Recombinant strain NT1003-P2 of EutM natural protein scaffold coupled carboxylic acid reductase mutant as well as construction method and application of recombinant strain NT1003-P2

Abstract

The invention discloses a recombinant strain NT1003-P2 of an EutM natural protein scaffold coupled carboxylic acid reductase mutant as well as a construction method and application of the recombinant strain NT1003-P2. According to the method, a carboxylate reductase mutant and an EutM natural protein scaffold are connected by utilizing the characteristic that a binding protein SpyCatcher and a binding molecular peptide SpyTag can be spontaneously dehydrated to form peptide bond coupling. Compared with a strain which is not subjected to EutM protein scaffold assembly, the scaffold in the assembly EutM-CAR has the advantage that the activity of the carboxylic acid reductase is remarkably improved; the unique surface charge distribution of the EutM protein scaffold also has beneficial effects on enzyme reaction, so that the yield of 1, 5-pentanediol synthesized by using the assembly EutM-CAR is also obviously improved, and the EutM protein scaffold has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a recombinant strain NT1003-P2 of an EutM natural protein scaffold coupled with a carboxylic acid reductase mutant, and a construction method and application thereof. Background Art

[0002] 1,5-Pentanediol (1,5-PDO) is an important five-carbon diol. Its good biocompatibility, low toxicity and unique chemical properties make it play an important role in the fields of synthetic materials, biomedicine and the environment. It can be mainly used in the production of polyesters, thermoplastic polyurethanes and plasticizers.

[0003] Currently, the methods for producing 1,5-PDO are relatively simple. The commercial production of 1,5-PDO is completely dependent on petroleum feedstocks, mainly through the hydrogenation reduction of glutaric acid esters or their diesters. However, due to the limited availability of C5 petrochemical feedstocks, 1,5-PDO cannot be produced in large quantities through these routes. In recent years, the chemical conversion of biomass-derived furfural to 1,5-PDO has been intensively studied. However, the entire process of chemical conversion is complicated, and the relatively high price of furfural also limits its commercialization.

[0004] Microbial fermentation can replace traditional chemical synthesis to produce 1,5-PDO. Currently, it is possible to introduce an artificial lysine-derived pathway into Escherichia coli and additionally introduce carboxylic acid reductase or coenzyme A transferase, but the yield of 1,5-PDO obtained is less than 1g / L. The highest yield reported was produced by Associate Professor Ma Chunling and others from Qilu University of Technology from glucose, through one-step fermentation of the intermediate metabolite pentamethylenediamine, but the shake flask fermentation yield was still only 2.92g / L, and 10.98g / L of 1,5-PDO was produced in a 5-liter fermenter.

[0005] In the process of enzyme catalysis in natural cells, each enzyme does not exist independently but forms a complex to effectively perform the catalytic step. This form of combination promotes the effective transfer of intermediates, enhances the activity of multiple synergistic enzymes, and avoids the loss of potential toxic intermediates. This has also inspired researchers to develop many artificial bio-enzyme complex systems. These systems are constantly improving, which can not only improve the efficiency of the reaction, but also improve the various properties of the enzymes.

[0006] The strain Spirochaeta americana contains ethanolamine-utilizing bacterial microcompartments (EutMCP). The coat protein EutM of EutMCP spontaneously forms a fibrous protein structure after overexpression in Escherichia coli, which is often used as an enzyme immobilization carrier in enzyme assembly strategies. The binding protein SpyCatcher and the binding molecule peptide SpyTag can spontaneously dehydrate to form an isopeptide bond coupling. This spontaneous specific connection has low requirements for reaction conditions, and the isopeptide bond formed by the combination has good stability, and is often used as a medium for connecting enzymes to fixed carriers. Summary of the invention

[0007] In view of the shortcomings of the prior art, the present invention aims to provide a recombinant strain NT1003-P2 of EutM natural protein scaffold coupled with carboxylic acid reductase mutant and its construction method and application. First, the carboxylic acid reductase assembly element MmCAR was constructed. Q302E -linker-Spytag and plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK, and then constructed the protein scaffold EutM-linker-Spycatcher and plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher, and finally the recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher and plasmid pTrc99a-davB-davA-GabT were co-transformed into the lysine high-producing bacteria NT1003 to obtain strain NT1003-P2, which has good application prospects in the production and fermentation of 1,5-PDO.

[0008] In order to solve the problems of the prior art, the technical solution adopted by the present invention is:

[0009] A recombinant strain NT1003-P2 of EutM natural protein scaffold coupled with carboxylic acid reductase mutant was first constructed. Q302E -linker-Spytag and plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK, and then constructed the protein scaffold EutM-linker-Spycatcher and plasmid pRSFDuet-MmCAR Q302E-linker-Spytag-sfp-YahK-EutM-linker-Spycatcher, and finally the recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher and plasmid pTrc99a-davB-davA-GabT were co-transformed into the lysine high-producing bacteria NT1003 to obtain strain NT1003-P2.

