SNP (Single Nucleotide Polymorphism) molecular marker related to Hu sheep testis size character as well as screening method and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the testis size character of Hu sheep as well as a screening method and application of the SNP molecular marker, and belongs to the fields of genetic breeding and molecular biology. The marker is located in an intron region of a Hu sheep chromosome 3 LRRIQ1 gene and is remarkably related to the Hu sheep testis size character, and the accuracy and reliability of the SNP molecular marker are ensured through a scientific and rigorous screening method; according to the marker, Hu sheep individuals related to testis size characters can be rapidly and accurately screened out, the breeding efficiency and accuracy are improved, the breeding process is accelerated, the breeding cost is reduced, and the economic benefits are improved; the genetic diversity is protected, the accuracy of seminal fluid quality evaluation is improved, a powerful tool is provided for Hu sheep breeding work, and important basic data is also provided for researching a genetic mechanism of testis development and functions; the method can also be used as an auxiliary diagnosis tool to assist in identifying potential genetic defects or disease risks and promote progress and development of the breeding technology.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker related to the testis size trait of Hu sheep, a screening method and application thereof. Background Art

[0002] As the sheep breed with the highest market share in China's mutton sheep market, the development and protection of its high-quality traits are crucial to the sustainable development of the mutton sheep industry. However, some unplanned hybridization behaviors are gradually changing the genetic characteristics of Hu sheep, posing a threat to its long-term development. In this context, improving the fertility of Hu sheep, especially male fertility, has become a focus of research and practice.

[0003] Male fertility is a complex polygenic trait that is affected by multiple gene loci and environmental factors. In large-scale sheep farms, the fertility of rams is directly related to the production level and economic benefits of the entire flock. Therefore, improving the utilization rate and coverage of excellent breeding rams is of great significance to improving the overall production level. Semen quality is an important indicator for measuring the fertility of breeding rams, but the evaluation of this indicator is complicated and easily affected by many factors, such as age, nutritional level, season, etc. This makes it quite difficult to objectively and accurately evaluate semen quality. In contrast, testicular size, as a simple, easy-to-measure and highly heritable indicator, is significantly positively correlated with reproductive performance parameters such as ejaculation volume, sperm density, and sperm motility, and is significantly negatively correlated with sperm deformity rate. It is also closely related to growth performance and conception rate of inseminated females. Therefore, testicular size has become an important selection target for genetically improving the fertility of males and offspring females.

[0004] In breeding practice, traditional breeding methods are often time-consuming and inefficient. Molecular marker-assisted selection, as an advanced breeding method, can significantly improve the accuracy of trait selection, reduce breeding costs, and improve breeding efficiency. However, the candidate genes and molecular markers related to testicular size in livestock are still very limited. Therefore, screening single nucleotide polymorphism (SNPs) sites and candidate genes related to testicular size-related traits and developing molecular markers for assisted selection and breeding design are of great significance for accelerating the breeding process of high-breeding Hu sheep and improving breeding accuracy. Summary of the invention

[0005] In view of the current technical problems faced in Hu sheep breeding, such as the lack of candidate genes and molecular markers, the inadequacy of traditional breeding methods, and the complexity of semen quality evaluation, it is urgent to develop efficient and accurate molecular markers to assist in the selection of high-breeding Hu sheep, significantly improve the breeding process and accuracy, ensure the inheritance of Hu sheep's high-quality traits, and promote the sustainable development of the mutton sheep industry. The present invention aims to provide a SNP molecular marker related to the testicular size trait of Hu sheep and its screening method and application.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides a SNP molecular marker related to the testis size trait of Hu sheep. The SNP molecular marker is located at 121444334 bp of Hu sheep chromosome 3, comes from the intron region of LRRIQ1 gene, and the base is A or G.

[0007] The SNP molecular marker is located in a gene fragment whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] The testis size traits of Hu sheep are total testis weight TTW, testis index TI and total epididymis weight TEW.

[0009] The present invention provides a method for screening the above-mentioned SNP molecular markers related to the testis size trait of Hu sheep, comprising: (1) Collect testicular and epididymal molecular samples from Hu sheep, and measure and record traits related to testicular size; (2) Blood was collected from the jugular vein to extract blood genomic DNA; (3) Based on the extracted blood genomic DNA, construct the library, test the library quality and sequence it; (4) Mutation detection and SNP site screening; (5) Based on the whole genome association analysis, significant association loci were screened to obtain SNP molecular markers related to the testis size trait of Hu sheep.

