Plant temperature stress resistance gene RAD and application thereof

Abstract

The invention discloses a plant temperature stress resistance gene RAD and application thereof, relates to the field of molecular biology, and in particular relates to a plant temperature stress resistance gene and application thereof in improving temperature applicability and increasing crop yield. The invention provides a nucleotide sequence of the temperature stress resistance gene RAD and a coded protein sequence, the gene can obviously enhance the temperature stress resistance of plants and improve the growth condition of the plants, and a certain theoretical basis and a new gene resource are provided for the breeding of temperature stress resistance varieties of the plants.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to plant temperature stress resistance genes and their application in improving temperature adaptability and increasing crop yield. Background Art

[0002] Temperature is one of the biggest variables in a plant's growth environment. As outdoor temperatures fluctuate greatly and are difficult to predict, plants may be threatened by low or high temperatures when growing in a natural environment. When plants encounter unforeseen low or high temperatures, or are planted in an environment that exceeds their temperature tolerance range, plant growth may be greatly affected, or even lead to plant death. For example, lychee is a plant with male and female flowers on the same plant, and the development of its flowers and fruits is greatly affected by temperature. Excessively high temperatures can cause the flower buds to "rush to the top", affecting the formation of flower buds and thus the yield; low temperatures are also not conducive to the development of fruits, thereby reducing yields and seriously affecting the economic benefits of lychees. In production, many plants that are intolerant of temperature often face many problems such as low yields and unstable yields. Improving the temperature resistance of plants has very important economic value and broad application prospects. Summary of the invention

[0003] In view of the above technical problems, the present invention provides a new temperature stress-resistant gene RAD, which specifically regulates the resistance of plants to temperature stress and the growth of their root system.

[0004] In order to achieve the above objectives, this application adopts the following technical solutions:

[0005] A plant temperature stress resistance gene RAD includes EcaRAD cds or LcRAD cds. The nucleotide sequence of the temperature stress resistance gene EcaRAD cds is shown in EQ ID No.1; the nucleotide sequence of the temperature stress resistance gene LcRAD cds is shown in EQ ID No.2.

[0006] Furthermore, the temperature stress resistance gene RAD and the EcaRAD protein sequence encoded by the EcaRAD cds are shown as EQ ID No.3, and the LcRAD protein sequence encoded by the temperature stress resistance gene LcRAD cds is shown as EQ ID No.4.

[0007] Furthermore, the plant temperature stress resistance gene RAD is used to increase plant yield or improve plant temperature adaptability.

[0008] Furthermore, the application includes the following steps: constructing a vector, transferring the vector into Agrobacterium, and transforming plants with Agrobacterium; the vector is a pEarlyGate201 vector, including an EcaRAD-pEarlyGate201 vector or a LcRAD-pEarlyGate201 vector.

[0009] Compared with the prior art, the beneficial effects of the present invention are as follows: the temperature stress-resistant gene and the encoded protein provided by the present invention can significantly improve the high and low temperature tolerance of plants, the tolerance of plants to the living environment, and expand the planting area of ​​temperature-sensitive plants. The present application also increases the yield of plants, and the transgenic plants grow more robustly and have larger leaf areas, thereby improving the land utilization rate per unit of plant planting. The effects of the present application have been verified in Arabidopsis and tobacco, and it can be applied to plants such as litchi, tobacco, and rice, and has important theoretical significance and broad application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0011] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0012] In the attached figure:

[0013] Figure 1 Schematic diagram of the EcaRAD-pEarlyGate201 vector;

[0014] Figure 2 This is a schematic diagram of the LcRAD-pEarlyGate201 vector;

[0015] Figure 3 Agarose gel electrophoresis for DNA PCR identification of Arabidopsis and tobacco overexpressing EcaRAD and LcRAD;

[0016] Figure 4 Identification of the expression level of Arabidopsis thaliana overexpressing EcaRAD, where WT represents wild-type Arabidopsis, E represents Arabidopsis thaliana overexpressing EcaRAD, L represents Arabidopsis thaliana overexpressing LcRAD, and numbers represent groups;

[0017] Figure 5 To identify the expression level of Arabidopsis thaliana overexpressing LcRAD;

[0018] Figure 6To identify the expression level of Nicotiana benthamiana overexpressing EcaRAD;

