Chinese cabbage clubroot susceptibility related gene BrSWEET14a as well as construction method and application thereof

Abstract

The invention provides a Chinese cabbage clubroot susceptibility related gene BrSWEET14a, a construction method and application, belongs to the technical field of plant genetic engineering, and particularly relates to a Chinese cabbage clubroot susceptibility related gene BrSWEET14a. The CDS sequence of the Chinese cabbage BrSWEET14a is as shown in SEQ ID No. 1 (sequence identifier number 1). The gene is transformed into Col-type arabidopsis thaliana through an agrobacterium flower immersion transformation method, a BrSWEET14a heterologous expression arabidopsis thaliana strain is obtained, and the result shows that T-DNA insertion mutant of the BrSWEET14a homologous gene Atsweet14 is more resistant to clubroot than that of the Col-type arabidopsis thaliana, and heterologous expression of Chinese cabbage BrSWEET14a leads to reduction of disease resistance of arabidopsis thaliana to plasmodiophora brassicae. Therefore, the Chinese cabbage BrSWEET14a is closely related to the clubroot disease, and the gene and the homologous gene of the gene in other cruciferous plants can be applied to breeding of the cruciferous plants and other horticultural plants and have a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and relates to a cabbage clubroot disease susceptibility-related gene BrSWEET14a, a construction method, and an application thereof, and the application relates to the application of cabbage BrSWEET14a and its encoded protein in a plant disease resistance process. Background Art

[0002] Cabbage (Brassica rapa L.syn.B.campestrisL.) is a Brassica plant in the family Cruciferae, accounting for 15% of the global vegetable production. Currently, clubroot disease caused by infection with Plasmodiophorabrassicae Woronin poses a serious threat to the production of cruciferous crops around the world. Clubroot disease spreads quickly and widely, and in various ways, including seeds, soil, farm tools, irrigation water, animal manure, and feed. The occurrence of clubroot disease has been reported in many countries around the world, resulting in yield losses of up to 10%-15%. The disease was first reported in the 1910s and then spread throughout China. The root-knot fungus spores in the soil infect the plant root hairs to reach the interior of the plant, and then the secondary zoospores infect the plant cortex for the second time, resulting in the formation of swollen roots. The plants infected by the root-knot fungus have enlarged root tissue, which affects the root system's absorption and transportation of mineral elements and water. Therefore, the aboveground parts of the plants will show symptoms of dwarfing and wilting, the leaves will turn red, fade, necrotic and fall off, and the plants will bloom early, seriously affecting the yield and quality of Brassica crops. Due to the tenacious vitality and easy spread of the root-knot fungus, the current physical, chemical, and biological methods to control root knot disease have limited effects and are not effective in the long term. Therefore, it is crucial to find resistance genes to root knot disease to develop varieties with broad and lasting resistance for the prevention and control of root knot disease.

[0003] Sugar is the main energy source for plant growth and is involved in a variety of metabolic pathways. Studies have shown that the sugar transporter (SWEET) gene family plays a key role in plant growth, development, reproduction and disease resistance. For example, in Arabidopsis, the loss of sugar transporter function in the Atsweet141 / 12 double mutant leads to reduced root swelling, AtSWEET4 / 15 is essential for the development of Brassica crops, AtSWEET4 / 15 / 17 is upregulated after Bacillus cinerea infection, and OsSWEEt11 / 14 transcripts increase during Xanthomonas oryzae infection. According to previous studies, including transcriptome sequencing and genome-wide association studies, a large number of differentially expressed SWEETs family genes in response to root swelling infection were found in B. rapa, indicating their involvement in sugar transport and pathogen infection.

[0004] Pathogen-induced infection exploits sugar resources in host plants by activating specific sugar transporter or SWEET genes. Summary of the invention

[0005] From the above, it can be seen that SWEETs proteins have great potential utilization value in plant disease resistance and stress resistance research, and new disease-resistant and stress-resistant varieties can be bred through molecular biological methods.

[0006] In view of this, the object of the present invention is to overcome the defects of the prior art and the aforementioned values, and to provide a cabbage clubroot susceptibility-related gene BrSWEET14a and its application.

[0007] 1. Related genes

[0008] The cabbage clubroot disease susceptibility-related gene BrSWEET14a is a candidate gene, and the nucleotide sequence of the related gene BrSWEET14a includes:

[0009] (1) the nucleotide sequence is shown in SEQ ID No. 1; or

[0010] (2) the nucleotide sequence shown in SEQ ID No. 1 is substituted, deleted and / or added with one or more nucleotides; or

[0011] (3) A nucleotide sequence that hybridizes to the DNA sequence defined in (1) under stringent conditions.