[0010] The Hu sheep are 180 days old.

[0011] The testis size-related traits include left testis weight, right testis weight, left testis length, right testis length, left testis width, right testis width, left epididymis weight and right epididymis weight.

[0012] The method screens significant association sites based on whole genome association analysis, and uses a univariate linear mixed model to perform correlation analysis between SNP sites and phenotypes.

[0013] The univariate linear mixed model formula is: y = Wα + xβ + μ + ε, where y is the individual phenotypic value, W is the fixed effect matrix, α is the fixed effect vector; x is the genotype of the SNP, β is the effect value of the SNP additive effect, μ is the random effect, and ε is the random residual.

[0014] The application of the above-mentioned SNP molecular markers related to the testis size trait of Hu sheep in molecular marker-assisted breeding of Hu sheep.

[0015] The application of the above-mentioned SNP molecular markers related to the testis size trait of Hu sheep in assisted selection breeding of the testis size trait of Hu sheep.

[0016] The application of the above-mentioned SNP molecular markers related to the testis size trait of Hu sheep in the preparation of a detection kit.

[0017] A kit for detecting the genotype of Hu sheep, wherein the kit is prepared by using SNP molecular markers related to the testis size trait of Hu sheep.

[0018] A method for detecting the genotype of Hu sheep, comprising designing primers according to the nucleotide sequences on both sides of the SNP molecular marker site related to the testis size trait of Hu sheep, collecting blood from the male Hu sheep lamb to be tested after birth and extracting genomic DNA, using the primers to perform genotyping on the Hu sheep material to be tested, and determining the genotype of the Hu sheep to be tested at the SNP site.

[0019] Compared with the prior art, the present invention achieves the following technical effects: The SNP molecular marker related to the testis size trait of Hu sheep provided by the present invention is located on chromosome 3 of Hu sheep and comes from the intron region of LRRIQ1 gene. The SNP molecular marker is closely related to the testis size trait of Hu sheep. Therefore, high-breeding Hu sheep can be accurately bred by screening individuals with specific genotypes, which can accelerate the pace of Hu sheep breed improvement and improve the reproductive capacity of the flock, thereby promoting the sustainable development of the mutton sheep industry. The SNP molecular marker not only improves the breeding efficiency and accuracy, accelerates the breeding process, but also promotes the protection and utilization of genetic diversity, improves the accuracy of semen quality evaluation, and promotes the progress and development of breeding technology.

[0020] The method for obtaining SNP molecular markers related to the testis size trait of Hu sheep in the present invention includes a series of scientific and rigorous steps such as sample collection and trait recording, DNA extraction, library construction and sequencing, variation detection, whole genome association analysis and significant SNP site screening. Through whole genome association analysis, SNP sites significantly associated with the testis size trait of Hu sheep are directly screened out, ensuring the accuracy and reliability of SNP molecular markers, avoiding the blindness and uncertainty based on phenotypic selection in traditional breeding methods, and not only providing a powerful tool for Hu sheep breeding, but also providing important basic data for studying the genetic mechanism of testicular development and function.

[0021] The application provided by the present invention can quickly screen out individuals closely related to the testicle size trait in a large number of Hu sheep populations through SNP molecular marker technology. Compared with traditional breeding methods, it is more efficient and directly screens for genetic variations, reducing the blindness and uncertainty in the breeding process. The SNP molecular marker is located in the intron region of the specific LRRIQ1 gene, which can more accurately locate the genetic variation that affects the testicle size trait, and help to accurately evaluate the genetic potential of individuals, thereby improving the accuracy of breeding. Breeding using SNP molecular markers can directly select individuals at the genome level in the early stage of individual development, without relying on phenotypic information, and can significantly This method significantly improves the selection efficiency, avoids the drawback of traditional breeding methods that require waiting for individuals to mature before evaluating traits, greatly shortens the breeding cycle, and accelerates the cultivation process of new varieties. Through early breeding, individuals that do not meet the requirements can be eliminated as early as possible, which helps to reduce breeding costs and improve economic benefits. For individuals with semen quality problems, SNP molecular markers can be used as auxiliary diagnostic tools to help identify potential genetic defects or disease risks. Therefore, the present invention not only improves the efficiency and accuracy of breeding and accelerates the breeding process, but also promotes the protection and utilization of genetic diversity, improves the accuracy of semen quality evaluation, and promotes the progress and development of breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a diagram of the genotyping results of the present invention. DETAILED DESCRIPTION