[0010] The method for constructing the recombinant strain NT1003-P2 of the EutM natural protein scaffold coupled with the carboxylic acid reductase mutant comprises the following steps:

[0011] Step 1, carboxylic acid reductase assembly element MmCAR Q302E -Linker-Spytag build

[0012] MmCAR Q302E -linker-F and MmCAR Q302E -linker-R is the upstream and downstream primers for MmCAR Q302E PCR amplification was performed, and the amplified fragment was recovered and connected with the binding molecule peptide Spytag through PCR overlap technology to obtain the fragment MmCAR Q302E -linker-spytag;

[0013] Step 2, recombinant plasmid pRSFDuet-MmCAR Q302E -linker-spytag-sfp-YahK build

[0014] The recombinant plasmid pRSFDuet-MmCAR was obtained by homologous recombination with the linear pRSFDuet-sfp-YahK. Q302E -linker-Spytag-sfp-YahK;

[0015] Step 3, Construction of protein scaffold EutM-linker-Spycatcher

[0016] The C-terminus of the natural fibrous protein EutM and the binding protein Spycatcher were fused and expressed to construct the protein scaffold EutM-linker-Spycatcher;

[0017] Step 4, recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher build

[0018] The amplified fragment was inserted into the plasmid pRSFDuet-MmCAR by homologous recombination. Q302E -linker-Spytag-sfp-YahK HindIII restriction site to obtain the recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher;

[0019] Step 5, pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher and plasmid pTrc99a-davB-davA-GabT were co-transformed into the lysine high-producing bacteria NT1003 to obtain the high-yield 1,5-PDO strain NT1003-P2.

[0020] As an improvement, in step 1, the primer MmCAR Q302E The nucleotide sequence of -linker-F is shown in EQ ID NO.11, aggaacagaccatggaattcatggaattcatgatgggcccg; primer MmCAR Q302E The nucleotide sequence of -linker-R is shown in EQ ID NO.12, gtcgacaccggatccccctgaaccctcgagcagcagacccagcagacgcagatcact.

[0021] The application of the above recombinant strain NT1003-P2 in the synthesis of 1,5-PDO.

[0022] Beneficial effects:

[0023] Compared with the prior art, the present invention discloses a recombinant strain NT1003-P2 of a carboxylic acid reductase mutant coupled with a EutM natural protein scaffold and a construction method and application thereof, and utilizes the characteristics that the binding protein SpyCatcher and the binding molecule peptide SpyTag can spontaneously dehydrate to form an isopeptide bond coupling to connect L-threonine aldolase and the EutM natural protein scaffold. Compared with the 1,5-PDO production strain without protein scaffold assembly, the scaffold in the strain NT1003-P2 with the EutM protein scaffold makes the enzyme in a more stable state; in addition, the unique surface charge distribution of the EutM protein scaffold also has a beneficial effect on the reaction of the enzyme, and is used for 1,5-PDO production, and the yield is increased by 1.3 times. The method utilizes the characteristics that the binding protein SpyCatcher and the binding molecule peptide SpyTag can spontaneously dehydrate to form an isopeptide bond coupling to connect the carboxylic acid reductase mutant and the EutM natural protein scaffold. The enzyme is fixed on the protein scaffold to keep the enzyme in a stable state; compared with the plasmid without protein scaffold assembly, the scaffold in the assembly EutM-CAR keeps the enzyme in a more stable state and improves the activity of carboxylic acid reductase; the unique surface charge distribution of the EutM protein scaffold also has a beneficial effect on the enzyme reaction. Therefore, the yield of 1,5-pentanediol synthesized using the assembly EutM-CAR has also been significantly improved, which has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Recombinant plasmid PRSFDuet-MmCAR Q302E -sfp-Yahk, PRSFDuet-MmCAR Q302E -linker-Spytag-sfp-Yahk-EutM-linker-Spycatcher.

[0025] Figure 2 The recombinant strain NT1003-P2 produced 1,5-PDO by fermentation.

[0026] Figure 3 Assembly of MmCAR for EutM scaffold Q302E Whole-cell catalytic production of 1,5-PDO. DETAILED DESCRIPTION

[0027] The following examples will enable those skilled in the art to more fully understand the present invention, but are not intended to limit the present invention in any way.

[0028] Preparation of LB medium (g / L): 10% tryptone; 5% yeast extract; 5% sodium chloride; 0.55% sodium pyruvate; if solid culture medium is used, add 2g / L agar.