[0012] (II) Construction method

[0013] The first method for constructing a Chinese cabbage BrSWEET14a gene silencing vector comprises the following steps:

[0014] The silencing sequence of the Chinese cabbage BrSWEET14a gene is predicted, and the silencing sequence is shown in SEQ ID No. 2;

[0015] Double enzyme digestion of pTRV2 vector to obtain linearized pTRV2 vector;

[0016] The silencing sequence was amplified, the amplified silencing sequence and the linearized pTRV2 vector were homologously recombined and connected, and the connection product was transformed to obtain the cabbage BrSWEET14a gene silencing vector.

[0017] Preferably, the specific primers for silent sequence amplification are shown as SEQ ID No.3 and SEQ ID No.4.

[0018] The second method for constructing a Chinese cabbage BrSWEET14a gene overexpression vector comprises the following steps:

[0019] Double enzyme digestion of pFGC1008-EGFP vector to obtain linearized pFGC1008-EGFP vector;

[0020] Specific primers were designed to amplify the nucleotide sequence of the cabbage BrSWEET14a gene, the amplified sequence was homologously recombined with the linearized pFGC1008-EGFP vector, and the ligation product was transformed to obtain

[0021] to the cabbage BrSWEET14a gene overexpression vector;

[0022] Among them, the specific primers are shown as SEQ ID No.12 and SEQ ID No.13.

[0023] The third method for constructing a Chinese cabbage BrSWEET14a gene subcellular localization vector comprises the following steps:

[0024] Double restriction enzyme digestion of pFGC5941-EGFP vector to obtain linearized pFGC5941-EGFP vector;

[0025] Designing specific primers to amplify the nucleotide sequence of the Chinese cabbage BrSWEET14a gene, homologously recombine-linking the amplified sequence with the linearized pFGC5941-EGFP vector, and transforming the ligation product to obtain a Chinese cabbage BrSWEET14a gene subcellular localization vector;

[0026] Among them, the specific primers are shown as SEQ ID No.14 and SEQ ID No.15.

[0027] A fourth method for constructing a mutant material suitable for the Brassica rapa BrSWEET14a gene comprises the following steps:

[0028] Arabidopsis DNA is extracted by a rapid DNA extraction method, and a mutant material suitable for the Brassica rapa BrSWEET14a gene is obtained by using the DNA and three-primer PCR, wherein the specific primers of the three-primer method are shown as SEQ ID No.9, SEQ ID No.10, and SEQ ID No.11; and the Brassica rapa BrSWEET14a gene is the Brassica rapa BrSWEET14a gene.

[0029] (III) Related applications

[0030] The biological material comprises the cabbage clubroot disease susceptibility-related gene BrSWEET14a, and the biological material comprises at least one of an expression vector, an expression cassette, a host cell and an engineering bacterium.

[0031] An application of the cabbage clubroot susceptibility-related gene BrSWEET14a or the biological material in screening disease-resistant plants and / or regulating the disease-resistant function of plants.

[0032] An application of the cabbage clubroot susceptibility-related gene BrSWEET14a or the biological material in preparing transgenic plants.

[0033] An application of the cabbage clubroot susceptibility-related gene BrSWEET14a or the biological material in improving plant germplasm resources.

[0034] (IV) Advantages

[0035] Compared with the prior art, the beneficial effects or advantages of the present invention include the following:

[0036] The Chinese cabbage BrSWEET14a sequence provided by the present invention is shown as SEQ ID No.1.

[0037] The present application also provides methods for constructing a cabbage BrSWEET14a gene silencing vector, an overexpression vector, and a subcellular localization vector, as well as a method for constructing mutant materials suitable for the cabbage BrSWEET14a gene. The constructed methods have high specificity and are more suitable for the biological materials used for the cabbage BrSWEET14a sequence provided in the present application.

[0038] The invention introduces the gene into Arabidopsis thaliana by Agrobacterium-mediated method, obtains transgenic Arabidopsis thaliana strains heterologously expressing BrSWEET14a in Chinese cabbage, and the results show that in the disease resistance analysis experiment, the T-DNA insertion mutant material of the BrSWEET14a Arabidopsis homologous gene Atsweet14 is more disease-resistant than the wild Columbia type Arabidopsis, and the overexpression of BrSWEET14a can promote the root swelling caused by root knot fungi infecting the roots of Arabidopsis thaliana. This shows that BrSWEET14a in Chinese cabbage is closely related to cruciferous root knot disease, and the application of the gene in the breeding of Chinese cabbage or other cruciferous vegetables has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0040] Figure 1 Schematic diagram of the BrSWEET14a VIGS vector.