[0023] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0024] The present invention is further described in detail below in conjunction with the accompanying drawings: Example 1 The present invention provides a SNP molecular marker related to the testis size trait of Hu sheep, comprising the following steps: 1. Selection and feeding management of experimental animals In this study, a total of 3028 Hu sheep lambs were selected as experimental animals in 9 batches from 8 large-scale Hu sheep farms between 2018 and 2022.

[0025] The experimental animals were weaned and standardized for disease prevention at 56 ± 8.4 days of age, and then transported to Minqin Defu Agricultural Technology Co., Ltd. (Lanzhou University Sheep Performance Measurement Center), and each lamb was transferred to a fattening pen (0.8 m × 1.0 m) in the sheep house for single-pen feeding. All batches of sheep were raised and cared for under the same nutritional and feeding management conditions, and the nutritional ratio was prepared as TMR (total mixed ration) pellet feed according to the NRC (National Research Council, 2007) standard configuration for fattening sheep.

[0026] 2. Trait determination and sample collection When the sheep are fed to 180 days of age, a soft ruler is placed close to the surface of the scrotum to measure the maximum circumference of the scrotum, i.e., scrotal circumference (SC). The sheep are slaughtered in accordance with the agricultural industry standards of the People's Republic of China (NY / T3469-2019 Sheep Slaughter Operation Procedures for Livestock and Poultry). After slaughter, the testicles and epididymis molecular samples are immediately collected and placed in liquid nitrogen, and then transported to the laboratory and stored in a -80°C refrigerator. At the same time, testicular size-related traits were measured and recorded, including left testicular weight (LTW), right testicular weight (RTW), left testicular length (LTL), right testicular length (RTL), left testicular width (LTWI), right testicular width (RTWI), left epididymis weight (LEW), and right epididymis weight (REW). The testicular and epididymis weights were weighed using a thousandths single balance, and the testicular length and width were measured using a digital vernier caliper. The total testicular weight (TTW), total epididymis weight (TEW), coefficient of variation of left and right testicular weights (VCTW), testicular index (TI), and total testicular volume (TV) were calculated using the following formula: Formula 1 Formula 2 Formula 3 SPSS Statistics 25.0 software was used to summarize and statistically analyze all phenotypic data, and outliers were eliminated using the 3-times standard deviation method. The descriptive statistics of testis size-related traits of Hu sheep at 180 days of age are shown in Table 1: Table 1: Descriptive statistics of testis size-related traits

[0027] 3. Genomic DNA Extraction and Sequencing (1) Sample collection and DNA extraction At 180 days of age, 5 mL of blood samples were collected from all sheep through the jugular vein using anticoagulant blood collection tubes containing sodium heparin to ensure that the blood samples did not coagulate during the collection process.

[0028] Blood genomic DNA was extracted using the EasyPure® Blood Genomic DNA Kit (TransGen Biotech, Beijing, China).

[0029] (2) DNA quality testing The integrity and concentration of the extracted DNA were detected using 1% agarose gel and NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), respectively.

[0030] (3) Library construction The construction of the library consists of three parts: DNA fragmentation / end repair / addition of A tails, adapter ligation, and PCR enrichment. The DNA fragments with added adapters are amplified by polymerase chain reaction (PCR); (4) Library quality testing The concentration and insert size of the constructed library were detected by Qubit2.0 and Agilent 2100, respectively.

[0031] Quantitative polymerase chain reaction (Q-PCR) was used to accurately quantify the effective concentration of the library.

[0032] (5) Sequencing and data processing The qualified libraries were sequenced on the Illumina NovaSeq 6000 platform to obtain 150 bp paired-end reads. The raw reads obtained by sequencing were quality controlled using fastp (v 0.20.0) to obtain high-quality clean reads. The quality control mainly included (1) deleting the adapter sequence in the Illumina library construction; (2) reads containing more than 10% unknown bases; and (3) reads containing more than 40% low-quality bases (base quality value <15).

