptera litura. Background Art

[0002] Spodoptera litura is an important agricultural pest with voracious appetite and intermittent rampant damage, causing serious damage to many economic food crops in my country. Due to the large-scale use of pesticides for chemical control, the field population of Spodoptera litura has developed serious resistance to multiple pesticides. Indoxacarb, as a new type of oxadiazine insecticide, not only has a unique mechanism of action, but also has high insecticidal activity. However, in the process of long-term and large-scale use of Spodoptera litura to control Spodoptera litura, the problem of pesticide resistance has inevitably arisen.

[0003] To date, various mechanisms related to insecticide resistance have been proposed, mainly including penetration resistance, metabolic resistance, target resistance and behavioral resistance. Penetration resistance refers to reducing the penetration of insecticides into insects by changing the cuticle composition or increasing the thickness of the cuticle. The insect cuticle is the first major defense barrier to hinder the penetration of insecticides, mainly composed of chitin and cuticle proteins.

[0004] Cuticular proteins are important structural proteins in the insect cuticle. They have chitin-binding domains and can bind to chitin to form a lamellar structure in the insect cuticle. At present, a variety of cuticular protein genes have been identified in insects, and a large number of studies have confirmed that cuticular proteins are mainly involved in multiple physiological processes such as insect growth and development and stress adaptation by regulating the cuticle or affecting cuticle synthesis. In recent years, studies have found that the high expression of different types of cuticular protein genes in various insect resistant strains is closely related to the penetration resistance of insecticides. At present, 287 cuticular protein genes from 9 CP families have been identified in the genome of Spodoptera litura, but the molecular functions of these cuticular protein genes and their mechanisms of action in insecticide resistance are unclear and need further in-depth exploration. Summary of the invention

[0005] Based on the above technical problems existing in the prior art, the purpose of the present invention is to provide an application of the cuticle protein gene SlituCP26 in controlling Spodoptera litura, to reduce the resistance of Spodoptera litura to insecticides by inhibiting the expression of SlituCP26, and to detect the resistance of Spodoptera litura to insecticides.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] The SlituCP26 gene is used as a target in controlling Spodoptera litura. The nucleotide sequence of the SlituCP26 gene is shown in SEQ ID NO: 1.

[0008] Furthermore, RNAi technology was used to inhibit the expression of the cuticular protein gene SlituCP26 of Spodoptera litura, thereby reducing the penetration resistance of Spodoptera litura to indoxacarb.

[0009] Furthermore, the RNAi technology includes: using the cloned partial sequence of the SlituCP26 gene as a template, then performing PCR amplification using primers containing a T7 polymerase promoter sequence, recovering the amplified product by gel, synthesizing dsRNA in vitro, and purifying the target dsRNA using a dsRNA purification kit.

[0010] Furthermore, the nucleotide sequence of the partial sequence of the SlituCP26 gene is shown in SEQ ID NO:14.

[0011] Furthermore, the primers containing the T7 polymerase promoter sequence include: an upstream primer as shown in SEQ ID NO: 5, and a downstream primer as shown in SEQ ID NO: 7.

[0012] A SlituCP26 gene promoter related to insecticide resistance of Spodoptera litura, the nucleotide sequences of which are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0013] A pair of primers for amplifying the promoter of the SlituCP26 gene, the nucleotide sequences of which are as follows: the upstream primer is shown in SEQ ID NO:4, and the downstream primer is shown in SEQ ID NO:6.

[0014] A method for detecting the insecticide resistance of Spodoptera litura, using DNA of Spodoptera litura population as a template, cloning the corresponding promoter fragment sequence by PCR, and comparing the fluorescence activity and sequence length of the SlituCP26 gene promoter; wherein, the fluorescence activity of the sensitive population is lower than that of the resistant population; and the sequence length of the resistant population is 74bp longer than that of the sensitive population.

