SYBR Green I fluorescent PCR primer group and kit for detecting chicken egg drop syndrome virus variant strain JS and use method of SYBR Green I fluorescent PCR primer group and kit

Abstract

The invention relates to the technical field of biological detection, in particular to an SYBR Green I fluorescent PCR primer group and kit for detecting a chicken egg drop syndrome virus variant strain JS and a use method of the SYBR Green I fluorescent PCR primer group and kit. The SYBR Green I fluorescent PCR primer group comprises an upstream primer of which the nucleotide sequence is as shown in SEQ ID NO.5 and a downstream primer of which the nucleotide sequence is as shown in SEQ ID NO.6; the target sequence of the SYBR Green I fluorescent PCR primer group is the Fiber gene sequence of the chicken egg drop syndrome virus variant strain JS, and the specific nucleotide sequence is as shown in SEQ ID NO.7. The invention further discloses a detection method of the SYBR Green I fluorescent PCR primer group. By using the kit provided by the invention, the detection of the chicken egg drop syndrome virus variant strain JS can be completed by adding a sample once, and the detection process is simple and easy to operate.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a SYBR Green I fluorescent PCR primer set and a kit for detecting a mutant strain JS of a chicken egg drop syndrome virus and a use method thereof. Background Art

[0002] Egg drop syndrome virus (EDSV) is a virus of the Adenoviridae family and the genus Adenovirus. The virus particles are without envelope, the size of the virus particles is 76~80nm, and the viral genome is double-stranded DNA. The virus has the property of hemagglutination of red blood cells and can agglutinate the red blood cells of poultry such as chickens, ducks, and turkeys. The egg drop syndrome virus can be isolated and cultured using duck embryos, and can also grow in duck embryo cells and chicken embryo liver and kidney cells. It has strong resistance to the external environment, can survive for several months at room temperature, can survive at pH 3~10, can be inactivated at 56℃180min or 60℃30min, and can be inactivated by treatment with 0.5% formaldehyde or 0.5% glutaraldehyde, but has a certain resistance to ether and chloroform.

[0003] The egg drop syndrome virus can infect chickens and cause clinical manifestations such as delayed start of laying age, decreased egg production, thin-shelled eggs and shellless eggs. The main pathological changes in autopsy are ovarian atrophy, follicular congestion, softening, oviduct and uterine mucosal edema, etc. Chickens of all breeds and ages can be infected. Young chickens are often latently infected and only show clinical symptoms when they reach sexual maturity, and most of them develop the disease at 26 to 35 weeks of age. Sick chickens and infected chickens are the main sources of infection. The disease can be transmitted horizontally through feed, drinking water, feces, etc., and can also be transmitted vertically through fertilized eggs. The disease can occur throughout the year, and the egg production can drop by up to 50%, causing serious economic losses to the poultry industry.

[0004] At present, the laboratory detection methods for egg drop syndrome virus in chickens mainly include etiological and serological methods, including virus isolation and identification, agar diffusion (AGP) test, virus neutralization test, hemagglutination and hemagglutination inhibition test, recombinase-mediated constant temperature amplification technology and enzyme-linked immunosorbent assay (ELISA). Traditional virus isolation and identification methods are cumbersome and time-consuming. The agar diffusion test has poor sensitivity and takes a long time, and cannot be carried out in batches. The virus neutralization test is time-consuming and is also affected by individual factors. There is no uniform positive standard for hemagglutination and hemagglutination inhibition tests, non-specific agglutination occurs, and individual differences cannot detect latently infected animals. Although the recombinase-mediated constant temperature amplification technology is constant temperature detection and does not require instruments and equipment, it is expensive and currently has a low popularity rate. The enzyme-linked immunosorbent assay is mainly used for antibody detection, and there is a lag in the diagnosis of clinical diseases.

