Application of OsST1 gene in regulating and controlling salt tolerance of rice

Abstract

The invention discloses an application of an OsST1 gene in regulating and controlling the salt tolerance of rice. Belongs to the technical field of plant genetic engineering. The invention provides the application of the OsST1 gene in regulation and control of the salt tolerance of the rice, the effect of the OsST1 gene in the salt tolerance of the rice is proved for the first time, and research finds that overexpression of the OsST1 gene can improve the salt tolerance of a rice plant and improve the survival rate of the rice plant under salt stress, which indicates that the OsST1 gene has the effect of regulating and controlling the salt tolerance of the plant, and the application of the OsST1 gene in the regulation and control of the salt tolerance of the rice plant. The adverse effect of soil salinization on rice growth in practical application is solved, and meanwhile, biological function verification of the gene also has important reference significance for rice salt tolerance molecular mechanism research.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more specifically to the application of OsST1 gene in regulating the salt tolerance of rice. Background Art

[0002] Soil salinization is one of the major disasters that restricts the growth and production of crops worldwide. According to statistics, the area of ​​salinized land in the world is expanding year by year, resulting in a reduction in arable land, which is one of the key factors causing the food crisis. With the continuous growth of population and the limited area of ​​arable land, coupled with unreasonable irrigation practices, secondary soil salinization has been aggravated. Rice is one of the most important food crops in my country and the preferred food crop for the improvement of coastal tidal flats and saline-alkali soils. However, rice growth is sensitive to salt stress, and soil salinization can cause rice growth to be hindered and yield to decrease. High concentrations of salt can affect the absorption of water and nutrients by rice roots, affecting the growth, development and yield of rice. In addition, soil salinization requires more agricultural water flushing to reduce the salt content in the soil, which may increase irrigation costs and water resource consumption.

[0003] Therefore, mining rice salt-tolerant genes and analyzing the genetic and molecular mechanisms of rice salt tolerance can provide a good theoretical basis for breeding new salt-tolerant rice varieties. At the same time, it has far-reaching significance for global food security, sustainable agricultural development, sustainable utilization of land resources, and improvement of the ecological environment. However, at this stage, there are relatively few studies on rice salt-tolerant genes. The inventor's research team has been engaged in the mining of rice abiotic stress-related functional genes, and obtained a gene OsST1 with unknown function through analysis by bioinformatics and other means. Therefore, how to explore the functions of many unknown genes, develop rice salt-tolerant genes, and apply them in the breeding of rice salt-tolerant varieties is a technical problem that technicians in this field urgently need to solve. Summary of the invention

[0004] In view of this, the present invention provides an application of the OsST1 gene in regulating the salt tolerance of rice. Through research, it is found that overexpressing the OsST1 gene can improve the salt tolerance of rice plants and improve their survival rate under salt stress, indicating that the OsST1 gene has a positive effect on regulating the salt tolerance of rice, which is beneficial to solving the adverse effects of soil salinization on rice growth in practical applications.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] Application of OsST1 gene, the application is any one of the following:

[0007] (1) Application in regulating rice salt tolerance;

[0008] (2) As a biological indicator for salt tolerance testing;

[0009] (3) Application in breeding of salt-tolerant rice varieties;

[0010] The nucleotide sequence of the OsST1 gene is shown in SEQ ID No.1.

[0011] Another object of the present invention is to provide: an application of the protein encoded by the OsST1 gene, wherein the application is any one of the following:

[0012] (1) Application in regulating rice salt tolerance;

[0013] (2) As a biological indicator for salt tolerance testing;

[0014] (3) Application in the breeding of salt-tolerant rice varieties.

[0015] Preferably, the amino acid sequence of the protein encoded by the OsST1 gene is shown as SEQ ID No.2.

[0016] Another object of the present invention is to provide: an overexpression vector pCAMBIA1300-GFP-OsST1, comprising the above-mentioned OsST1 gene.

[0017] Another object of the present invention is to provide: a recombinant engineered bacterium comprising the above-mentioned overexpression vector pCAMBIA1300-GFP-OsST1.