[0019] Figure 7 To identify the expression level of Nicotiana benthamiana overexpressing LcRAD;

[0020] Figure 8 To count the number of transgenic Arabidopsis pods;

[0021] Fig. 9 Comparison of the growth status of transgenic Arabidopsis and wild-type Arabidopsis under different temperature treatments, where the left side is a low temperature environment (22℃ / 20℃ day / night), the right side is a high temperature environment (28℃ / 26℃ day / night), the top row is wild-type Arabidopsis, and the bottom row is transgenic Arabidopsis;

[0022] Fig.10 Comparison of the growth status of transgenic Arabidopsis and wild-type Arabidopsis under different temperature treatments;

[0023] Fig.11 Comparison of the growth status of wild-type Arabidopsis and overexpression Arabidopsis seedlings;

[0024] Fig.12 Comparison of root hair growth status between wild-type Arabidopsis and overexpressing Arabidopsis, where WT represents wild-type Arabidopsis, E represents EcaRAD overexpressing Arabidopsis, L represents LcRAD overexpressing Arabidopsis, and numbers represent groups. DETAILED DESCRIPTION

[0025] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Modifications or substitutions made to the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc. used in the examples of the present invention are all commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.

[0026] In some embodiments, the culture medium formulation used is as follows:

[0027] MS culture medium: MS powder 4.74 g / L; sucrose 30 g / L; Ph = 5.8-5.9.

[0028] Tobacco co-cultivation medium: MS powder 4.74 g / L; sucrose 30 g / L; 6-BA 2 mg / L; NAA 1 mg / L; AS 100 uM; Ph = 5.8-5.9; Agar 8 g / L.

[0029] Tobacco differentiation medium: MS powder 4.74 g / L; sucrose 30 g / L; 6-BA 2 mg / L; NAA 1 mg / L; Ph = 5.8-5.9; Agar 8 g / L; Cef 400 mg / L; plant resistance screening antibiotic herbicide (basta) 5-10 mg / L.

[0030] Tobacco rooting medium: 1 / 2MS powder 2.47g / L; sucrose 25g / L; NAA 0.1-0.3mg / L; IBA 0.1-0.3mg / L; Cef 400mg / L; plant resistance screening antibiotic herbicide (basta) 5-10mg / L.

[0031] The target gene used in the present invention is EcaRAD cds or LcRAD cds. The nucleotide sequence of EcaRAD cds is shown in EQ ID No.1, and the nucleotide sequence of LcRAD cds is shown in EQ ID No.2.

[0032] Example 1: Construction of vector

[0033] (1) Gene cloning

[0034] The cDNA of litchi and cyperus umbellata flower buds were used as amplification templates, respectively, and the Primestar high-fidelity enzyme produced by Takara was used for amplification.

[0035] The reaction system used was: PrimestarMAX Premix 25ul; Primer 11ul; Primer 21ul; Template 1ul; Sterile water 22ul; Total volume 50ul.

[0036] Amplification conditions were as follows: 98°C for 2 min; 98°C for 10 s; 55°C for 15 s; 72°C for 1 min and 40 s; Step 2-step 431 cycle; 72°C for 5 min; and constant temperature storage at 16°C.

[0037] The primers used for gene amplification are:

[0038] LcRAD-F(3102):tttggagaggacacgctcgagATGCCGGTGCAGGTGAAA

[0039] LcRAD-R(3102):agcaggactctagggactagtTTACACGTTTACTTTTGCTGGAAGG

[0040] EcaRAD-CE8-F:5'-tttggagaggacacgctcgagATGCCGGTGGCGACGAGA-3'

[0041] EcaRAD-CE8-R:5'-agcaggactctagggactagtTTAAGCGTAATCTGGAACATCGTATG-3'

[0042] Recovery of PCR products: 50ul of PCR product; 5ul of 3M NaOAC; 250ul of anhydrous ethanol. Mix well, centrifuge at 4°C, 10000g for 30min, discard the supernatant, gently rinse the precipitate with 70% ethanol, discard the supernatant, dry at room temperature until the precipitate is colorless and transparent, add 50ul of sterile water to dissolve the precipitate, measure the concentration with NanoDrop 2000, and store at -20°C.