[0041] Figure 2Schematic diagram of BrSWEET14a overexpression vector.

[0042] Figure 3 Schematic diagram of BrSWEET14a subcellular localization vector.

[0043] Figure 4 Comparison of gene expression levels between BrSWEET14a gene silenced plants and control plants 42d after inoculation with pathogen spore suspension.

[0044] Figure 5 Comparison of disease index between BrSWEET14a gene silenced plants and control plants 42d after inoculation with pathogen spore suspension.

[0045] Figure 6 This is a comparison of the root pathology between the BrSWEET14a gene-silenced plants and the control plants 42 days after inoculation with the pathogen spore suspension. It should be noted that the white line in the lower right corner of the figure is 4 cm.

[0046] Figure 7 This is the PCR electrophoresis gel image for screening homozygous strains of the T-DNA insertion mutant material SALK_010224C. The three-primer identification method was used. This image is LP+RP, and the marker used is DL2000. Among them, lane 1 is a wild-type plant, and lanes 2-10 are plants with possible T-DNA insertion.

[0047] Figure 8 This is the PCR electrophoresis gel image for screening homozygous strains of the T-DNA insertion mutant material SALK_010224C. The three-primer identification method was used. This image is BP+RP, and the marker used is DL2000. Among them, lanes 2, 4, 5, 6, 7, 8, and 10 are homozygous strains, lane 1 is a heterozygous strain, and lanes 3 and 9 are negative result plants.

[0048] Fig. 9 This is a comparison of the growth conditions of atsweet14 (SALK_010224C) mutant plants and control plants 21 days after inoculation with pathogen spore suspension. It should be noted that the white line in the lower right corner of the figure is 5 cm.

[0049] Fig.10 This is a comparison of the growth conditions of Rescue-BrSWEET14a complemented plants and control plants 21 days after inoculation with pathogen spore suspension. It should be noted that the white line in the lower right corner of the figure is 5 cm.

[0050] Fig.11This is a comparison of the growth conditions of OE-BrSWEET14a overexpressing plants and control plants 21 days after inoculation with pathogen spore suspension. It should be noted that the white line in the lower right corner of the figure is 5 cm.

[0051] Fig.12 The figure shows the comparison of root pathology of atsweet14 (SALK_010224C) mutant plants, Rescue-BrSWEET14a complemented plants and control plants 21 days after inoculation with pathogen spore suspension. It should be noted that the white line in the lower right corner of the figure is 2 cm.

[0052] Fig.13 This is a comparison of root pathology between OE-BrSWEET14a overexpressing plants and control plants 21 days after inoculation with pathogen spore suspension. It should be noted that the white line in the lower right corner of the figure is 2 cm.

[0053] Fig.14 This is a bar graph showing the investigation and analysis of the disease index of atsweet14 (SALK_010224C) mutant plants, Rescue-BrSWEET14a complemented plants (A in the figure), OE-BrSWEET14a overexpressing plants (B in the figure) and control plants 21 days after inoculation with pathogen spore suspension.

[0054] Fig.15 Observation of the subcellular localization of BrSWEET14a protein. DETAILED DESCRIPTION

[0055] The technical solution of the present invention is described below through specific examples. It should be understood that the one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combination step or the insertion of other method steps between these explicitly mentioned steps; it should also be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, and is not intended to limit the order of arrangement of each method step or to limit the scope of the present invention. The change or adjustment of the relative relationship thereof shall also be regarded as the scope of the present invention without substantially changing the technical content.

[0056] In order to better understand the above technical scheme, the exemplary embodiments of the present invention are described in more detail below. Although exemplary embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present invention and to enable the scope of the present invention to be fully communicated to those skilled in the art.

[0057] 1. Related genes

[0058] Example 1

[0059] In this embodiment, the present invention provides a clubroot disease susceptibility gene BrSWEET14a, which is cloned from the extremely susceptible cabbage (B. rapa var. pekinensis) ECD05, and its gene sequence is shown in SEQ ID No.1.

[0060] (II) Construction Method and Application

[0061] Based on the aforementioned clubroot disease susceptibility gene BrSWEET14a, the present invention further provides the application of this gene in clubroot disease resistance in Chinese cabbage (ECD05) and Arabidopsis thaliana, which is described in detail below.