[0005] Fluorescence quantitative PCR technology is a new detection technology developed in recent years. It has the advantages of good specificity, sensitivity, and fast detection speed. It is suitable for the detection of a large number of clinical samples. Fluorescence PCR technology designs primers based on viral gene sequences. The deletion, insertion, and mutation of viral gene bases will affect the amplification effect of existing primers. The JS variant strain of chicken egg drop syndrome virus is a strain isolated from diseased materials collected from chicken farms with clinical chicken egg drop syndrome immunization failure. The measured sequence has the highest homology of 98.36% with the existing chicken egg drop syndrome virus-related gene sequences published in GenBank.

[0006] The JS strain of egg drop syndrome virus was isolated from a chicken farm that was immunized with the chicken egg drop syndrome vaccine, indicating that the existing vaccine cannot provide good immune protection against the JS strain virus. After the chicken farm became ill, the egg production rate of the chickens dropped from 95% to 40%, which lasted for more than 20 days, causing heavy losses to the chicken farm. Sequencing and identification showed that the viral gene sequence had certain variations. It was verified that the existing detection and inspection methods could not detect the JS strain of egg drop syndrome virus. It is urgent to establish new detection methods and develop relevant test kits to achieve early detection of the disease and reduce losses. Summary of the invention

[0007] In view of the genetic mutation of the virus and the limitations of fluorescent PCR detection, the present invention provides a SYBR Green Ⅰ fluorescent PCR primer set, a kit and a method of using the same for detecting the mutant strain JS of the chicken egg drop syndrome virus. The primer set of the present invention has the advantages of good sensitivity and high specificity, and the kit has the advantages of high specificity, high detection accuracy and high specificity. Using the kit, the detection of the mutant strain JS of the chicken egg drop syndrome virus can be completed by adding the sample once, and the detection process is simple and easy to operate.

[0008] The technical solution of the present invention is as follows: In a first aspect, the present invention provides a SYBRGreen Ⅰ fluorescent PCR primer set for detecting a variant strain JS of chicken egg drop syndrome virus, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6; The target sequence of the SYBR Green Ⅰ fluorescent PCR primer set is the Fiber gene sequence of the variant strain JS of the egg drop syndrome virus, and the specific nucleotide sequence is shown in SEQ ID NO.7.

[0009] In a second aspect, the present invention provides a kit for detecting a variant strain JS of chicken egg drop syndrome virus, comprising a SYBR Green Ⅰ fluorescent PCR primer set; The SYBR Green Ⅰ fluorescent PCR primer set includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6; The target sequence of the SYBR Green Ⅰ fluorescent PCR primer set is the Fiber gene sequence of the variant strain JS of the egg drop syndrome virus, and the specific nucleotide sequence is shown in SEQ ID NO.7.

[0010] Furthermore, the kit also includes 2×SYBR Green Pro Taq HS Premix, negative control, and positive control.

[0011] Furthermore, the negative control was nuclease-free water.

[0012] Furthermore, the positive control is a pMD-Fiber plasmid containing the gene sequence shown in SEQ ID NO.7.

[0013] Furthermore, the concentrations of the upstream primer and the downstream primer were both 10 pmol / μL.

[0014] In a third aspect, the present invention also provides a method for using the above kit, that is, a method for detecting egg drop syndrome virus using the above kit, the specific steps are as follows: (1) Prepare the sample template to be tested; (2) Fluorescence PCR amplification: The total fluorescence PCR system is 50 μL, including 2×SYBR Green Pro Taq HS Premix 25 μL, primer set 5 μL, and nuclease-free water 5 μL were added to 0.1 mL amplification tubes. Three replicates were made and labeled as amplification tube I, amplification tube II, and amplification tube III. Add 15 μL of the sample template to be tested to amplification tube I, add 15 μL of the positive control to amplification tube II, and add 15 μL of the negative control to amplification tube III. After the addition of samples, centrifuge instantly and place in a fluorescent PCR instrument for amplification reaction; (3) Result determination: If the test sample has no Ct value and no typical amplification curve, or the Ct value is >35.0 but the melting curve Tm value is 81.5±0.5℃ and no melting peak appears, it is judged to be negative for egg laying syndrome virus nucleic acid; If the Ct value of the test sample is ≤30.0, a typical amplification curve appears, and the melting curve Tm value is 81.5±0.5℃ with a melting peak, it is judged to be positive for the egg laying syndrome virus nucleic acid; If 30.0<Ct value of the test sample≤35.0, a typical amplification curve appears, and the melting curve Tm value is 81.5±0.5℃ with a melting peak, the sample is judged to be suspicious and a double-well repeated test is performed. If the repeated test result of at least one well is positive, it is judged to be positive for the nucleic acid of the egg laying decline syndrome virus, otherwise it is negative.

