DsRNA of migratory locust myosin heavy chain gene and application thereof

Abstract

According to the dsRNA of the migratory locust myosin heavy chain gene and the application of the dsRNA, the dsRNA for synthesizing interference sequence fragments of the migratory locust myosin heavy chain gene is injected into migratory locust bodies, so that the mRNA expression of the migratory locust myosin heavy chain gene can be specifically silenced, the excavation frequency is obviously reduced when insects lay eggs, and the excavation depth is obviously reduced; a large number of eggs are retained in the body, so that insects cannot normally lay eggs, and the purpose of biological control is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to dsRNA of locust myosin heavy chain gene and application thereof. Background Art

[0002] Effective non-chemical pest control technologies are extremely important for the sustainable control of agricultural pests.

[0003] dsRNA (double-stranded RNA) is a double-stranded RNA molecule formed by the renaturation of two complementary RNA single strands. dsRNA can efficiently and specifically induce the silencing of homologous RNA in cells, thereby blocking the expression of target genes and causing the organism to show a phenotype of target gene deletion. This RNAi technology mediated by double-stranded RNA molecules has been widely used in many non-model organisms. Silencing the expression of key genes in agricultural pests through RNAi technology can inhibit the growth, development and reproduction of pests and even cause the death of pests. Nucleic acid pesticides made from dsRNA have significant advantages such as strong targeting, non-toxicity, and environmental friendliness. Therefore, RNAi insecticide technology is a new type of biological control method and is gradually becoming an important tool in insect pest research and agricultural applications.

[0004] Muscles play an important role in the egg-laying process of insects. Muscles are composed of thick filaments and thin filaments. Myosin, as the main component of thick filaments, is a hexameric molecular motor protein composed of two heavy chains (Myosin Heavy Chain), two pairs of light chains (Myosin Light Chain) and two pairs of essential light chains, which plays an important role in the body's muscle contraction. Summary of the invention

[0005] The purpose of the present invention is to provide dsRNA of locust myosin heavy chain gene and its application;

[0006] The invention provides a locust myosin heavy chain gene fragment, the nucleotide sequence of the locust myosin heavy chain gene fragment is SEQ ID NO: 1.

[0007] The present invention provides a method for synthesizing the locust myosin heavy chain gene fragment as described above, comprising the following steps: based on the locust myosin heavy chain gene, PCR amplification is performed using an upstream primer with a sequence of SEQ ID NO: 2 and a downstream primer with a sequence of SEQ ID NO: 3 to obtain the locust myosin heavy chain gene fragment.

[0008] The present invention provides dsRNA synthesized from the locust myosin heavy chain gene fragment as described above.

[0009] The present invention provides the use of the dsRNA described above in controlling migratory locusts.

[0010] The present invention provides the use of the dsRNA described above in preparing an agent for inhibiting locust egg laying.

[0011] The present invention can specifically silence the expression of the locust myosin heavy chain Mhc gene by injecting dsRNA synthesized based on the locust myosin heavy chain gene fragment into the female locust, significantly reducing the frequency of the ovipositor's digging when the locust lays eggs, significantly reducing the digging depth, and causing a large number of mature eggs to be retained in the body and unable to be discharged normally, thereby causing the insect to be unable to lay eggs normally, thereby achieving the purpose of biological control, protecting the ecological environment, and having extremely high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the agarose gel electrophoresis detection diagram of the amplified interference sequence fragment of the locust myosin heavy chain Mhc gene.

[0013] Figure 2 This is the change in the expression level of the myosin heavy chain Mhc gene of the migratory locust after the fifth-day adult locust was injected with dsRNA in the experiment of the embodiment of the present invention, wherein β-actin is the internal reference gene, the left side is the control group injected with dsGFP, and the right side is the dsMhc treatment group, **P<0.01.

[0014] Figure 3 This is a comparison chart of the effects of dsRNA injection on the digging frequency of locusts on the fifth day of adulthood in the experiment of the present invention, with the left side being the dsGFP control group and the right side being the dsMhc treatment group, ***P<0.001.

[0015] Figure 4 Figure A is a photograph of the egg-laying depth, with the left side being the control group injected with dsGFP, and the right side being the treatment group injected with dsMhc; Figure B is a comparison chart of the results of the effect of dsRNA injection on the egg-laying depth of locusts on the fifth day of adulthood in the experiment of the embodiment of the present invention, with the left side being the dsGFP control group, and the right side being the dsMhc treatment group, ***P<0.001.

[0016] Figure 5 This is a statistical chart of the amount of eggs laid by locusts after dsRNA was injected on the fifth day of adulthood in the experiment of the present invention, with the dsGFP control group on the left and the dsMhc treatment group on the right, ***P<0.001.

[0017] Figure 6Figure A is a comparison chart of the effects of dsRNA injection on the ovaries of locusts on the fifth day of adulthood in the experiment of the embodiment of the present invention, with the dsGFP control group on the left and the dsMhc treatment group on the right; Figure B is a statistical chart of the number of eggs retained but not produced in the ovaries of locusts, with the dsGFP injection control group on the left and the dsMhc injection treatment group on the right, ***P < 0.001. DETAILED DESCRIPTION

[0018] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0019] Example 1: Obtaining the Locust Myosin Heavy Chain Mhc Gene Fragment

[0020] Based on the locust transcriptome database, the bioinformatics method was used to search for the locust Mhc gene, and the Mhc gene sequence was obtained after sequence alignment analysis.