[0043] (2) Double enzyme digestion

[0044] The backbone vector used was pEarlyGate201 (CE8);

[0045] The vector was digested with double enzymes, and the restriction sites used were: 5'Xho1: CTCGAG; 3'Spe1: ACTAGT.

[0046] The enzyme digestion system is: XbaI 1ul; SpeI 1ul; vector plasmid 1ng; rCutsmartbuffer 5ul; sterile water to 50ul; overnight enzyme digestion at 37℃.

[0047] Recover the enzyme cleavage product; 50ul of enzyme cleavage product; 5ul of 3M NaOAC; 250ul of anhydrous ethanol; mix well, centrifuge at 4°C, 10000g for 30min; discard the supernatant, gently rinse the precipitate with 70% ethanol, and discard the supernatant; dry at room temperature until the precipitate is colorless and transparent, add 50ul of sterile water to dissolve the precipitate, measure the concentration with NanoDrop 2000, and store at -20°C.

[0048] (3) Recombinant vector

[0049] The recombinant vector was constructed using the infusion method. The reaction system was: 2XCE mix 5ul; target gene fragment 0.03pmol; enzyme-cut vector fragment 0.06pmol; add sterile water to 10ul and mix gently; 50℃15min; store on ice.

[0050] (4) Conversion

[0051] Escherichia coli was transformed as follows: 50ul of DH5α competent cells; 5ul of target gene and vector ligation product; gently mixed, allowed to stand on ice for 30min, heat-shocked in a 42°C metal bath for 45s, allowed to stand on ice for 2min, added with 1ml of antibiotic-free LB liquid culture medium, cultured at 37°C in a shaker at 220rpm for 1h; centrifuged at 12000rpm for 1min, discarded the supernatant, resuspended the bacteria, evenly spread on a plate containing 50mg / L Kana LB solid culture medium, and cultured in an incubator at 37°C overnight; screened the bacteria by colony PCR and sequenced, extracted the plasmid, and used it to transform Agrobacterium.

[0052] The plasmid extraction method is as follows: centrifuge at 13,000×g for 1 minute and collect 1-5 ml of bacteria. Discard the culture medium and gently tap on absorbent paper to absorb the residual liquid; add 250ul Buffer P1 / RNaseA mixture and resuspend the bacteria by high-speed vortexing; make sure RNaseA has been added to Buffer P1 before use; thorough resuspension of bacteria is critical to yield, and no bacterial clumps should be seen after resuspension; add 250ul Buffer P2 to the resuspension and mix by inversion 8-10 times; add 350ul Buffer NP3 and immediately invert 8-10 times to completely neutralize the solution; centrifuge at 13,000×g for 2 minutes; install HiPure DNAMini Column IV in the collection tube, transfer the supernatant to the column, and centrifuge at 13,000×g for 30-60 seconds; discard the filtrate, put the column back into the collection tube, and add 500ul Buffer PW1 to the column. Centrifuge at 13,000×g for 30-60 seconds; discard the filtrate and put the column back into the collection tube. Add 600ul BufferPW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 13,000×g for 30-60 seconds; discard the filtrate and put the column back into the collection tube. Add 300ul BufferPW2 (diluted with anhydrous ethanol) to the column; centrifuge at 13,000×g for 3 minutes; discard the filtrate and put the column back into the collection tube. Centrifuge at 13,000xg for 3 minutes to dry the column. Put the column into a sterilized 1.5ml centrifuge tube and add 50ul Elution Buffer to the center of the column membrane. Let stand for 1 minute and centrifuge at 13,000xg for 1 minute to elute the DNA. Discard the column and store the plasmid at -20℃.

[0053] Get as Figure 1 The EcaRAD-pEarlyGate201 vector shown and Figure 2 The LcRAD-pEarlyGate201 vector is shown.

[0054] Example 2: Agrobacterium transformation

[0055] 1) Add 2ul of the constructed vector in Example 1 to 30ul of GV3101 competent cells, mix carefully, and place on ice for 5min;

[0056] 2) Quickly freeze in liquid nitrogen for 5 minutes;

[0057] 3) 37°C for 5 min;

[0058] 4) Place on ice for 5 min;

[0059] 5) Add 1 ml of YEP liquid medium without antibiotics and culture at 28°C in a shaking incubator for 1.5 h;

[0060] 6) Centrifuge at 8000 rpm for 1 min at 28°C, apply K / Rif YEP medium to the plate, and incubate at 28°C incubator for 2 days;

[0061] 7) Pick a single clone colony to screen the bacteria, shake the bacteria, and preserve the bacteria; obtain Agrobacterium carrying the vector of Example 1.