[0062] Example 2

[0063] In this example, the construction of the Chinese cabbage BrSWEET14a gene silencing vector includes the following steps:

[0064] 1.1 Prediction of silent sequences

[0065] The SGN-VIGS website (https: / / vigs.solgenomics.net / ) was used to predict a 300 bp silent sequence (SEQ ID No. 2) for the aforementioned BrSWEET14a gene.

[0066] 1.2 Enzyme digestion of pTRV2 vector

[0067] The BamH I and Sma I sites of the pTRV2 vector were double-digested to obtain a linearized pTRV2 vector.

[0068] Enzyme digestion system: Buffer 4μl, about 2μl of recovered product, 2μl of SalⅠ and KpnⅠ enzymes respectively, then make up to 40μl with double distilled water and incubate in a 37℃ water bath for 1h.

[0069] 1.3 Design of specific primers

[0070] The primer sequence information is shown in Table 1. The 300 bp silencing sequence was amplified using high-fidelity KOD enzyme. The PCR products were separated by 1% agarose gel electrophoresis. The lengths were consistent and the vector fragments were recovered by gel tapping to obtain the 300 bp silencing sequence amplified by PCR.

[0071] 1.4 Homologous recombination ligation

[0072] The linearized pTRV2 vector and the 300 bp silencing sequence amplified by PCR were homologously recombined and connected using the single fragment homologous recombination kit C112 of Novozymes to obtain a connection product.

[0073] The system is: 4μl 5×CEⅡBuffer, 2μl ExaseⅡ, 200ng double-enzyme digestion recovered linearized vector (linearized pTRV2 vector), 20ng BrSWEET14a PCR amplified 300bp silencing sequence, ddH2O filled to 20μl; 37℃ reaction for 30min.

[0074] 1.5 Transformation of E. coli

[0075] The ligation product was transformed into Escherichia coli DH5α competent cells by freeze-thaw method, and the cultured bacterial solution was verified by PCR, and the target plasmid was extracted for sequencing verification. The plasmid with successful sequence verification was transformed into Agrobacterium GV3101 competent cells by electroporation. If the transformed bacterial solution had bands in PCR, it was expanded and cultured; the extracted plasmid was sequenced (the final vector map is shown in Figure 1 ), the final vector was pTRV2-BrSWEET14a, the successfully verified bacterial solution was preserved and the mother solution was stored at 4°C for later use.

[0076] The above detailed experimental steps were carried out in accordance with the instructions of Novozymes' single fragment homologous recombination kit C112 and will not be elaborated here.

[0077] Table 1 Primers used for construction of VIGS silencing vector

[0078]

[0079]

[0080] Example 3

[0081] In this example, VIGS was used to silence the cabbage BrSWEET14a gene, including the following steps:

[0082] 2.1 Seed soaking method to infect cabbage

[0083] The bacterial solution verified by sequencing in the above Example 1 was used as the mother solution to infect Chinese cabbage (B. rapacv. Chiifu) by the seed soaking method. The steps are as follows: 100 μl of the Agrobacterium bacterial solution containing the target vector was added to 15 ml of liquid LB containing kanamycin (0.5 μl / ml) and rifampicin (1 μl / ml), and the culture was shaken at 28°C and 200 rpm for about 12-16 h until the OD 600 The Agrobacterium precipitate was obtained by centrifugation at 5000 rpm for 15 min, and the bacterial precipitate was resuspended in a resuspension solution prepared by dd H2O, which contained 10 mmol / L MES, 10 mmol / L MgCl2, and 150 μmol / L acetosyringone. 600Adjust to 1.0 and let stand at room temperature for 2-3 hours for use. Subsequently, in order to infect the seedlings, the bacterial solution containing pTRV1 was mixed with the bacterial solutions containing pTRV2-BrSWEET14a and pTRV2-empty (as a control) in a volume ratio of 1:1. Germinate the cabbage seeds until the root length is about 1 cm, then remove the seed coat and place them in the prepared mixed bacterial solution, evacuate (conditions: 0pa, 15min), and then move the seeds to the matrix for normal culture. Among them, pTRV2-empty is the pTRV2 empty vector.

[0084] 2.2 Quantification of BrSWEET14a gene expression

[0085] The total RNA was extracted from the cabbage leaves 30-35 days after transplantation using Trizol reagent, and then reverse transcribed to obtain cDNA using PrimeScript provided by TaKaRa. TM RT reagent Kit with gDNA Eraser (PerfectReal Time) reverse transcription dedicated kit, detailed operation steps according to the instructions. The primers used for qRT-PCR analysis were designed by Primer Premier 6, as shown in Table 2.