[0021] Design specific primers, whose upstream and downstream primer sequences are SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0022] wherein SEQ ID NO: 2: 5'AAAGGAGACGACCCTAAGAA3';

[0023] SEQ ID NO: 3: 5'GTTGAGCAGAGGCTTGACC3'.

[0024] Healthy and uniform-sized female locusts were selected, their ovipositors were quickly dissected and frozen in liquid nitrogen, 3 in each group, 6 biological replicates in total, and the specific steps for RNA extraction were referred to the Invitrogen Trizol kit. The genomic DNA was removed by the kit, and the first-strand cDNA was synthesized by reverse transcription. The cDNA chain was used as a template to obtain the Mhc gene fragment by PCR amplification. The fragment length was 444 bp, which was connected to the pLB vector (Tiangen Biochemical Technology Co., Ltd.), cloned and transformed into the competent Escherichia coli, cultured at 37°C overnight, and white, round and plump monoclonal colonies were selected for bacterial inspection, and the bacterial solution with the correct verification band was sequenced.

[0025] The sequencing results were compared with the transcriptome search results to verify and obtain the nucleotide sequence of the gene fragment, which is SEQ ID NO: 1.

[0026] SEQ ID NO:1

[0027] AAAGGAGACGACCCTAAGAAGATGGCTCAGACAATTCTGGATGCTGTGAACCTTGACACTGAGTCTTACCGTTTGTCACACCAAGGCATATACAAAATCCTGTGCGCTCATCTTGTCAAAGAGCCAATAGCAGCCGAGAAGGCGACGCAAATCATCCTGGACCACGTCAATATGGACGCGGAGCAATATCGAATGGGCAAAACAAAGGTCTTCTTCAGAGCT GGAATCCTGGGTCAGATGGAAGAATTGCGAGACGAACGTCTCGGCAAGATCATCAGTTGGATGCAGGCCTGGATCAGGGGTTATCTGGCAAGGAAGGAGTACAAGAAGCTCCAGGAACAGAGAGTGGCCCTCCAGGTGGTACAGAGAAACCTGCGCAAGTACTTGCAGCTGCGCACCTGGCCCTGGTGGAAGCTGTGGCAGAAGGTCAAGCCTCTGCTCAAC.

[0028] Example 2: Acquisition of dsRNA of Locust Myosin Heavy Chain Mhc Gene

[0029] The Mhc gene fragment obtained in Example 1 was used to synthesize dsRNA by in vitro transcription according to the instructions of the kit. The integrity of the obtained dsRNA was verified by 1% agarose gel electrophoresis, and its concentration was detected. The dsRNA was diluted to a final concentration of 5 μg / μL, packaged and stored in a -80°C refrigerator.

[0030] Example 3: Effect of locust myosin heavy chain Mhc gene dsRNA on locust egg-laying behavior

[0031] 1) Injection of dsRNA of Mhc gene of locust

[0032] The fifth-day females of uniform size and healthy growth were selected as experimental subjects, and the dsRNA synthesized in Example 2 was injected, and the last abdominal segment of the migratory locust was selected as the injection point for injection. Do not use too much force during injection. After the injection, the migratory locust adults were placed in a well-ventilated metal mesh cage (light and dark cycle 14h:10h conditions, temperature 30±2°C, humidity 60%), and fed with fresh wheat seedlings every day.

[0033] 2) Detection of the silencing effect of the Mhc gene in locusts

[0034] The ovipositors of migratory locust adults injected with dsGFP (control group) and dsMhc (experimental group) were collected, with 3 in each group, and 6 biological replicates in each control group and experimental group. Total RNA was extracted and reverse transcribed into first-strand cDNA. Specific quantitative primers were designed, and the SYBR Green real-time fluorescence quantitative method was used to detect the relative expression of the target gene (Mhc) and the internal reference gene (β-actin). The quantitative instrument was Q6 pro. The double standard curve method was used, and the calculation formula was: 2 -(目的基因Ct值-内参基因Ct值) , and obtain the relative expression level of the target gene. Figure 2 As shown, the results showed that compared with the control group, the expression level of the locust myosin heavy chain Mhc gene was significantly reduced after injection of dsMhc, and its silencing efficiency reached 64%.

[0035] 3) Observation of locust phenotypes after dsRNA injection

[0036] On the fifth day of adulthood, locusts were injected with dsRNA at a dose of 10 μg / head. Figure 3 and Figure 4 As shown in Figure 2, compared with the control group injected with dsGFP, the digging frequency and digging depth of the locusts in the treatment group injected with dsMhc were significantly reduced. In addition, compared with the control group, the locusts injected with dsMhc could not lay eggs normally, and the egg laying amount was significantly reduced, as shown in Figure 2. Figure 5 The present invention further dissected the ovaries of migratory locusts and found that after the injection of dsMhc, a large number of mature eggs were retained in the body and not discharged normally. Figure 6 .

Claims

1. A locust myosin heavy chain gene fragment, characterized in that: The nucleotide sequence of the locust myosin heavy chain gene fragment is SEQ ID NO:

1.

2. The synthetic method of locust myosin heavy chain gene fragment as claimed in claim 1, characterized in that, The method comprises the following steps: based on the locust myosin heavy chain gene, PCR amplification is performed with an upstream primer with a sequence of SEQ ID NO: 2 and a downstream primer with a sequence of SEQ ID NO: 3 to obtain a locust myosin heavy chain gene fragment.

3. dsRNA synthesized from the locust myosin heavy chain gene fragment as claimed in claim 1 or 2.

4. Use of the dsRNA as claimed in claim 3 in locust control.

5. Use of the dsRNA as claimed in claim 3 in preparing an agent for inhibiting locust egg laying.

Images