[0029] Preparation of shake flask fermentation medium (g / L): glucose 20; ammonium sulfate 10; peptone 5; yeast powder 2; potassium chloride 0.5; magnesium sulfate heptahydrate 1.6; zinc sulfate heptahydrate 0.086; anhydrous copper sulfate 0.077; manganese sulfate monohydrate 0.032; ferrous sulfate heptahydrate 0.032; calcium carbonate 10; methionine 0.3; threonine 0.1; vitamin B1 0.06; nicotinamide 0.01.

[0030] Seed culture: Pick a single colony of the positive clone and place it in 5 ml of culture medium containing ampicillin and kanamycin, and culture it at 37°C, 200 rpm for 12-16 hours.

[0031] Shake flask culture: transfer to shake flask fermentation medium, add ampicillin and kanamycin during transfer, culture at 37°C for 7-9 hours, add 0.5mM IPTG for induction when the OD value reaches 1, and transfer to 30°C for 120-144 hours to obtain 1,5-PDO by fermentation.

[0032] Example 1 Carboxylic acid reductase assembly element MmCAR Q302E -Linker-Spytag build

[0033] The MmCAR for the construction of the carboxylic acid reductase assembly element was obtained by mutating the asparagine at position 302 in the protein sequence of the carboxylic acid reductase MmCAR from Mycobacterium marinum to glutamic acid. Q302E , and the nucleotide sequence is shown in SEQ ID NO.1.

[0034] SEQ ID NO.1

[0035]

[0036] The binding molecule peptide SpyTag is derived from the strain Streptococcus pyogenes (the gene of the binding molecule peptide SpyTag is obtained by full gene synthesis from Qingke Biotechnology Co., Ltd. (Nanjing), and the nucleotide sequence of the gene fragment is shown in SEQ ID NO.2.

[0037] SEQ ID NO.2:

[0038] Ggctcaggtgcacatatcgtcatggttgatgcgtacaaaccgaccaaaggcagcgga

[0039] Overlap-PCR was used to detect the expression of linker I in MmCAR Q302E The C-terminal fusion binding peptide SpyTag was used to obtain the fragment MmCAR Q302E -linker-Spytag. The amino acid sequence of linkerⅠ is as follows: GSGGSGVD.

[0040] The specific construction method is:

[0041] 1. pRSFDuet-MmCAR Q302E -sfp-YahK as template, with primer MmCAR Q302E -linker-F and MmCAR Q302E -linker-R is the upstream and downstream primer pair MmCAR Q302E Perform PCR amplification.

[0042] Among them, pRSFDuet-MmCAR Q302E -sfp-YahK is constructed as follows:

[0043] The gene fragment MmCAR-sfp was amplified using the upstream primer MmCAR-sfp-F and the downstream primer MmCAR-sfp-R;

[0044] The gene fragment YahK was amplified using the upstream primer YahK-F and the downstream primer YahK-R.

[0045] The upstream primer MmCAR-sfp-F is shown in SEQ ID NO.3:

[0046] aggagatataccatgatggaattcatgatgggcccg

[0047] The downstream primer MmCAR-sfp-R is shown in SEQ ID NO.4:

[0048] cgccgagctcgaatttcaaagtaactcctcgtaggagacca

[0049] The gene fragment MmCAR-sfp is shown in SEQ ID NO.5:

[0050] atggGCCCGATTACCCGCGAAGAACGTCTGGAACGTCGTATTCAGGATCTGTATGCAAATGATCCGCA

[0051] GTTTGCAGCAGCAAAACCGGCCACCGCCATTACCGCAGCAATTGAACGCCCGGGCCTGCCGCTGCCG

[0052]

[0053] The upstream primer YahK-F is shown in SEQ ID NO.6:

[0054] ttactttgaaattcgatgaagatcaaagctgttggtgca

[0055] The downstream primer YahK-R is shown in SEQ ID NO.7:

[0056] atgcggccgcaagcttcagtctgttagtgtgcgattatcga

[0057] The gene fragment YahK is shown in SEQ ID NO.8:

[0058] ATGAAGATCAAAGCTGTTGGTGCATATTCCGCTAAACAACCACTTGAACCGATGGATATCACCCGGCGTGAACCGGGACCGAATGATGTCAAAATCGAAATCGCTTACTGTGGCGTTTGCCATTCCGATCTCCACCAGGTCCGTTCCGAGTGGGCGGGGACGGTTTACCCCTGCGTGCCGGGTCATGAAATTGTGGGGCGTGTGGTAGCCGTTGGTGATCAGGTAGAAAAATATGCGCCGGGCGATCTGGTCGGTGTCGGCTGCATTGTCGACAGTTGTAAACATTGCGAAGAGTGTGAAGACGGGTTGGAAAACTACTGTGATCACATGACCGGCACCTATAACTCGCCGACGCCGGACGAACCGGGCCATACTCTGGGCGGCTACTCACAACAGATCGTCGTTCATGAGCGATATGTTCTGCGTATTCGTCACCCGCAAGAGCAGCTGGCGGCGGTGGCTCCTTTGTT