[0015] Furthermore, the specific method of preparing the sample template to be tested in step (1) is: using suspected diseased tissue (such as avian follicles, oviducts, etc.) as the test sample, grinding and preparing a suspension, centrifuging to obtain the supernatant, and using a commercial kit to extract viral nucleic acid.

[0016] Furthermore, the conditions for fluorescence PCR amplification in step (2) are as follows: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 5 s; annealing at 55°C for 10 s; extension at 72°C for 15 s; 40 cycles; after the cycle, 60°C for 1 min, heating at a rate of 0.1°C / s until 97°C, collecting fluorescence continuously during the whole process, and finally cooling at 40°C.

[0017] Furthermore, the method of using the above kit (the method of using the above kit to detect the egg drop syndrome virus) is for non-disease diagnosis purposes.

[0018] The beneficial effects of the present invention are: The invention designs three pairs of primers according to the Fiber gene sequence of the variant strain JS of the egg drop syndrome virus, obtains a pair of optimal primers after screening, and a SYBR Green I fluorescent dye kit prepared by the primer set can perform fluorescent PCR detection on the JS strain EDSV, has good specificity, has no amplification on the standard strain AV127 strain EDSV and other avian viruses, has high sensitivity, and the minimum detection limit of pMD-Fiber is 0.053 copies / μL.

[0019] The kit provided by the present invention is easy to operate during use and has low requirements on operators. In addition, the kit can complete the detection of JS strain EDSV isolated virus by adding a sample once, is easy to operate, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 This is the sensitivity analysis graph of the SYBR Green Ⅰ fluorescent PCR detection kit for JS strain EDSV in Example 2.

[0022] Figure 2 This is the specific analysis chart of the SYBR Green I fluorescent PCR detection kit for JS strain EDSV in Example 3.

[0023] Figure 3 This is the sample detection spectrum in Example 4. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0025] The mutated strain JS of the egg drop syndrome virus used in the present invention was isolated by the applicant from diseased materials collected from chicken farms with failed immunization for egg drop syndrome in clinical chickens. The primers were designed with reference to the literature "Establishment of SYBRGreen Ⅰ Real-time Fluorescence Quantitative PCR Detection Method for Hexon Gene of Chicken Egg Drop Syndrome Virus" (Du Donghua, Zhou Jing, Wang Aihua, et al. Chinese Journal of Veterinary Medicine, 2014(008):034.) and "Triple Fluorescence Quantitative PCR Detection Primers, Kits and Methods for DTMUV, EDSV and H9 Subtype AIV" (CN104894292B). The detection results were all negative. Then, primers were designed according to the Fiber gene sequence of the egg drop syndrome virus published in GenBank, and nucleic acid was extracted from the sample and then amplified. The sequencing and sequence analysis results showed that it was indeed the egg drop syndrome virus, named as the JS strain EDSV. The highest homology between the measured sequence and the existing gene sequence related to the egg drop syndrome virus published in GenBank was 98.36%.