[0018] Another object of the present invention is to provide the use of the above-mentioned overexpression vector pCAMBIA1300-GFP-OsST1 or the above-mentioned engineering bacteria in improving the salt tolerance of rice or in breeding salt-tolerant rice varieties.

[0019] Another object of the present invention is to provide: a method for improving the salt tolerance of rice, by overexpressing the OsST1 gene to improve the tolerance of rice to salt stress.

[0020] It can be seen from the above technical solution that compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention discloses the application of OsST1 gene in regulating rice salt tolerance, discloses for the first time the gene OsST1 with the function of regulating salt tolerance in rice, and promotes the annotation of its gene function. The tolerance of rice to salt stress can be improved by overexpressing OsST1 gene, indicating that the gene positively regulates high salt stress of rice. The adverse effect of salinized soil on rice growth in practical application process is solved, and it has social benefits and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0023] Figure 1 : Linearized pCAMBIA1300-GFP vector map;

[0024] Figure 2 The following are: the expression levels of OsST1 protein in three homozygous transgenic lines OE-1, OE-2, OE-5 and wild-type plants;

[0025] Figure 3 A: Identification of salt tolerance of OsST1 overexpressing plants; A: Growth status of plants after 150mM NaCl treatment; B: Statistical results of rice seedling survival rate after 6 days of recovery;

[0026] Among them, Nip represents the wild type Nipponbare, OE-1, OE-2, and OE5 represent OsST1 overexpressing plants; one star indicates a significant difference compared with the control, and two stars indicate a very significant difference compared with the control. DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The nucleotide sequence of the OsST1 gene is shown in SEQ ID No. 1:

[0029] ATGGTACTACCAGACTCCGTCCCTGAGAACCTGAAGGCCATTGACATTGTTGTCAACCATGAGAATGGAAAGAACTGTTCCATCAGAGTGAGGCTTGAGGCCATTGACAAGCTCAGGCTAGCTTGGAACACTAGCGTGCAGCCGGTGGCGGCCCCGCTGCTCCTCCGCATGAAGTCCGGCAAGGGCGCCCACCGCAGCGAGAACATCTTCTGGGAGACCACCATGGAGTCCACCATCTTCCTCGTCGACGACAACTCCTCCTCCTCCTGCGCCGGCGGCGGCGACGATGATTACCACTACCTCGACGCCTGCTTCCTCTGCAAGCGGGACATCACTTCAACCGCCACATCTTCATGTACAAGTACGGGGAACGTGGCGTTCTGCTGCGACGACTGCAGGCAGGACAAGATGGACATGGACTCCGCGCTCGCCGCCGTCAAGCGCCGCCACCGCACGCTGCAACGCAGCAGCAGGGACAGGTCGTCCTCCTCCTCGTCGGCGCCGGCGGAGGCACAGTGCGCCGACAACGAGGCGGGCCTCTTTGCGGTGATCCCCCGCCGCCCCACCGTCTCTGACCTCACCACCCACGCTGCTCCCGCCGTGTCTGGCTAG, SEQ ID No.1.

[0030] The amino acid sequence encoded by the OsST1 gene is shown in SEQ ID No.2:

[0031] MVLPDSVPENLKAIDIVVNHENGKNCSIRVRLEAIDKLRLAWNTSVQPVAAPLLLRMKSGKGAHRSENIFWETTMESTIFLVDDNSSSSCAGGGDDDYHYLDACFLCKRDITSTATSSCTSTGNVAFCCDDCRQDKMDMDSALAAVKRRHRTLQRSSRDRSSSSSSAPAEAQCADNEAGLFAVIPRRPTVSDLTTHAAPAVSG*, SEQ ID No.2.

[0032] Example 1

[0033] 1) Obtaining total RNA

[0034] Total RNA was extracted from the ears of japonica rice variety Nipponbare (stored at the Rice Research Institute of Guangdong Academy of Agricultural Sciences) using a plant RNA extraction kit (Magen), and the purity and concentration of RNA were detected using NANODROP 2000C (Thermo SCIENTIFIC).