[0062] Example 3: Preparation of infection solution

[0063] 1) Take the Agrobacterium culture prepared in Example 2 and add it to 10 ml YEP medium (with kanamycin and rifampicin), and culture it in a shaking incubator at 28°C overnight.

[0064] 2) Take 2 ml of overnight cultured bacterial solution and add it to 60 ml of freshly prepared sterile YEP medium (with kanamycin and rifampicin), add acetosyringone to improve bacterial activity, and culture until OD600 is between 0.8-1.0

[0065] 3) Centrifuge at 28°C, 5000 rpm, 5 min, collect the cells, wash once with sterile water and collect the cells again

[0066] 4) Add sterile water until OD600=0.8, add sucrose (final concentration 5%), and 0.05% silweet L-77; obtain an infection solution containing Agrobacterium of Example 2.

[0067] Example 4: Infection of Arabidopsis thaliana plant material

[0068] 1) Water the plants thoroughly the night before infection to promote the opening of Arabidopsis stomata. If it is the first time to infect Arabidopsis, cut off the fruit pods and opened flowers to improve the infection efficiency; if it is Arabidopsis that has been infected before, do not remove the fruit pods and opened flowers.

[0069] 2) Soak the unopened inflorescence of Arabidopsis thaliana in the infection solution of Example 3 for 30 seconds, shake gently, take out the inflorescence after the timer ends, and gently pinch the inflorescence to promote infection; absorb excess infection solution with filter paper, and place the Arabidopsis thaliana flat in a moisturizing box, cover with plastic wrap to keep moisture, and leave it overnight away from light.

[0070] 3) The next day, the infected Arabidopsis thaliana were taken out and cultured under normal conditions (24°C, 16 / 8h light / darkness).

[0071] 4) One week later, the infection was repeated for a total of three times to obtain transgenic Arabidopsis thaliana.

[0072] Example 5: Infection of tobacco plant material

[0073] 1) Preparation of sterile seedlings: Take an appropriate amount of Nicotiana benthamiana seeds, put them into a sterile 1.5ml centrifuge tube, add 70% alcohol, and shake vigorously for 30 seconds. Centrifuge for 10 seconds, quickly pour out the supernatant and add 1ml sterile water, shake vigorously to wash. Centrifuge for 10 seconds, discard the supernatant, add 2% NaClO solution, and sterilize for 8 minutes. Centrifuge for 10 seconds, discard the supernatant, and wash with sterile water 5 times. Sow the seeds on MS medium and culture at 24℃, 16 / 8h light / dark conditions.

[0074] 2) Infection and screening culture: Take a healthy and sterile Nicotiana benthamiana seedling that has grown for about 30 days, clip the tobacco from the tissue culture bottle, cut the leaves, cut off the four sides, cut into squares, and put them on moist filter paper for later use. Transfer the cut tobacco leaves to the infection solution with the adjusted OD, 28℃, dark, 100rpm, shake and culture for 15min. Use sterile filter paper to absorb the excess bacterial solution, spread the back of the leaves upward on the tobacco co-cultivation medium, 25℃, dark conditions, and co-cultivate for 2d. Transfer the leaves from the tobacco co-cultivation medium to the tobacco differentiation medium, culture under light, and change the medium every 2 weeks. A very obvious callus can be seen around 20d, and differentiated buds can be seen starting from 25d. Cut the buds and put them in the tobacco rooting medium to root. After culturing in the rooting medium for 20d, harden the seedlings and transplant them to obtain transgenic tobacco.