[0033] 4. Mutation detection and SNP site screening (1) Clean reads are aligned to the reference genome The high-quality clean reads that had undergone quality control were aligned to the sheep reference genome (ARS-UI Ramb v2.0, GCF016772045.1) using the Burrows-Wheeler Alignment-Maximal Exact Match (BWA-MEM) algorithm.

[0034] (2) Sorting and deduplication of bam files SAMtools (v 1.10) and Picard (v 2.20.1) software were used to sort and remove duplicates from bam files.

[0035] (3) Mutation detection GATK (v 4.1.8) was used for mutation detection. The HaplotypeCaller module was used to analyze the bam file of each sample and generate the corresponding gVCF file, which contains the genomic variation information of the sample, including SNPs, insertions and deletions, etc. The CombineGVCFs module was used to merge the GVCF files of multiple samples into a large GVCF file. The GenotypeGVCFs module was used to perform joint genotype analysis on the merged GVCF files and output the final VCF file. (4) Variant hard filtering bcftools (v 1.18) was used to perform hard filtering on the identified variant set to remove low-quality variant sites. The filtering conditions were: INFO / DP <10311 | INFO / DP> 92802 | QD<2.0 | QUAL<30.0 | MQ<40.0 | FS>60.0 | ReadPosRankSum<-8.0 | MQRankSum<-12.5 | SOR>3.0, 51750417 SNP sites were obtained.

[0036] (5) Further filtering of SNP sites PLINK (v 1.9) software was used to filter out SNP sites with SNP missing rate >5%, individuals with sample missing rate >20%, and SNP sites with minimum allele frequency (MAF) < 0.01, and finally 19,142,158 autosomal SNP sites were obtained for subsequent whole-genome association analysis.

[0037] 5. Genome-wide association analysis (1) Trim the autosomal SNPs obtained by quality control to obtain independent SNP sites The autosomal SNPs obtained by quality control were trimmed using the --indep-pairwise 50 5 0.2 in PLINK software to obtain 891,673 independent SNP loci, and principal component analysis (PCA) was performed using PLINK software.

[0038] (2) Use GEMMA software to perform univariate linear mixed model analysis and screen for significantly associated SNP sites The univariate linear mixed model (LMM) in GEMMA (v 0.98) software was used to analyze the correlation between SNP loci and phenotypes. The model formula was: y = Wα + xβ + μ + ε, where y is the individual phenotypic value, W is the fixed effect matrix, α is the fixed effect vector; x is the SNP genotype, β is the effect value of the SNP additive effect, μ is the random effect, and ε is the random residual. The centralized kinship matrix (kinship) calculated from the SNP locus information was used as an independent variable, and the first three principal components of PCA were added as covariates to the genome-wide association analysis model to minimize the impact of population stratification. The field-year-season effect of the experimental animals was integrated into the batch fixed effect (a total of 9 batches). In order to eliminate the bias caused by pre-slaughter live weight on the analysis results, pre-slaughter live weight was used as a numerical covariate in the GWAS for testis size traits other than TI, and P < 1 × 10 -6 It is used as a significant threshold at the genome level to screen significant association sites.

[0039] (3) Use ANNOVAR to perform functional annotation on significant SNPs obtained from GWAS The sheep reference genome version used was ARS-UI Ramb v2.0, GCF 016772045.1. A SNP molecular marker significantly associated with TTW, TI and TEW was screened out from the GWAS results. It was located at 121444334 bp on chromosome 3 of Hu sheep. Gene annotation showed that the SNP site was located in the intron of LRRIQ1. The detailed information is shown in Table 2: Table 2: Detailed information of SNP molecular markers