[0015] Furthermore, the nucleotide sequences of the PCR primers are as follows: the upstream primer is shown in SEQ ID NO:8, and the downstream primer is shown in SEQ ID NO:9.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] The present invention verifies the role of the cuticle protein gene SlituCP26 in preventing and controlling Spodoptera litura. By inhibiting its expression, the penetration effect of indoxacarb can be improved, thereby improving the insecticidal efficiency. The present invention also provides a dsRNA that can interfere with the expression of SlituCP26 in Spodoptera litura. After the corresponding dsRNA of the SlituCP26 gene is injected into the larvae of Spodoptera litura, the expression level of the SlituCP26 gene is significantly reduced, the larvae are significantly smaller, the thickness of the cuticle is significantly thinner, and after being treated with indoxacarb, the larval mortality rate is significantly increased. It can be seen that the dsRNA can significantly inhibit or silence the expression of SlituCP26, reduce the penetration resistance of Spodoptera litura to indoxacarb, and indicate that the SlituCP26 gene is involved in the effect of Spodoptera litura against insecticides, and can be used as a potential target for the prevention and control of resistant pests.

[0018] The present invention provides a method for detecting the insecticide resistance of Spodoptera litura. There are differences in the SlituCP26 promoter sequence between sensitive and resistant populations, and dual luciferase reporter analysis finds that the activity of the resistant promoter is significantly higher than that of the sensitive population. Research on the promoter region upstream of the gene will help to gain a deeper understanding of the formation process of the resistance mechanism of Spodoptera litura, and can also be used to detect whether Spodoptera litura is resistant to indoxacarb.

[0019] The invention provides a theoretical basis for monitoring and controlling insecticide resistance and developing new insecticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the expression level of SlituCP26 gene in different strains of Spodoptera litura;

[0021] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0022] Figure 2 To detect the silencing efficiency of Spodoptera litura SlituCP26 gene;

[0023] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0024] Figure 3 Morphological observation of Spodoptera litura larvae after silencing the SlituCP26 gene.

[0025] Figure 4 Detection of cuticle thickness of Spodoptera litura larvae after silencing the SlituCP26 gene;

[0026] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0027] Figure 5 Sensitivity test of Spodoptera litura larvae to indoxacarb after silencing the SlituCP26 gene;

[0028] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0029] Figure 6 Schematic diagram of the differential analysis of the SlituCP26 gene promoter sequence in sensitive and resistant populations.

[0030] Figure 7 Comparison of the promoter activity of SlituCP26 gene between sensitive and resistant strains;

[0031] Note: The results are shown as the mean and standard error of three biological replicates; different letters on the error bars indicate significant differences (P<0.05). DETAILED DESCRIPTION

[0032] To make the purpose, technical scheme and advantages of the present invention clearer, the present invention will be described in further detail below in conjunction with embodiment, but the embodiments of the present invention are not limited thereto. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by the technicians belonging to the technical field of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. It should be noted that, unless otherwise specified, the reagents used in the present embodiment, etc. are all common commercial products.

[0033] In the embodiment of the present invention, the susceptible strain (SS) of Spodoptera litura comes from the Institute of Zoology, Chinese Academy of Sciences, and is raised indoors without any pesticides; the indoor indoxacarb resistant strain (InRS) of Spodoptera litura is a resistant strain formed by long-term screening of the SS strain with indoxacarb by the Pesticide Laboratory of Hunan Agricultural University, and its resistance to indoxacarb is 58.39 times. Both strains are raised in separate indoor constant temperature incubators with artificial feed, and the feeding standards are strictly followed during the period: temperature 25±2°C, relative humidity 65±5%, and light-dark cycle ratio of 14:10h.