[0059] GTGTGCAGGATCACCACGTATTCGCCGCTACGTCACTGGCAGGCCGGCCGGGTAAAAAAGTGGGCGTGGTCGGCATCGGCGGTCTGGGACATATGGGGATTAAGCTGGCCCACGCGATGGGGGCACATGTGGTGGCATTTACC ACTTCTGAGGCAAAACGCGAAGCGGCAAAAGCCCTGGGGGCCGATGAAGTTGTTAACTCACGCAATGCCGATGAGATGGCGGCTCATCTGAAGAGTTTCGATTTCATTTTGAATACAGTAGCTGCGCCACATAATCTCGACGATT TTACCACCTTGCTGAAGCGTGATGGCACCATGACGCTGGTTGGTGCGCCTGCGACACCGCATAAATCGCCGGAAGTTTTCAACCTGATCATGAAACGCCGTGCGATAGCCGGTTCTATGATTGGCGGCATTCCAGAAACTCAGGA GATGCTCGATTTTTGCGCCGAACATGGCATCGTGGCTGATATAGAGATGATTCGGGCCGATCAAATTAATGAAGCCTATGAGCGAATGCTGCGCGGTGATGTGAAATATCGTTTTGTTATCGATAATCGCACACTAACAGACTGA

[0060] The amplified gene fragment MmCAR-sfp was inserted into the two restriction sites NcoI and EcoRI (Shanghai Haojia Co., Ltd.) of pCDFDuet by homologous recombination to obtain pCDFDuet-MmCAR-sfp.

[0061] The amplified gene fragment Yahk was inserted into the two restriction sites of SacI and HindIII (Shanghai Haojia Co., Ltd.) of pCDFDuet-MmCAR-sfp by homologous recombination to obtain pCDFDuet-MmCAR-sfp-YahK.

[0062] The gene fragment MmCAR-sfp-YahK was amplified using the upstream primer MmCAR-sfp-YahK-F and the downstream primer MmCAR-sfp-YahK-R. The amplified fragment MmCAR-sfp-YahK was connected to the linear pRSFDuet by homologous recombination, and the T7 promoter was replaced with Trc to obtain pRSFDuet-MmCAR-sfp-YahK.

[0063] The upstream primer MmCAR-sfp-YahK-F is shown in SEQ ID NO.9:

[0064] cgactcctgcattaggaaatatactagtttgacaattaatcatcc

[0065] The upstream primer MmCAR-sfp-YahK-R is shown in SEQ ID NO.10:

[0066] cctgaggtttcagtcagtctgttagt

[0067] Using pRSFDuet-MmCAR-sfp-YahK as a template, the gene sequence CAG of the 302nd amino acid was replaced with GAA on the upstream primer, and the gene sequence GTC of the 302nd amino acid was replaced with CTT on the downstream primer. Circular plasmid PCR was performed on pRSFDuet-MmCAR-sfp-YahK to obtain plasmid pRSFDuet-MmCAR Q302E -sfp-YahK.

[0068] Primer MmCAR Q302E The nucleotide sequence of -linker-F is shown in SEQ ID NO.11, aggaacagaccatggaattcatggaattcatgatgggcccg;

[0069] Primer MmCAR Q302E The nucleotide sequence of -linker-R is shown in SEQ ID NO.12, gtcgacaccggatccccctgaaccctcgagcagcagacccagcagacgcagatcact.

[0070] The amplified fragment was recovered using a DNA purification kit (TianGen) for later use.

[0071] 2. Overlap the purified fragments to the amplified fragment MmCAR Q302E Connecting with Spytag to obtain MmCAR Q302E -linker-spytag, alternate.

[0072] The conditions for PCR amplification were: 95°C 5min, 95°C 30s, Tm-5°C 30s, 72°C 30-45s / Kb, 72°C 5min, 4°C∞.

[0073] The PCR amplification system is:

[0074] Genome template 2μl <![CDATA[Primer MmCAR Q302E -linker-F]]> 2μl <![CDATA[Primer MmCAR Q302E -linker-R]]> 2μl 2 × PhantaMaxMasterMix 25μl <![CDATA[ddH2O]]> 19μl Total volume 50μl

[0075] Example 2 Recombinant plasmid pRSFDuet-MmCAR Q302E -linker-spytag-sfp-YahK build

[0076] The recombinant plasmid pRSFDuet-MmCAR was obtained by homologous recombination with the linear pRSFDuet-sfp-YahK. Q302E -linker-Spytag-sfp-YahK.