[0040] The 150 bp base sequence before and after the SNP molecular marker is shown in SEQ: NC_056056.1|:121444184-121444484 Ovis aries strain OAR_USU_Benz2616 breed Rambouillet chromosome 3, ARS-UI_Ramb_v3.0, whole genome shotgun sequence CTGAGTGTTCCTATTGATGCATAATTCATAACAAGATATTTTCAGGACTATAACCAAATGTTGCATAACTCACAGCTTACCATCTATATTAACCAGATGAAAGAGGTCTTCTTTAGCGATTTAAAAGCATCTGTACAGATAATGTGAAAA[A / G ]TACAAACAAAACATTTCAGGATGTATTTTTAAGATACTTAAACATTTAACAACCTCAGTTACTCTTTAATTAGTTATATTTAAACATATAATGCAACAGGCAATTATTGATAGATTTCTCCTTTGAAAATAATAATAATATAAAGGAATATA (SEQ ID NO.1) (4) Verification of the association between SNP loci and phenotypes The genotyping results of all sequenced individuals at 121444344 bp on chromosome 3 were extracted using plink software. The association between different genotypes of this SNP and TTW, TEW and TI was further analyzed using paired sample T test in SPSS software. The results are shown in the attached Figure 1 And as shown in Table 3.

[0041] Table 3: Association between different SNP genotypes and TTW, TEW and TI

[0042] The above results show that SNP molecular markers significantly affect TTW, TEW and TI, among which TTW, TEW and TI of AA genotype are significantly higher than those of AG and GG genotypes (P<0.01), which indicates that there is a significant association between the SNP site (rs422564674) and the three traits of TTW, TEW and TI, and G is a harmful allele.

[0043] Therefore, when breeding Hu sheep, the above-mentioned SNP molecular markers can be used to design primers on the nucleotide sequences on both sides of the markers. Blood can be collected after the birth of the Hu sheep lambs and genomic DNA can be extracted. The primers can be used to perform genotyping on the tested Hu sheep lambs to determine whether the individuals carry the G allele. Eliminating individuals with the G allele can speed up the breeding process.

[0044] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker related to the testis size trait of Hu sheep, characterized in that: The SNP molecular marker is located at 121444334 bp of chromosome 3 of Hu sheep, comes from the intron region of the LRRIQ1 gene, and the base is A or G.

2. The SNP molecular marker associated with the testis size trait of Hu sheep according to claim 1, characterized in that: The SNP molecular marker is located in a gene fragment whose nucleotide sequence is shown in SEQ ID NO.

1.

3. The SNP molecular marker associated with the testis size trait of Hu sheep according to claim 1, characterized in that: The testicular size traits of Hu sheep are total testicular weight, testicular index and total epididymal weight.

4. A method for screening SNP molecular markers related to the testis size trait of Hu sheep according to any one of claims 1 to 3, characterized in that: include: (1) Collect testicular and epididymal molecular samples from Hu sheep, and measure and record traits related to testicular size; (2) Blood was collected from the jugular vein to extract blood genomic DNA; (3) Based on the extracted blood genomic DNA, construct the library, test the library quality and sequence it; (4) Mutation detection and SNP site screening; (5) Based on the whole genome association analysis, significant association loci were screened to obtain SNP molecular markers related to the testis size trait of Hu sheep.

5. The method for screening SNP molecular markers related to the testis size trait of Hu sheep according to claim 4, characterized in that: The method screens significant association sites based on whole genome association analysis, and uses a univariate linear mixed model to perform correlation analysis between SNP sites and phenotypes.

6. The method for screening SNP molecular markers related to the testis size trait of Hu sheep according to claim 5, characterized in that: The univariate linear mixed model formula is: y = Wα + xβ + μ + ε, where y is the individual phenotypic value, W is the fixed effect matrix, α is the fixed effect vector; x is the genotype of the SNP, β is the effect value of the SNP additive effect, μ is the random effect, and ε is the random residual.

7. Use of the SNP molecular marker associated with the testis size trait of Hu sheep as described in any one of claims 1 to 3 in Hu sheep molecular marker-assisted breeding.

8. Use of the SNP molecular marker associated with the testis size trait of Hu sheep as described in any one of claims 1 to 3 in assisted selection breeding of the testis size trait of Hu sheep.

9. Use of the SNP molecular marker associated with the testis size trait of Hu sheep as described in any one of claims 1 to 3 in the preparation of a detection kit.

10. A method for detecting the genotype of Hu sheep, characterized in that: According to any one of claims 1 to 3, primers are designed respectively based on the nucleotide sequences on both sides of the SNP molecular marker site related to the testis size trait of Hu sheep, blood is collected after the test Hu sheep lamb is born, and genomic DNA is extracted. The primers are used to perform genotyping on the test Hu sheep material to determine the genotype of the test Hu sheep at the SNP site.

Images