[0075] Example 6: Screening and identification of transgenic materials

[0076] Extract genomic DNA of plant materials by CTAB method for transgenic identification. Take Arabidopsis thaliana in Example 4 and tobacco in Example 5 respectively, put them into 2ml centrifuge tubes, add a steel ball with a diameter of 3mm, put them into liquid nitrogen for quick freezing, and grind them into powder with a proofer. Add 900ul 65℃ preheated CTAB extract and mix well. Put it into a 65℃ water bath for 30min, take it out and mix it up and down every 10min. Add 900ul chloroform: isoamyl alcohol (24:1), shake well, and centrifuge at 12000rpm for 10min at room temperature. Take 600ul supernatant to a new 1.5ml centrifuge tube, add 400ul isopropanol, mix well, and centrifuge at 1200rpm for 10min at room temperature. Discard the supernatant, add 1ml 70% ethanol to wash, centrifuge at 1200rpm for 5min at room temperature, discard the ethanol, and repeat once. Open the lid of the centrifuge tube and place it in a fume hood to dry until the precipitate is colorless and transparent. Add 50ul sterile water to dissolve the precipitate, detect the DNA concentration using Nano Drop 2000, and store at -20℃.

[0077] In this embodiment, the primer sequences used for DNA identification are:

[0078] 35S:ATGACGCACAATCCCACTATCC

[0079] EcaRAD201-R:TTATACATTGACTTCAGCGGGAAG

[0080] LcRAD201-R:TTACACGTTTACTTTTGCTGGAAGG.

[0081] In this embodiment, the system used for PCR identification is: 2 TaqMix 5ul; Primer F 0.5ul; Primer R 0.5ul; Template DNA 1ul; Sterile water 3ul.

[0082] The PCR program used was: 95°C for 2 min; 95°C for 15 s; 58°C for 15 s; 72°C for 1 min and 40 s; to step 231 cycle; 72°C for 5 min; 12°C∞.

[0083] The extracted genomic DNA was subjected to electrophoresis.

[0084] Preparation of 1% agarose gel: Add 1.5g agarose powder to 150ml 1X TAE solution and heat in a microwave oven until it is completely dissolved and becomes colorless and transparent; after cooling, add nucleic acid dye GelRed and pour into a gel plate.

[0085] Perform electrophoresis under the following conditions: 120 V, 0.13 A, 16 W, 30 min.

[0086] Result analysis:

[0087] The identification primers used were the primer sequence 35S on the vector and the R-terminal primer of the target gene. The expected sizes of the amplified bands were 3180bp (LcRAD) and 2780bp (EcaRAD), respectively. From the results, the amplified bands were between 3000bp and 5000bp, and were closer to the 3000bp position, which was a bright band, in line with expectations. Figure 3 shown.

[0088] Example 7: Fluorescence quantitative PCR

[0089] The total RNA of plants was extracted by the trizol method. Take about 0.1g of Arabidopsis 4 and tobacco 5 plant tissues in the example, grind them into powder with liquid nitrogen, transfer to a 1.5ml centrifuge tube, add 1ml of trizol (pre-added with 2% β-mercaptoethanol), mix well, and let stand at room temperature for 5min. Add 200ul of chloroform, mix well, and let stand at room temperature for 5min. Centrifuge at 4℃, 12000g for 5min, and take 600ul of supernatant to a new 1.5ml centrifuge tube. Add 600ul of isopropanol, mix well, and let stand at room temperature for 10min. Centrifuge at 4℃, 12000g for 5min, and discard the supernatant. Carefully add 1ml75% ethanol, rinse gently, centrifuge at 4℃, 7500g for 5min, discard the supernatant, and repeat once. Let the dry precipitate stand at room temperature until the precipitate is colorless and transparent, and add 30ul of RNase-free water to dissolve the precipitate. NanoDrop2000 detects RNA concentration and stores at -80℃.

[0090] First-strand cDNA synthesis

[0091] The system used in this embodiment is as follows: gDNA eraser 1ul; total RNA 1ug; 5x gDNA eraser buffer 2ul; RNase free water up to 10ul; reaction at 42°C for 2min.

[0092] Take 10ul of the reaction solution from the previous step; 4ul of 5x PrimeScript buffer; 0.5ul of RNase Inhibitor; 1ul of PrimeScript RTase; Up to 20ul of RNase free water; incubate at 37℃ for 15min; 85℃ for 5s; place on ice and detect the concentration using NanoDrop2000; store at -20℃.

[0093] The qRT-PCR program was as follows: 95°C for 10 min; 95°C for 15 s; 55°C for 1 min; fluorescence detection to step 240 cycles.