[0077] Among them, the construction method of pRSFDuet-sfp-YahK is:

[0078] The gene fragment sfp-YahK was amplified using the upstream primer sfp-YahK-F and the downstream primer sfp-YahK-R;

[0079] The upstream primer MmCAR-sfp-YahK-F is shown in SEQ ID NO.13,

[0080] AGATATACATATGGCAGATCTAAGGAGATATACATATGaaaatttacggcatctacatg;

[0081] The downstream primer MmCAR-sfp-YahK-R is shown in SEQ ID NO.14,

[0082] TTTCTTTACCAGACTCGAGGGTACCTCAGTCTGTTAGTGTGCGATTATCGATAAC A;

[0083] The protein was inserted into the BglII and KpnI restriction sites of pRSFDuet (provided by Shanghai Haojia Co., Ltd.) by homologous recombination to obtain the recombinant plasmid pRSFDuet-sfp-YahK.

[0084] Example 3 Construction of protein scaffold EutM-linker-Spycatcher

[0085] The EutM natural protein is derived from the strain Spirochaeta americana, and the nucleotide sequence of its gene fragment is shown in SEQ ID NO.15.

[0086] GCGGATGTGCAGATGATCGCGCTGGGCATGATTGAAACCAAGGGTCTGGTGGCGGCGATTGAAGCGG

[0087] CGGATGCGATGGTGAAAGCGGCGAACGTTAAGCTGATCGGCAAAGAGTACATTGGTGGCGGTCTGGT

[0088] GACCGTTATGGTTCGTGGCGACGTGGGTGCGGTTAAAGCGGCGACCGATGCGGGTGCTGCGGCGGCG

[0089] CAGCGTATCGGCGAGCTGGTTAGCGTGCACGTTATTCCGCGTCCGCACGGTGATGCGGAAATGATTCT

[0090] GCCGAGCGCGAAA

[0091] The binding protein SpyCatcher is derived from the strain Streptococcus pyogenes, and the nucleotide sequence of its gene fragment is shown in SEQ ID NO.16.

[0092] ggcggggagcgctatggtggacaccctgtcgggcctctctagtgaacaggggcaaagcggcgatatgactatcgaagaagattcagcgacgcatattaagttttcgaagcgcgatgaagatgggaaggaactcgcaggagcaactatggagctgcgtgacagtagcgggaagacaatttcg acctggattagtgatggccaagttaaagacttttatctgtatccaggcaaatataccttcgtagaaaccgcagcacctgatggttatgaagtcgcgaccgctattacttttacagtgaacgagcaggggcaggtcaccgtcaatgggaaagctacgaaaggggatgcccatattgactaa

[0093] The genes of EutM native protein and binding protein SpyCatcher were obtained by whole gene synthesis from Qingke Biotechnology Co., Ltd. (Nanjing).

[0094] Through literature research, we learned that when EutM protein polymerizes into fibrous protein, the C-terminus of EutM is located on the outside of the fiber filament. Therefore, when constructing the protein scaffold, the binding protein SpyCatcher is fused to the C-terminus of EutM, and the linkerII amino acid sequence connecting the two proteins is: GSGSGSGSGSGS.

[0095] The specific construction method is:

[0096] When designing primers, the sequence of linkerII was added to the downstream primer EutM-linkerII-R of the EutM gene and the upstream primer linkerII-Spycatcher-F of the Spycatcher. The upstream primer EcoRI-EutM-F containing the EutM gene (the nucleotide sequence of the upstream primer EcoRI-EutM-F is SEQ ID NO.17:

[0097] CCGGAATTCCGATGGCGGATGTGCAGATGATC) and a downstream primer EutM-linkerII-R containing the EutM gene (the nucleotide sequence of the downstream primer EutM-linkerII-R is SEQ ID NO.18: AGAACCAGAACCAGAACCAGAACCAGAACCAGAACCTTTCGCGCTCGGCAGAATC). The EutM gene fragment with linkerⅡ at the C-terminus was amplified, and the protein scaffold EutM-linker-Spycatcher was purified using a DNA purification kit (TianGen) for later use.

[0098] In the same way, the plasmid containing the Spycatcher gene was used as a template, and the upstream primer linkerII-Spycatcher-F of the Spycatcher gene (the nucleotide sequence of the upstream primer linkerII-Spycatcher-F is SEQ ID NO.19: GGTTCTGGTTCTGGTTCTGGTTCTGGTTCTggcgggagcgctatgg) and the downstream primer spycatcher-HindIII-R containing the Spycatcher gene (the nucleotide sequence of the downstream primer spycatcher-HindIII-R is SEQ ID NO.20: cccAAGCTTttagtcaatatgggcatcccctttcg) were used to amplify the Spycatcher gene fragment with linkerII at the N-terminus, and the EutM gene fragment was purified using a DNA purification kit (TianGen) for later use.