[0026] The fiber gene sequence of the JS strain EDSV is shown in SEQ ID NO.7, specifically: GGATCCATTTGGTGTTATTGATGGGAAGCTTGGGGTCAAGTTAGGCCCTGGGGTTCACATCAATGGTGAAGGGGCTGTGGCGGTAGAATCCCCTGTGGACCCCATTACACTTGATACGGCTGGTAGAATTACTTTAAATTATGGCACAGTTTTAAATGTGAGTGATGGAAAATTACGACTAGTAAGTCCTGAAAGTCCGCTCACACTTCTTGGAAATGGCAAGGTTGCTCTTAATTTTGGTAAT TCAATGGAGCTTGTGCAAGGGACCTTGCAACTGAAAGCTCCGCTAAATCCTTTGTTCATGACCCCCGCGGGTGCGATCGGCTTAAGGGTGGATGACATGTTTAACATTTCTGAAGGTTTACTCTCATTCAAGATGCCATCCGATCCAATTTCGTTTAAAGCTGATGGTATGGTGTCTTTGAACACAAATGACACATTGCAAACAACTGGTGGGCTGTTAGGGTTGACCGAACTGGCCCAAGCCG.

[0027] Example 1 Establishment of SYBR Green Ⅰ Fluorescence PCR Detection Method for JS Strain EDSV 1. Primer design and synthesis According to the sequence alignment of the Fiber gene of JS strain EDSV, three pairs of amplification primers were designed by selecting the conservative region, and the sequences are as follows: The first pair of primers: SEQ ID NO.1: Upstream primer GACTAGTAAGTCCTGA, SEQ ID NO.2: downstream primer GGTCATGAACAAAGGATT; The second primer set: SEQ ID NO.3: Upstream primer TTAATTTTGGTAATTCAA, SEQ ID NO.4: downstream primer GATCGGATGGCATCTTGAA; The third primer set: SEQ ID NO.5: Upstream primer TTCTGAAGGTTTACTCTCA, SEQ ID NO.6: downstream primer CGGCTTGGGCCAGTTCGGTC; The above primer sets were synthesized by General Biosystems (Anhui) Co., Ltd.

[0028] 2. Positive and negative controls The positive control was the artificially synthesized pMD-Fiber plasmid containing the Fiber gene sequence of the egg drop syndrome virus (SEQ ID NO.7), and the negative control was nuclease-free water.

[0029] 3. Screening of the best primer set sequence SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 were used as primer sets, respectively, and the plasmid copy number was 5.3×10 3 The pMD-Fiber plasmid was used as a standard template for fluorescence PCR amplification reaction. The primer combination with the lowest Ct value, the highest fluorescence intensity increase value (△Rn) and a single product amplification peak was the best, and the optimal primer combination was screened.

[0030] The results showed that there was no amplification with the primer pairs of SEQ ID NO.3 and SEQ ID NO.4. When the template, reaction system and amplification conditions were the same, the primer pairs of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.5 and SEQ ID NO.6 all had amplification curves, with the CT of the former being 28 and the CT of the latter being 20. There was no CT in the negative control when the two primer pairs were amplified. The optimal primer combination finally screened was SEQ ID NO.5 and SEQ ID NO.6.

[0031] 4. Optimization of SYBR Green Ⅰ fluorescent PCR detection method for JS strain EDSV (1) Optimization of primer concentration ratio: After primer dilution, the primers were mixed at different primer concentrations. The SYBR GreenPro Taq HS premixed qPCR kit and the recommended reaction system and reaction conditions were used. The lowest Ct value, the highest fluorescence intensity increase value (△Rn), amplification efficiency, repeatability and plateau phase were used as comprehensive judgment criteria. Finally, the concentrations of the primers shown in SEQ ID NO.5 and SEQ ID NO.6 in the system were determined to be 10 pmol / μL. In the primer set, the molar ratio of SEQ ID NO.5 and SEQ ID NO.6 was 1:1.

[0032] (2) Optimization of annealing temperature: Using the positive control determined in the above step as a template, the annealing temperature was optimized and set within the range of 50-60°C. The SYBR Green Pro Taq HS premixed qPCR kit and the recommended reaction system and reaction conditions were used. The optimal annealing temperature was 55°C.