[0086] 15μl reaction system, 15μl composition: 7.5μl SYBR Green Master Mix, 0.3μl forward and reverse primers, 1μl template, 5.9μl double distilled water.

[0087] qRT-PCR reaction process: 95℃: 30s, 40 cycles (95℃: 5s, 55℃: 45s). The specificity of the reaction was determined by melting curve, the internal reference gene was BrUBC10, and the relative expression of the gene was determined by 2 -ΔΔCt Method calculation. (Three biological replicates were set for sampling)

[0088] Reference Figure 4 , the results showed that the gene was down-regulated in Brassica rapa.

[0089] Table 2 Primers used for qRT-PCR analysis

[0090]

[0091]

[0092] Example 4

[0093] In this embodiment, the infection and morbidity experiment of Brassica root knotweed and phenotypic observation were carried out, including the following steps:

[0094] 3.1 Preparation of Brassica rutabaga spore solution

[0095] 1) Take out the diseased roots stored in a -20℃ refrigerator and thaw them.

[0096] 2) Soak in 70% ethanol solution for 1 minute for disinfection.

[0097] 3) Treat with 10% NaClO for 20 min, shield from light with tin foil, and rinse with sterile water three times.

[0098] Use a juicer to squeeze the root tubers into a homogenate and filter twice through sterilized gauze. Centrifuge the filtrate at 500rpm for 5min, discard the black precipitate, and keep the supernatant and gray precipitate. Replace a new clean 50mL centrifuge tube, add sterile water to 45mL, centrifuge at 4000rpm for 15min, and discard the supernatant. Dissolve the precipitate in sterile water, centrifuge at 4000rpm for 10min, and repeat once. Dissolve the precipitate in 50% sucrose, 3100rpm, 10min, and discard the supernatant. Add sterile water to 45mL, centrifuge at 4000rpm for 10min, discard the supernatant, and repeat 2-3 times. Dissolve the precipitate in 1mL of sterile water to obtain a high-concentration spore solution, which is stored in a -4℃ refrigerator.

[0099] 3.2 Microscopic examination of dormant spores of root knotweed

[0100] Use a pipette to draw up the spore suspension and place it on a blood cell counting plate (model 1 / 400mm 2 ) Add the suspension to the groove at the edge of the cover glass until the cover glass is filled with the root knot fungus spore suspension, and place it under a microscope for counting. The spores pressed on the upper and left lines are counted in the grid. The spore concentration (spores / ml) = [(upper left + lower left + middle + upper right + lower right) a total of 5 dormant spores in the grid] / (80 × 400 × 10 4 × dilution factor).

[0101] 3.3 Infection, morbidity and phenotypic observation

[0102] When the true leaves of the cabbage seeds emerge after sowing, the different bacterial solutions prepared in Example 3 are injected and inoculated respectively. After growing under normal conditions for 42 days, the plants are carefully taken out, the roots are cleaned with clean water, and the root disease conditions are counted and photographed. The inventors divide the disease conditions into 4 levels from 0 to 3, with a total of 4 standards. Level 0, no swelling of the roots, normal development state; Level 1, no swelling of the main root, normal development, and small lumps in the lateral roots; Level 2, the swelling area of ​​the main and lateral roots exceeds 1 / 3 of the whole; Level 3: The main and lateral roots are obviously swollen and even cracked and rotten. Calculation is performed according to the disease index calculation formula, the formula is as follows:

[0103] Disease Index DI = [(number of level 0 plants*0+number of level 1 plants*30+number of level 2 plants*60+number of level 3 plants*100) / total number of plants]*100.

[0104] If DI ≥ 10, it is judged as susceptible; if DI < 10, it is judged as resistant.

[0105] The results show: Figure 5 The disease index of plants with silenced BrSWEET14a gene was significantly lower than that of the control. Figure 6 , plants in which the BrSWEET14a gene was silenced developed better.