[0035] 2) Acquisition of total cDNA

[0036] 1 μg of high-quality RNA was reverse transcribed to obtain cDNA, and the reverse transcriptase was PrimeScript (TAKARA).

[0037] 3) Obtaining the full-length cDNA of the target gene

[0038] According to the target gene, specific amplification primers were designed, and the target gene was amplified using cDNA as a template and KOD FX polymerase (ToYoBo). The specific amplification primer sequences are as follows:

[0039] F: 5'-CTGATTAACAGGGATCCCCCATGGTACTACCAGACTCC-3', SEQ ID No. 3;

[0040] R: 5'-TCGAGACTAGTGGTACCCCCGCCAGACACGGCGGGAGC-3', SEQ ID No. 4;

[0041] The amplification system is: cDNA 0.5μL (cDNA content 200ng), F primer (10pmol / L) 0.5μL, R primer (10pmol / L) 0.5μL, 2mM dNTP 2μL, 2*Buffer 15μL, KOD enzyme (1.0U / μL) 0.5μL, add water to 30μL. The reaction program is: 98℃3min; 98℃30sec, 60℃25sec, 68℃30sec, 35 cycles; 68℃10min.

[0042] 4) Construction of overexpression vector

[0043] The pCAMBIA1300-GFP vector was linearized with restriction endonuclease SmaⅠ (TAKARA). (The pCAMBIA1300-GFP vector was transformed from the pCAMBIA1300 vector and contains the maize Ubiquitin promoter and GFP tag. It was preserved by the Rice Research Institute of Guangdong Academy of Agricultural Sciences. The vector map is shown in Figure 1As shown). After the vector digestion products and PCR products were purified and recovered, they were recombined using a recombination kit (Novozyme). The recombination system was: target fragment: [0.04×insert fragment base pair number] ng, vector fragment: [0.02×cloning vector base pair number] ng, 5X buffer 2μL, ExnaseII 1μL, add water to make up to 10μL. Recombination was carried out at 37℃ for 30min. All ligation products were taken and CaCl 2 Transformed into E. coli DH5α, the transformation product was coated on LB solid medium (containing kanamycin resistance, the concentration of kanamycin was 50 mg / L). Cultured at 37°C overnight, 10 single clones were selected for plasmid extraction, and colony PCR was used for identification. Two positive clones were selected for sequencing. Finally, the overexpression vector pCAMBIA1300-GFP-OsST1 containing the OsST1 target gene was obtained.

[0044] Example 2

[0045] 1) Obtaining OsST1 overexpressing plants

[0046] The overexpression vector pCAMBIA1300-GFP-OsST1 constructed above was transformed into the japonica rice variety Nipponbare by using the genetic transformation method mediated by Agrobacterium EHA105. T0 generation transgenic seedlings were obtained through selection, culture, differentiation, rooting and seedling hardening (the acquisition of genetic transformation materials was entrusted to Wuhan Boyuan Biotechnology Co., Ltd.).

[0047] The DNA of the transgenic seedlings was extracted using a plant DNA extraction kit (Magen), and PCR was performed to identify and amplify the GFP fragment. The specific amplification primer sequences are as follows:

[0048] F: 5'-CAAGCTGACCCTGAAGTTCA-3', SEQ ID No. 5;

[0049] R: 5'-ATGTGATCGCGCTTCTCGTT-3', SEQ ID No. 6;

[0050] The amplification system is: DNA 1μL (DNA content 200ng), F primer (10pmol / L) 0.5μL, R primer (10pmol / L) 0.5μL, 2*Taq Mix 10μL, add water to 20μL. The reaction program is: 95℃3min; 95℃30sec, 52℃25sec, 72℃30sec, 30 cycles; 72℃10min.

[0051] The 20 positive transgenic seedlings were propagated to obtain T1 and T2 generations. If the T2 generation plants sampled and tested were all transgenic plants, it was proved that the strain was homozygous. Three homozygous transgenic strains (OE-1, OE-2, OE-5) were selected for Western Blot detection (with Nipponbare as the control), and T3 generation plants were obtained by continued planting, and T3 generation plants were used for subsequent experimental analysis.