[0034] Example 1: Acquisition of the Spodoptera litura SlituCP26 gene

[0035] Total RNA was extracted from SS larvae using an RNA extraction kit from Acori, and reverse transcribed using a cDNA synthesis kit with gDNA Clean for SlituCP26 gene cloning. The full-length cloning primers for SlituCP26 were F: AATTCTCAATCTATCGC (SEQ ID NO: 10), R: CTATCCCGATCTTAATTCCAA (SEQ ID NO: 11). After 1% agarose gel electrophoresis of the PCR amplification product, the target gene was recovered using the FastPure Gel DNA Extraction MiniKit from Novazon Biotech to obtain SlituCP26, which was sequenced by Beijing Qingke Biotechnology Co., Ltd. The sequence is:

[0036] ATGGCCGCTAAGTTCGTCGTAGTTCTCGCCCTCGTGGCTGCAG

[0037] CTCACTGCTCCGTGGTGCCAGTGGCGCGAGTAGACGCCGACTA

[0038] CACCAGCTTCGCATACGACGTGGCCGACCCCAACACCGGCGAC

[0039] TTCAAAAGCCAGGTGGAGACCCGCGTGGGCGGCAACGTGGCC

[0040] GGCCAGTACTCGCTGCTTGACGCTGACGGCACCAAGCGCACCG

[0041] TGGACTACACCGCTGACGATGTCAATGGATTCAATGCTGTAGT

[0042] GCGCAAGGACCCCGCTGTAGTGGCTGCTGCTCCTGCTGTAGTA

[0043] GCTGCCGCTCCCGCGGTAGTGGCTGCCCGTACTGTGGCTGCCC

[0044] CAGCAGCTGTCGTCGCTGCATCACCTGCAGTTGTTGCTGCTCGC

[0045] ACTGTCGCTGGTCCCGCAGTAGTCACACGTACTTATGCCGCAG

[0046] CCCCCGCATACTATGCAGCCCGCTCTTACGCCGCTCCTGCCGTC

[0047] TATGCTGCCAGTGCTCCCGTTGTAGCCGCGCGCACCGTTGCTG

[0048] CTCCTGTTGCATACACCGCTGGTGCCCGCCTTGCCTATACCGCT

[0049] GGTGCTCCAGTTGCCTACACAGCTAGTGCTCCAGTAGCCTACG

[0050] CTGCCGGTGCGCGTTTCATCGCTCCCTCTGTGTACGCCGCCCGC

[0051] GTGGCTGCCGCCCCCGCCGTGTACTCTGGTGCCGCCTACTACG

[0052] GATCTCCTCTGACCTATGCCGCCTACTCCGCTCCAATCTCGTAT

[0053] TGCTCGATGTCTAAAAAGAAAAGATGTCTGCAAAGACATAGA

[0054] GGATCAGCAATGGCAGCCAAGTTCGTAGTTCTCGCCGCCCTAG

[0055] TGGCCATGGCTCACTGCTCCGTGGTGCCAGTGGCGCGAGTAGA

[0056] CGCCGACTACACCAGCTTCGCATACGACGTGGCCGACCCCAAC

[0057] ACCGGCGACTTCAAGAGCCAGGTGGAGACCCGCGTGGGCGGC

[0058] AACGTGGCCGGCCAGTACTCGCTGCTTGACGCTGACGGCACCA

[0059] AGCGCACCGTGGACTACACCGCTGACGATGTCAATGGATTTAA

[0060] CGCTGTGGTGCGCAAGGACCCCGCTGTAGTAGCTTCCGTGGTG

[0061] GCCGCGCCCGTGGTGGCTGCCCCCGCTGTGGCCGCGCCCGCTG

[0062] TTATCGCTGCCCGCACTGTGGCCCGCTCCCGCTGTCTACGCCGCT

[0063] CACGCCGCTCCCGCTGTCTACGCCGCTCACGCCGCCCCCGCCG

[0064] TGTACGCCGCTCACTCCGCTCCCGTCTACGCCGCTCCCTCTTTC

[0065] TACTCGTACGGTGCTCCCGCCCTATACTCCGCTCCCCTCACTTACGCCGCTAAGTGGTAA (SEQ ID NO: 1).