[0106] Example 5

[0107] In this embodiment, the screening of T-DNA insertion mutant materials includes the following steps:

[0108] 4.1 Rapid DNA extraction method DNA extraction:

[0109] Add 200μl DNA extraction buffer and magnetic beads to the centrifuge tube containing Arabidopsis leaves, use a 65Hz crusher to crush the tissue for 120s to obtain the ground tissue fluid; transfer all the ground tissue fluid to a 1.5ml centrifuge tube, centrifuge at 13000rpm for 8min to obtain the supernatant; prepare a new 1.5ml centrifuge tube, add 100μl isopropanol to each tube, take 100μl of the supernatant and transfer it to a centrifuge tube containing an equal volume of isopropanol, shake gently for about 50 times, and let it stand at room temperature for 5min; centrifuge at 13000rpm for 6min, remove the supernatant; wash the precipitate twice with 1ml70vol% ethanol, specifically shake up and down 20 times, centrifuge at 13000rpm for 3min, discard the supernatant, repeat once; empty for 1min. After washing, aspirate the liquid, dry the precipitate for 5min, add 25-50μl ddH2O, and store at -20℃ for use.

[0110] 4.2 Three-primer PCR detection

[0111] The three-primer method requires three primers, namely LP (SALK_010224C-LP), RP (SALK_010224C-RP), and BP (T-DNA-BP). For specific primers, please refer to Table 3.

[0112] According to the instructions of Qingke Biotechnology, the reaction system of 1.1x T3 Super Mix PCR (Qingke Biotechnology) is as follows: 44μl 1.1x T3 super Mix, 2μl Template, 2μl Primer F, 2μl Primer R.

[0113] The program was set as follows: pre-denaturation at 98°C for 2 min 30 sec, 35 cycles of amplification (denaturation at 98°C for 10 sec, annealing at 55°C for 10 sec, extension at 72°C for 10 sec), and finally full extension at 72°C for 2 min to ensure complete amplification of the fragment; the PCR product amplified by LP+RP primers was mixed evenly with the PCR product amplified by RP+BP primers and separated by 1% agarose gel electrophoresis.

[0114] Test results reference Figure 7 and Figure 8 , Lane 6 in the figure is a homozygous strain, and the homozygous mutant material was collected for subsequent experiments.

[0115] Table 3 Primers used for screening of T-DNA insertion mutant materials

[0116] Primer name Primer sequence (5'-3') T-DNA-BP ATTTTGCCGATTTCGGAAC(SEQ ID No.9) SALK_010224C-LP AAGCATCATCGATCTCAAACG(SEQ ID No.10) SALK_010224C-RP CGCACCCAATATATTTGGAAG(SEQ ID No.11)

[0117] Example 6

[0118] In this example, the construction of the BrSWEET14a overexpression vector includes the following steps:

[0119] Referring to the method of Example 1,

[0120] 5.1pFGC1008-EGFP vector double restriction enzyme digestion

[0121] pFGC1008-EGFP was double-digested at the SalⅠ and KpnⅠ sites, and the large fragment product was separated by electrophoresis to recover the linear vector.

[0122] 5.2 Design specific primers (primer sequence information see Table 4) to amplify the CDS sequence of BrSWEET14a (refer to SEQ ID No. 1) using high-fidelity KOD enzyme. The PCR products were separated by 1% agarose gel electrophoresis. If the length was consistent, the products were tapped and recovered.

[0123] 5.3 Homologous recombination ligation and transformation

[0124] The method is the same as 1.4 and 1.5 of Example 1. The final carrier map is shown in Figure 2 The final vector is pFGC1008-EGFP (OE-BrSWEET14a)

[0125] Table 4 Primers used for construction of heterologous overexpression vector

[0126]

[0127] Example 7

[0128] In this embodiment, Arabidopsis floral dip transformation and screening of positive transformants include the following steps:

[0129] 6.1 Transformation of Arabidopsis thaliana by floral dipping method

[0130] The above bacterial solution verified by sequencing and the Agrobacterium GV3101 bacterial solution containing the pFGC1008 empty vector plasmid were used as the mother solution for transformation of Arabidopsis thaliana by the floral dipping method. The steps are as follows: 500 μl of the Agrobacterium bacterial solution containing the target vector was added to 200 ml of liquid LB containing kanamycin and rifampicin (50 mg / L), and the culture was shaken at 28°C and 200 rpm for about 30 h until the OD 600 The concentration of Agrobacterium was 1.2; the Agrobacterium was precipitated by centrifugation at 8000rpm for 10min, and the bacterial solution was resuspended in 200ml 5% sucrose; Silwet L-77 was added to a final concentration of 200μl / L, and the culture was shaken at 28℃ and 200rpm for 2min to obtain the bacterial solution; the open flowers and siliques of wild-type Arabidopsis were removed, and the flower buds were immersed in the bacterial solution for 30sec, and the excess bacterial solution was absorbed and cultured in the dark at 25℃ for 24h, and then cultured normally. The flower immersion was repeated once a week.