[0094] The primer sequences used for fluorescent quantitative PCR are:

[0095] Arabidopsis thaliana internal reference gene

[0096] AtActin-F:5'CGCTCTTCTTTCCAAGCTC 3'

[0097] AtActin-R:5'AACAGCCCTGGGAGCATC 3'

[0098] Nicotiana benthamiana internal reference gene

[0099] NtEF1a-F:5'AGAGGGCCCTCAGACAAAC 3'

[0100] NtEF1a-R:5'TAGGTCCAAAGGTCACAA 3'

[0101] LcRAD gene

[0102] LcRAD-F:5'CGAAGATCATCTCCGAAACAC 3'

[0103] LcRAD-R:5'TCAGGTCCAACGAAAGTAAGC 3'

[0104] EaRAD gene

[0105] EcaRAD-F:5'AGGCAAGGCAGACGCGAACAT 3'

[0106] EcaRAD-R:5'GACTCCAGACGCAAACATCC 3'

[0107] After the above determination, Figure 4 As shown, EcaRAD was successfully expressed in Arabidopsis; Figure 5 As shown, LcRAD was successfully expressed in Arabidopsis; Figure 6 As shown, EcaRAD was successfully expressed in tobacco; Figure 7 As shown, LcRAD was successfully expressed in tobacco.

[0108] Example 8: Cultivation of Arabidopsis thaliana treated at different temperatures

[0109] The treated Arabidopsis thaliana was cultured at different culture temperatures under fixed light conditions. The light conditions were: 16 / 8h light / dark conditions; light intensity 8000lx; relative humidity 65%; and culture temperatures were as follows:

[0110] Low temperature is 22℃ / 20℃ day / night;

[0111] Normal is 24℃ / 22℃ day / night;

[0112] High temperature is 28℃ / 26℃ day / night.

[0113] The two genes were transferred into Arabidopsis and tobacco by inflorescence infection and leaf disc methods, respectively. The results showed that the transgenic Arabidopsis was more resistant to temperature stress and had significantly improved growth conditions compared to the wild-type Arabidopsis. The details are as follows:

[0114] (1) Figure 8 As shown, compared with the number of pods in the control group, the number of pods in the transgenic Arabidopsis increased significantly, among which the number of pods in the EcaRAD Arabidopsis was the largest;

[0115] (2) Fig. 9 , 10 As shown, the transgenic Arabidopsis obtained in Example 4 is more luxuriant than the wild-type Arabidopsis in a low temperature environment (22°C / 20°C day / night) and a high temperature environment (28°C / 26°C day / night), has high temperature resistance and low temperature resistance, and has a significantly increased leaf area and leaf number.

[0116] (3) Fig.11 , 12 As shown, the Arabidopsis seedlings in Example 4 grew better and more densely than the wild-type Arabidopsis. The root hairs of overexpressed Arabidopsis were more densely developed than those of wild-type Arabidopsis, and the higher the relative expression level of overexpressed EcaRAD and LcRAD Arabidopsis, the more significantly the growth of seedlings and root hairs was improved.

[0117] It can be understood that the above embodiments only express the preferred implementation modes of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the patent scope of the present invention. It should be pointed out that, for ordinary technicians in this field, the above technical features can be freely combined without departing from the concept of the present invention, and several deformations and improvements can be made, which all belong to the protection scope of the present invention. Therefore, all equivalent changes and modifications made to the scope of the claims of the present invention should belong to the coverage of the claims of the present invention.

Claims

1. A plant temperature stress resistance gene RAD, comprising EcaRAD cds or LcRAD cds, characterized in that: The nucleotide sequence of the temperature stress resistance gene EcaRAD cds is shown in EQ ID No.1; the nucleotide sequence of the temperature stress resistance gene LcRAD cds is shown in EQ ID No.

2.

2. The plant temperature stress resistance gene RAD according to claim 1, characterized in that: The EcaRAD protein sequence encoded by the temperature stress resistance gene EcaRAD cds is shown as EQ ID No.3, and the LcRAD protein sequence encoded by the temperature stress resistance gene LcRAD cds is shown as EQ ID No.

4.

3. Use of the plant temperature stress resistance gene RAD as claimed in claim 1 in increasing plant yield or improving plant temperature adaptability.

4. The use according to claim 3, characterized in that The following steps are involved: Construct a vector, transfer the vector into Agrobacterium, and use Agrobacterium to transform plants.

5. The use according to claim 4, characterized in that The vector is pEarlyGate201 vector.

Images