[0066] Example 2: Detection of expression levels of S. litura SlituCP26 in different strains

[0067] Total RNA was extracted from SS and InRS larvae using an RNA extraction kit from Acrobio, and reverse transcribed using an Evo M-MLVRT kit with gDNAClean for qPCR. Primers for qPCR of SlituCP26 were designed using Primer 3.0 (http: / / frodo.wi.mit.edu / ), where F: CACACGTACTTATGCCGCAG (SEQ ID NO: 12) and R: ACACAGAGGGAGCGATGAAA (SEQ ID NO: 13). qPCR reactions were performed using a 2×T5 Fast qPCRMix kit on an ABI-7500Fast Real-Time PCR system, using 2 -ΔΔCt The results are shown in Figure 2. Figure 1 As shown, the expression level of SlituCP26 in the InRS indoxacarb-resistant strain was significantly upregulated by 155.3 times.

[0068] Example 3: In vitro synthesis of SlituCP26 gene dsRNA

[0069] The cloned full-length sequence of SlituCP26 gene was used as a template, and a partial sequence (SEQ ID NO: 14) was selected to design dsRNA synthesis primers (F: CAGCAATGGCAGCCAAGT (SEQ ID NO: 4); F+T7: GGATCCTAATACGACTCAC TATAGG CAGCAATGGCAGCCAAGT (SEQ ID NO: 5); R: TAGCGGCGTAAGTGAGGG (SEQ ID NO: 6); R+T7:

[0070] GGATCCTAATACGACTCACTATAGG TAGCGGCGTAAGTGAGGG (SEQ ID NO: 7)) and PCR amplification, the product was subjected to 1% agarose gel electrophoresis, and the target gene was recovered using the FastPure GelDNAExtractionMini Kit of Novazon Biotechnology. A plasmid containing GFP was used as a template as a control group.

[0071] Promega's T7 RiboMAX TM The Express RNAi System synthesizes and purifies dsRNA.

[0072] The dsRNA corresponding to the gene fragment of SlituCP26 was named dsSlituCP26, and the dsRNA obtained from the plasmid containing GFP was named dsGFP.

[0073] (SEQ ID NO: 14)

[0074] Example 4: Functional analysis of the SlituCP26 gene in insecticide resistance in Spodoptera litura

[0075] The dsRNA was injected into the third-instar larvae of Spodoptera litura using the injection method. Three biological replicates were set up in each group, and 30 to 40 larvae were injected in each replicate, with each larva injected with 6 μg of dsRNA. After 24 hours of normal culture in a light incubator, the surviving larvae were collected, and total RNA was extracted from some of them to detect the expression level of the target gene; some larvae were treated with indoxacarb (LC) using the feed dipping method. 50:37.37mg / L) sensitivity test; take the epidermis of some larvae, fix it immediately in a 1.5mL centrifuge tube containing 2.5% glutaraldehyde, put it in a 4℃ refrigerator for fixation, and fix the sample with 1% osmium acid solution for 1-2h. Carefully take out the osmium acid waste liquid, rinse it with 0.1M phosphate buffer PBS (PH7.4) 3 times, 15min each time, and the sample is successively dehydrated in 30%-100% acetone for 10min each time, penetrated and embedded, and the resin block is cut into 70-90nm ultrathin slices with an ultrathin slicer. Finally, use a copper mesh to fish out the slices, and observe the epidermal structure and thickness under a transmission electron microscope Hitachi H-7650 after 8-15min of uranyl acetate staining and 8-10min of lead citrate staining.

[0076] The expression level of SlituCP26 in Spodoptera litura larvae was detected 24 h after injection of dsSlituCP26. Figure 2 As shown in the figure, compared with the control group, after injection of dsSlituCP26, the expression of SlituCP26 decreased significantly by 45.6%, achieving a good silencing efficiency. After successfully silencing the expression of SlituCP26 in Spodoptera litura larvae, it was observed that the larvae were significantly smaller ( Figure 3 ), the thickness of the epidermis is significantly thinned ( Figure 4 The changes in the sensitivity of the larvae to indoxacarb were further tested. Figure 5 As shown in Figure 2, compared with the control group, after SlituCP26 was silenced, the mortality of Spodoptera litura larvae at 24h and 48h after indoxacarb treatment increased significantly by 17.8% and 19.3%, respectively ( Figure 5 The results showed that silencing SlituCP26 could reduce the cuticle penetration resistance of Spodoptera litura to indoxacarb.