[0131] Wherein, when the target vector is the pure and mutant material of Example 4, the wild-type Arabidopsis thaliana is transformed by mutation to obtain T-DNA insertion mutant plant seeds;

[0132] When the target vector is the BrSWEET14a overexpression vector of Example 5, overexpression transformation of wild-type Arabidopsis thaliana obtains complemented plant seeds; overexpression transformation of T-DNA insertion mutant plants obtains heterologous overexpression plant seeds.

[0133] 6.2 Preparation of Kanamycin Seeding Medium

[0134] Take 2.22 g of MS powder and 10 g of sucrose, add 2 M NaOH to adjust the pH to 5.8 to obtain MS medium, add 4 g of agar powder, and then sterilize with high-pressure steam at 121°C for 20 min, cool to 50-60°C in an ultra-clean workbench, add kanamycin to a final concentration of 75 mg / L, pour solid plates, and obtain kanamycin seeding medium.

[0135] 6.3 Screening of positive transformants

[0136] Different Arabidopsis seeds T1 generations obtained by soaking flowers were sown on kanamycin sowing medium, and the steps were as follows: 10vol% NaClO disinfection for 2min; 75vol% ethanol washing seeds for 2min; sterile water washing 5 times, 1min each time; sowing on kanamycin sowing medium, sealing, and culturing in a 22℃ culture room (16h light, 8h dark), and after about two weeks, the healthy positive plants were removed. T-DNA insertion mutant plants, complementation plants, and heterologous overexpression plants were obtained respectively.

[0137] Example 8

[0138] In this example, the disease resistance identification of transgenic Arabidopsis plants is carried out, including the following steps:

[0139] 7.1 Arabidopsis infection, disease development and phenotypic observation

[0140] When the heterologous overexpression, T-DNA insertion mutant, and complemented plant obtained in Example 6 grew to two true leaves, the roots of the plants were immersed in a solution of resting spores of root knotweed fungus (1×10 7 / mL) for 45-60min, then transplanted into the substrate, and dug out the plants 21d after inoculation to observe and count the disease.

[0141] The results showed that in the disease experiment, the T-DNA inserted Arabidopsis mutant SALK_010224C (atsweet14) grew significantly better than the wild type (WT) plants ( Fig. 9 ), the root swelling degree is less than that of wild type ( Fig.12 ), the disease index was significantly lower than that of the wild type ( Fig.14 The missing plant rate of heterologous overexpression plants (OE-BrSWEET14a) was significantly higher than that of wild-type plants ( Fig.11 ), the root swelling degree is more serious than that of wild type ( Fig.13 ), the disease index was significantly higher than that of the wild type ( Fig.14 B); the growth of the complemented plants (Rescue-BrSWEET14a) was not significantly different from that of the wild-type plants ( Fig.10 ), and the degree of root swelling ( Fig.12 ) and disease index ( Fig.14 In summary, BrSWEET14a in Chinese cabbage is closely related to the onset of clubroot disease and is a susceptible gene for clubroot disease.

[0142] Example 9

[0143] In this example, the expression location analysis of Chinese cabbage BrSWEET14a was performed, including the following steps:

[0144] Referring to the method of Example 1,

[0145] Using cDNA extracted from the root of Chinese cabbage ECD05 as a template, specific primers (Table 5) were designed to amplify the CDS sequence of gene BrSWEET14a (refer to SEQ ID No. 1), tapped and recovered, and stored at -20°C. To construct a subcellular localization vector, pFGC5941-EGFP vector was used, with double restriction sites of BamHI and XbaⅠ. The restriction products were recovered, ligated, and transformed into Escherichia coli (the final vector map is shown in Figure 3), the final vector is pFGC5941-EGFP (BrSWEET14a). After positive clones are identified, plasmids are extracted and transformed into Agrobacterium GV3101 by electroporation. After positive clones are obtained, transient transfection of tobacco is performed. The shaken Agrobacterium bacterial solution is centrifuged at 5000 rpm for 15 min, the supernatant is discarded, and the suspension is resuspended in a resuspension solution until the bacterial OD is 600 The value was 0.5, and the bacterial solution was injected into tobacco leaves with a 2 mL syringe. After dark culture for 24-48 h, a confocal microscope Confocal LSM 780 (Carl Zeiss) was used to take pictures to observe the subcellular localization ( Fig.15 ). The results show that Fig.15 , BrSWEET14a is localized in the cell membrane and nucleus.