[0099] The EutM gene was fused with the SpyCatcher gene by Overlap-PCR using EcoRI-EutM-F as the upper primer and spycatcher-HindIII-R as the lower primer, and the EutM-linker-SpyCatcher gene fragment was purified using a DNA purification kit (TianGen).

[0100] Example 4 Recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher build

[0101] The plasmid pRSFDuet-MmCAR was cut with restriction endonuclease HindIII (Shanghai Haojia Co., Ltd.) Q302E ~Spytag-sfp-YahK, use gel recovery kit to recover the target fragment and set it aside.

[0102] The amplified fragment protein scaffold EutM-linker-Spycatcher of Example 3 was added to the recombination system according to the instructions of the c-112 homologous recombinase, and the recombinant plasmid pRSFDuet-MmCAR was obtained at 37°C for 30 minutes. Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher, such as Figure 1 shown.

[0103] Example 5 Construction of high-yield 1,5-PDO strain NT1003-P2 using a plasmid containing the EutM protein scaffold

[0104] The recombinant plasmid pTrc99a-davB-davA-GabT was respectively combined with the recombinant plasmid pRSFDuet-MmCAR carrying the EutM protein scaffold Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher and original plasmid pRSFDuet-MmCAR Q302E -sfp-YahK was introduced into competent cells (prepared with reference to CN114774472B) by electroporation.

[0105] The specific method is:

[0106] First, competent cells were prepared, and then 10 μl of each plasmid was added to 100 μl of competent cells, mixed and added to an electroporation cup pre-cooled for 5 minutes, ice bathed for 10 minutes, and after electroporation, 900 μl of LB solution was added, and the cells were revived at 37°C for 2 hours, and then spread on an LB plate containing kanamycin sulfate and carbenicillin, and cultured at 37°C for 12 hours to obtain strain NT1003-P2 containing the EutM protein scaffold and production strain NT1003-P1.

[0107] Among them, the conditions for the electric shock method are:

[0108] Voltage 1500V capacitance 25uF resistance 200-400 Shock time 5ms

[0109] The specific construction method of pTrc99a-davB-davA-GabT is:

[0110] The gene fragment DavB was amplified using the upstream primer DavB-F and the downstream primer DavB-R;

[0111] The gene fragment DavA was amplified using the upstream primer DavA-F and the downstream primer DavA-R;

[0112] Gene fragment GabT was amplified using upstream primer GabT-F and downstream primer GabT-R;

[0113] Wherein, the upstream primer DavB-F is shown in SEQ ID NO.21:

[0114] aggaaacagaccatgatgaacaaaaaaaaccgtcacccg

[0115] The downstream primer DavB-R is shown in SEQ ID NO.22:

[0116] ggatgattaattgtcaattaagctgcgctagtagacgag

[0117] The gene fragment DavB is shown in SEQ ID NO.23:

[0118]

[0119] The upstream primer DavA-F is shown in SEQ ID NO.24:

[0120] ttgtgagcggataacaatttcacacaggaaacagaccatgcgtatcgctctgtaccag

[0121] The downstream primer DavA-R is shown in SEQ ID NO.25:

[0122] taccgagctcgaattctcagtggtggtggtggtggtgc

[0123] The gene fragment DavA is shown in SEQ ID NO.26:

[0124] ATGCGTATCGCTCTGTACCAGGGTGCTCCGAAACCGCTGGACGTTCCGGGTAACCTGCAGCGTCTGC

[0125] GTCACCAGGCTCAGCTGGCTGCTGACCGTGGTGCTCAGCTGCTGGTTTGCCCGGAAATGTTCCTGTCT

[0126] GGTTACAACATCGGTCTGGCTCAGGTTGAACGTCTGGCTGAAGCTGCTGACGGTCCGGCTGCTATGA

[0127] CCGTTGTTGAAATCGCTCAGGCTCACCGTATCGCTATCGTTTACGGTTACCCGGAACGTGGTGACGAC

[0128] GGTGCTATCTACAACTCTGTTCAGCTGATCGACGCTCACGGTCGTTCTCTGTCTAACTACCGTAAAAC

[0129] CCACCTGTTCGGTGAACTGGACCGTTCTATGTTCTCTCCGGGTGCTGACCACTTCCCGGTTGTTGAAC

[0130] TGGAAGGTTGGAAAGTTGGTCTGCTGATCTGCTACGACATCGAATTCCCGGAAAACGCTCGTCGTCT

[0131] GGCTCTGGACGGTGCTGAACTGATCCTGGTTCCGACCGCTAACATGACCCCGTACGACTTCACCTGCC

[0132] AGGTTACCGTTCGTGCTCGTGCTCAGGAAAACCAGTGCTACCTGGTTTACGCTAACTACTGCGGTGCT

[0133] GAAGACGAAATCGAATACTGCGGTCAGTCTTCTATCATCGGTCCGGACGGTTCTCTGCTGGCTATGG

[0134] CTGGTCGTGACGAATGCCAGCTGCTGGCTGAACTGGAACACGAACGTGTTGTTCAGGGTCGTCGTGC

[0135] TTTCCCGTACCTGACCGACCTGCGTCAGGAACTGCACCTGCGTAAAGGT

[0136] The upstream primer GabT-F is shown in SEQ ID NO.27:

[0137] aaggagatatacatatgatgaacagcaataaagagttaatgcagc

[0138] The downstream primer GabT-R is shown in SEQ ID NO.28:

[0139] tatccaattgagatctctgcttcgcctcatcaaaacact

[0140] The gene fragment GabT is shown in SEQ ID NO.29:

[0141] ATGAACAGCAATAAAGAGTTAATGCAGCGCCGCAGTCAGGCGATTCCCCGTGGCGTTGGGCAAATTC

[0142] ACCCGATTTTCGCTGACCGCGCGGAAAACTGCCGGGTGTGGGACGTTGAAGGCCGTGAGTATCTTGA

[0143] TTTCGCGGGCGGGATTGCGGTGCTCAATACCGGGCACCTGCATCCGAAGGTGGTGGCCGCGGTGGAA

[0144] GCGCAGTTGAAAAAACTGTCGCACACCTGCTTCCAGGTGCTGGCTTACGAGCCGTATCTGGAGCTGT

[0145] GCGAGATTATGAATCAGAAGGTGCCGGGCGATTTCGCCAAGAAAACGCTGCTGGTTACGACCGGTTC

[0146] CGAAGCGGTGGAAAACGCGGTAAAAATCGCCCGCGCCGCCACCAAACGTAGCGGCACCATCGCTTT

[0147] TAGCGGCGCGTATCACGGGCGCACGCATTACACGCTGGCGCTGACCGGCAAGGTGAATCCGTACTCT

[0148] GCGGGCATGGGGCTGATGCCGGGTCATGTTTATCGCGCGCTTTATCCTTGCCCGCTGCACGGCATAA

[0149] GCGAGGATGACGCTATCGCCAGCATCCACCGGATCTTCAAAAATGATGCCGCGCCGGAAGATATCGC

[0150] CGCCATCGTGATTGAGCCGGTTCAGGGCGAAGGCGGTTTCTACGCCTCGTCGCCAGCCTTTATGCAG

[0151] CGTTTACGCGCTCTGTGTGACGAGCACGGGATCATGCTGATTGCCGATGAAGTGCAGAGCGGCGCGG

[0152] GGCGTACCGGCACGCTGTTTGCGATGGAGCAGATGGGCGTTGCGCCGGATCTTACCACCTTTGCGAA

[0153] ATCGATCGCGGGCGGCTTCCCGCTGGCGGGCGTCACCGGGCGCGCGGAAGTAATGGATGCCGTCGCT

[0154] CCAGGCGGTCTGGGCGGCACCTATGCGGGTAACCCGATTGCCTGCGTGGCTGCGCTGGAAGTGTTGA

[0155] AGGTGTTTGAGCAGGAAAATCTGCTGCAAAAAGCCAACGATCTGGGGCAGAAGTTGAAAGACGGAT

[0156] TGCTGGCGATAGCCGAAAAACACCCGGAGATCGGCGACGTACGCGGGCTGGGGGCGATGATCGCCA

[0157] TTGAGCTGTTTGAAGACGGCGATCACAACAAGCCGGACGCCAAACTCACCGCCGAGATCGTGGCTCG

[0158] CGCCCGCGATAAAGGCCTGATTCTTCTCTCCTGCGGCCCGTATTACAACGTGCTGCGCATCCTTGTAC

[0159] CGCTCACCATTGAAGACGCTCAGATCCGTCAGGGTCTGGAGATCATCAGCCAGTGTTTTGATGAGGC

[0160] GAAGCAGTAG

[0161] The amplified gene fragments davB and davA were inserted into the two restriction sites NcoI and EcoRI (provided by Shanghai Haojia Co., Ltd.) in pTrc99a by homologous recombination to obtain pTrc99a-davB-davA.

[0162] The amplified gene fragment GabT was inserted into the two restriction sites of SacI and XbaI (provided by Shanghai Haojia Co., Ltd.) of pTrc99a-davB-davA by homologous recombination to obtain pTrc99a-davB-davA-GabT.

[0163] Example 6 Production of 1,5-PDO by Shake Flask Fermentation of Recombinant Strain

[0164] The production strain NT1003-P1 and the recombinant strain NT1003-P2 were subjected to fermentation experiments. The specific fermentation method was as follows: the monoclonal strain on the LB plate was placed in a 50 ml shake tube containing 5 ml LB liquid culture medium, the total antibiotic concentration was 2‰, and cultured at 37°C for 12 hours.