[0077] Example 5: Cloning of SlituCP26 gene promoter and fluorescence activity analysis

[0078] Based on the genome database of Spodoptera litura, the upstream sequence of SlituCP26 gene was searched, primers were designed, and the corresponding promoter fragment sequence was cloned by PCR using the DNA of sensitive and resistant populations of Spodoptera litura as templates. The primers were F: CGCGTGTAGCTATTTAAG (SEQ ID NO: 8) and R: CATTGCGATAGATTGAGA (SEQ ID NO: 9). The cloned sequence was connected, transformed and sequenced, and the results were as follows: Figure 6 As shown, the promoter of the SlituCP26 gene in the resistant population has an additional 74 bp sequence insertion compared to the promoter in the sensitive population. The specific sequences of the sensitive and resistant populations are:

[0079]

[0080] GGTACC CGCGTGTAGCTATTTA (SEQ ID NO: 15), R: CCG CTCGAG CATTGCGATAGATTG (SEQ ID NO: 16), which was connected to the pGL4.10 expression vector. HEK-293T cells were grown in DEME medium (GibcoBRL, USA) containing 10% fetal bovine serum (InnerMongolia Opcel Biotechology, China), streptomycin and penicillin at 37°C and 5% carbon dioxide. Promoters (1 μg) of different strains and reporter plasmid pGL4.73 (200 ng) were transfected into HEK-293T cells using G4000 Susfectin transfection reagent (Abm, Canada), and the empty PGL4.10 vector was used as a control. 48 hours after transfection, the cells were transfected with Firefly & Renilla detection kit (UElandy, China) was used to measure luciferase activity. Figure 7 As shown, the promoters of both sensitive and resistant populations have fluorescent activity, but the activity of the resistant promoter is significantly higher than that of the sensitive population.

[0081] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of the SlituCP26 gene as a target in controlling Spodoptera litura, the nucleotide sequence of the SlituCP26 gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The expression of the cuticular protein gene SlituCP26 of Spodoptera litura was inhibited by RNAi technology, thereby reducing the penetration resistance of Spodoptera litura to indoxacarb.

3. The use according to claim 2, characterized in that: The RNAi technology includes: using the cloned SlituCP26 gene partial sequence as a template, then using primers containing a T7 polymerase promoter sequence to perform PCR amplification, recovering the amplified product by gel, synthesizing dsRNA in vitro, and purifying the target dsRNA using a dsRNA purification kit.

4. The use according to claim 2, characterized in that: The nucleotide sequence of the partial sequence of the SlituCP26 gene is shown in SEQ ID NO:

14.

5. The use according to claim 2, characterized in that: The primers containing the T7 polymerase promoter sequence include: an upstream primer as shown in SEQ ID NO: 5, and a downstream primer as shown in SEQ ID NO:

7.

6. A SlituCP26 gene promoter related to insecticide resistance of Spodoptera litura, characterized in that: The nucleotide sequences thereof are shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. A pair of primers for amplifying the promoter of the SlituCP26 gene, characterized in that: The nucleotide sequence thereof is as follows: the upstream primer is shown in SEQ ID NO:4, and the downstream primer is shown in SEQ ID NO:

6.

8. A method for detecting insecticide resistance of Spodoptera litura, characterized in that: Using the DNA of Spodoptera litura population as template, the corresponding promoter fragment sequence was cloned by PCR, and the fluorescence activity and sequence length of the SlituCP26 gene promoter were compared. Among them, the fluorescence activity of the sensitive population was lower than that of the resistant population; the sequence length of the resistant population was 74bp longer than that of the sensitive population.

9. The method according to claim 8, characterized in that The nucleotide sequences of the PCR primers are as follows: the upstream primer is shown in SEQ ID NO:8, and the downstream primer is shown in SEQ ID NO:9.

Images