[0052] 2) Detection of OsST1 overexpression effect

[0053] The process of Western Blot identification of the overexpression effect of OsST1 gene in transgenic plants is as follows:

[0054] A: Extract total protein from rice leaves at the four-leaf stage. The extract composition is as follows: 0.1MTris-HCl (pH=8.0), 10% glycerol, 3.3% SDS, 0.05% β-mercaptoethanol. The extracted total protein is stored at -80℃;

[0055] B: 20 ​​μL of protein sample was separated by SDS-PAGE gel electrophoresis, incubated with GFP antibody (Trans Company) and detected by Western Blot.

[0056] Results: The expression levels of OsST1 protein in the three homozygous transgenic lines and wild-type Nipponbare rice plants were as follows: Figure 2 As shown, all three strains accumulated OsST1-GFP fusion protein, while the wild-type plants did not show the target band. This result indicated that all three strains achieved the effect of overexpression of OsST1.

[0057] Example 3

[0058] Identification of salt tolerance phenotype of OsST1 overexpressing plants

[0059] The three homozygous T3 generation strains (OE-1, OE-2, OE-5) and wild-type Nipponbare rice seeds in Example 2 were broken dormancy at 49°C, soaked, and germinated. When they grew to the three-leaf and one-heart stage under natural conditions, the wild-type Nipponbare and homozygous OsST1 overexpressing transgenic plant seedlings were transferred to a 150 mM NaCl solution for 8 days and then recovered under normal conditions for 6 days. Photos were taken and the survival rate was counted, and three biological replicates were performed for each material.

[0060] Result analysis: The results before and after treatment are shown in Figure 3 In Figure A, after treatment with 150 mM NaCl, the growth status of the overexpression plants was significantly better than that of the control group Nipponbare.

[0061] The survival results are shown in Figure 3In middle B, after treatment with 150 mM NaCl, the average survival rates were: Nip: 8.3%; OE-1: 29.2%; OE-2: 45.8%; OE-5: 33.3%.

[0062] According to the above embodiments, the present invention obtains a gene OsST1 that plays an important role in the salt stress response process; we successfully transformed rice with the OsST1 overexpression vector through the Agrobacterium-mediated transformation method to obtain homozygous T3 generation transgenic rice plants; we found that under salt stress conditions, the survival rate of OsST1 overexpressing plants was significantly higher than that of wild-type Nipponbare; the above results indicate that the gene OsST1 in rice can improve the tolerance of rice to salt stress.

[0063] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0064] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of OsST1 gene is characterized by: The application is any of the following: (1) Application in regulating rice salt tolerance; (2) As a biological indicator for salt tolerance testing; (3) Application in breeding of salt-tolerant rice varieties; The nucleotide sequence of the OsST1 gene is shown in SEQ ID No.

1.

2. Application of the protein encoded by the OsST1 gene, characterized in that: The application is any of the following: (1) Application in regulating rice salt tolerance; (2) As a biological indicator for salt tolerance testing; (3) Application in the breeding of salt-tolerant rice varieties.

3. The use according to claim 2, characterized in that The amino acid sequence of the protein encoded by the OsST1 gene is shown in SEQ ID No.

2.

4. An overexpression vector pCAMBIA1300-GFP-OsST1, characterized in that: Comprising the OsST1 gene according to claim 1.

5. A recombinant engineered bacterium, characterized in that: It comprises the overexpression vector pCAMBIA1300-GFP-OsST1 described in claim 4.

6. Use of the overexpression vector pCAMBIA1300-GFP-OsST1 according to claim 4 or the engineered bacteria according to claim 5 in improving the salt tolerance of rice or in breeding salt-tolerant rice varieties.

7. A method for improving salt tolerance of rice, characterized in that: Overexpression of OsST1 gene can improve the tolerance of rice to salt stress.

Images