[0165] Then, the liquid seed culture was inoculated into 30 ml of fermentation medium and cultured at 37°C and 200 rpm. 600 When the value is 1, 0.5mM of inducer IPTG and 10g / L α-KG are added to the fermentation medium. After glucose is consumed, 20g / L glucose is added until glucose consumption stops. The total fermentation time is 96h. Samples are taken every 12h and centrifuged at 12000rpm for 3min. The supernatant is taken and stored at -80℃ for testing.

[0166] The fermentation results are as follows Figure 2 As shown in , the recombinant strain NT1003-P2 produced a total of 1.84 g / L of 1,5-PDO using glucose as a substrate, which was twice the yield of the strain NT1003-P1 without assembled protein scaffold.

[0167] Example 7 Recombinant strain whole cell catalytic production of 1,5-PDO

[0168] Pick out single colonies of production strain NT1003-P1 and recombinant strain NT1003-P2 respectively and place them in 5 mL LB liquid medium with kanamycin and carbenicillin, and culture at 37°C for 12 h. Transfer the bacterial solution to 100 mL LB liquid medium with resistance and continue to culture, with an inoculum size of 2.5% and an OD 600 When the p-value was about 0.6, 0.5 mM IPTG was added, and the bacteria were harvested after induction at 18°C ​​for 18 h. Subsequently, the bacteria were collected by centrifugation at 4°C, 6000 rpm, for 15 min, and then washed with PBS salt buffer and centrifuged for later use.

[0169] The catalytic system is:

[0170] The cell concentration is OD 600 =20, 50mM 5-HV and 50mM glucose (100mM PBS, pH=7.0). After reacting at 30℃, 200rpm for 8h, samples were taken and centrifuged at 12000rpm for 5min to take the supernatant to detect the formation of 1,5-PDO. The 1,5-PDO values ​​of each product were detected and compared by high performance liquid chromatography. The results are as follows Figure 3 shown.

[0171] In the 12h catalytic results, the recombinant strain NT1003-P2 was about to Q302E Assembly onto the scaffold of EutM significantly increased the capacity of the 1,5-PDO production module, which was 1.3 times higher than that of the system with the production strain NT1003-P1.

Claims

1. A recombinant strain NT1003-P2 of EutM natural protein scaffold coupled with carboxylic acid reductase mutant, characterized in that: First, the carboxylic acid reductase assembly element MmCAR was constructed Q302E -linker-Spytag and plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK, and then constructed the protein scaffold EutM-linker-Spycatcher and plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher, and finally the recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher and plasmid pTrc99a-davB-davA-GabT were co-transformed into the lysine high-producing bacteria NT1003 to obtain strain NT1003-P2.

2. A recombinant strain NT1003-P2 based on a EutM natural protein scaffold coupled with a carboxylic acid reductase mutant according to claim 1, characterized in that: The following steps are involved: Step 1, carboxylic acid reductase assembly element MmCAR Q302E -Linker-Spytag build MmCAR Q302E -linker-F and MmCAR Q302E -linker-R is the upstream and downstream primers for MmCAR Q302E PCR amplification was performed, and the amplified fragment was recovered and connected with the binding molecule peptide Spytag through PCR overlap technology to obtain the fragment MmCAR Q302E -linker-spytag; Step 2, recombinant plasmid pRSFDuet-MmCAR Q302E -linker-spytag-sfp-YahK build The recombinant plasmid was obtained by homologous recombination with the linear pRSFDuet-sfp-YahK. pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK; Step 3, Construction of protein scaffold EutM-linker-Spycatcher The C-terminus of the natural fibrous protein EutM and the binding protein Spycatcher were fused and expressed to construct the protein scaffold EutM-linker-Spycatcher; Step 4, recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher build The amplified fragment was inserted into the plasmid by homologous recombination pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK HindIII restriction site to obtain the recombinant plasmid pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher Step 5, pRSFDuet-MmCAR Q302E -linker-Spytag-sfp-YahK-EutM-linker-Spycatcher and plasmid pTrc99a-davB-davA-GabT were co-transformed into the lysine high-producing bacteria NT1003 to obtain the high-yield 1,5-PDO strain NT1003-P2.

3. The construction method according to claim 2, characterized in that: Primer MmCAR in step 1 Q302E The nucleotide sequence of -linker-F is shown in EQ ID NO. 11, aggaacagaccatggaattcatggaattcatgatgggcccg; primer MmCAR Q302E The nucleotide sequence of -linker-R is shown in EQ ID NO. 12, gtcgacaccggatccccctgaaccctcgagcagcagacccagcagacgcagatcact.

4. Use of the recombinant strain NT1003-P2 constructed based on the construction method of claim 2 in synthesizing 1,5-PDO.

Images