[0146] Table 5 Primers used for subcellular localization vector construction

[0147]

[0148] It should be noted that the materials used in the above examples can be easily obtained from commercial companies unless otherwise specified.

[0149] in,

[0150] Arabidopsis thaliana: Col-0 type Arabidopsis thaliana.

[0151] Cabbage is a type of cabbage.

[0152] Cabbage ECD05 was donated by Professor GR Dixon of the University of Reading, UK, and propagated in the laboratory.

[0153] Preparation of diseased roots: Plant a sufficient amount of cabbage ECD05, and take out the roots 24 hours after infection with Brassica rapa to obtain the diseased roots.

[0154] The above embodiments can well illustrate the technical solutions of the present invention, but they are only descriptions of the preferred implementation modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various changes and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the present invention.

Claims

1. A cabbage clubroot disease-related gene BrSWEET14a, wherein the related gene is a candidate gene, characterized in that: The nucleotide sequence of the related gene BrSWEET14a includes: (1) the nucleotide sequence is shown in SEQ ID No. 1; or (2) the nucleotide sequence shown in SEQ ID No. 1 is substituted, deleted and / or added with one or more nucleotides; or (3) A nucleotide sequence that hybridizes to the DNA sequence defined in (1) under stringent conditions.

2. A method for constructing a Chinese cabbage BrSWEET14a gene silencing vector, characterized in that: The steps include: Predicting the silenced sequence of the cabbage clubroot susceptibility-related gene BrSWEET14a described in claim 1, the silenced sequence is shown in SEQ ID No. 2; Double enzyme digestion of pTRV2 vector to obtain linearized pTRV2 vector; The silencing sequence was amplified, the amplified silencing sequence and the linearized pTRV2 vector were homologously recombined and connected, and the connection product was transformed to obtain the cabbage BrSWEET14a gene silencing vector.

3. The method for constructing the Chinese cabbage BrSWEET14a gene silencing vector according to claim 2, characterized in that: The specific primers for silent sequence amplification are shown in SEQ ID No.3 and SEQ ID No.

4.

4. A method for constructing a Chinese cabbage BrSWEET14a gene overexpression vector, characterized in that: The steps include: Double enzyme digestion of pFGC1008-EGFP vector to obtain linearized pFGC1008-EGFP vector; Designing specific primers to amplify the nucleotide sequence of the cabbage clubroot disease-related gene BrSWEET14a described in claim 1, homologously recombine the amplified sequence with the linearized pFGC1008-EGFP vector, and transforming the ligation product to obtain a cabbage BrSWEET14a gene overexpression vector; Among them, the specific primers are shown as SEQ ID No.12 and SEQ ID No.

13.

5. A method for constructing a subcellular localization vector of Brassica rapa BrSWEET14a gene, characterized in that: The steps include: Double restriction enzyme digestion of pFGC5941-EGFP vector to obtain linearized pFGC5941-EGFP vector; Designing specific primers to amplify the nucleotide sequence of the cabbage clubroot disease-related gene BrSWEET14a described in claim 1, homologously recombine the amplified sequence with the linearized pFGC5941-EGFP vector, and transforming the ligation product to obtain a cabbage BrSWEET14a gene subcellular localization vector; Among them, the specific primers are shown as SEQ ID No.14 and SEQ ID No.

15.

6. A method for constructing a mutant material suitable for the Brassica rapa BrSWEET14a gene, characterized in that: The steps include: Arabidopsis DNA is extracted by a rapid DNA extraction method, and a mutant material suitable for the Brassica rapa BrSWEET14a gene is obtained by using the DNA and three-primer PCR, wherein the specific primers of the three-primer method are shown as SEQ ID No.9, SEQ ID No.10, and SEQ ID No.11; the Brassica rapa BrSWEET14a gene is the Brassica rapa clubroot susceptibility-related gene BrSWEET14a described in claim 1.

7. A biological material comprising the cabbage clubroot susceptibility-related gene BrSWEET14a according to claim 1, wherein the biological material comprises at least one of an expression vector, an expression cassette, a host cell, and an engineered bacterium.

8. Use of the cabbage clubroot susceptibility-related gene BrSWEET14a according to claim 1 or the biological material according to claim 7 in screening disease-resistant plants and / or regulating plant disease resistance.

9. Use of the cabbage clubroot susceptibility-related gene BrSWEET14a according to claim 1 or the biological material according to claim 7 in preparing transgenic plants.

10. Use of the cabbage clubroot susceptibility-related gene BrSWEET14a according to claim 1 or the biological material according to claim 7 in improving plant germplasm resources.

Images