[0033] 5. SYBR Green Ⅰ fluorescent PCR detection kit for JS strain EDSV The kit includes SYBR Green Ⅰ fluorescent PCR primer set, 2×SYBR Green Pro Taq HS Premix, negative control, and positive control; The SYBR Green Ⅰ fluorescent PCR primer set includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.6, and the concentrations of the upstream primer and the downstream primer are both 10 pmol / μL; The negative control was nuclease-free water; The positive control was the pMD-Fiber plasmid containing the gene sequence shown in SEQ ID NO.7.

[0034] 6. Establishment of SYBR Green Ⅰ fluorescent PCR detection method for JS strain EDSV (1) The total fluorescence PCR system is 50 μL: 2×SYBR Green Pro Taq HS Premix 25 μL, primer set 5 μL, nuclease-free water 5 μL, template 15 μL; (2) Fluorescence PCR amplification conditions: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 5 s, annealing at 55°C for 10 s, extension at 72°C for 15 s, 40 cycles; after the cycle, heat at 60°C for 1 min, increase the temperature at a rate of 0.1°C / s to 97°C, collect fluorescence continuously during the whole process, and finally cool at 40°C.

[0035] (3) Result analysis: ①Quality control standards: Negative control: no Ct value and no typical amplification curve, but the melting curve Tm value is 81.5±0.5℃ and no melting peak appears; Positive control: Ct value <30.0, with a typical amplification curve, and a melting peak at 81.5±0.5℃ on the melting curve Tm value; If the results of the negative and positive control groups are not established, the test is considered invalid.

[0036] ②Result determination: If the test sample has no Ct value and no typical amplification curve, or the Ct value is >35.0 but the melting curve Tm value is 81.5±0.5℃ and no melting peak appears, it is judged to be negative for chicken egg laying syndrome virus nucleic acid; If the Ct value of the test sample is ≤30.0, a typical amplification curve appears, and the melting curve Tm value is 81.5±0.5℃ with a melting peak, it is judged to be positive for the egg laying syndrome virus nucleic acid; If 30.0<Ct value of the test sample≤35.0, a typical amplification curve appears, and the melting curve Tm value is 81.5±0.5℃ with a melting peak, the sample is judged to be suspicious and a double-well repeated test is performed. If the repeated test result of at least one well is positive, it is judged to be positive for the nucleic acid of the egg laying decline syndrome virus, otherwise it is negative.

[0037] Example 2 Kit sensitivity analysis The test was conducted using the SYBR Green I fluorescent PCR detection kit for JS strain EDSV determined in Part 5 of Example 1.

[0038] (1) Preparation of pMD-Fiber standard solution: Calculate the copy number based on the concentration of the pMD-Fiber plasmid standard solution. The copy number of the pMD-Fiber plasmid is 5.3×10 10 copies / μL; The plasmid standard was diluted in a 10-fold serial gradient. 4 Copies / μL~10 -3 The pMD-Fiber plasmid standard with a volume of 100 copies / μL was used as the plasmid standard template, and the obtained template solutions were numbered as follows: Standard template 1: 5.3×10 4 copies / μL of pMD-Fiber plasmid standard; Standard template 2: 5.3×10 3 copies / μL of pMD-Fiber plasmid standard; Standard template 3: 5.3×10 2 copies / μL of pMD-Fiber plasmid standard; Standard template 4: 5.3×10 1 copies / μL of pMD-Fiber plasmid standard; Standard template 5: 5.3×10 0 copies / μL of pMD-Fiber plasmid standard; Standard template 6: 5.3×10 -1 copies / μL of pMD-Fiber plasmid standard; Standard template 7: 5.3×10 -2 copies / μL of pMD-Fiber plasmid standard; Standard template 8: 5.3×10 -3 Copies / μL of pMD-Fiber plasmid standard.

[0039] (2) Fluorescence PCR amplification: The total fluorescence PCR system is 50 μL, including 2×SYBR Green Pro Taq HS Premix 25 μL, primer set 5 μL, and nuclease-free water 5 μL were added to 0.1 mL amplification tubes to prepare 9 aliquots for later use; they were marked as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8#, and 9#; Take 15 μL of each of the 8 standard templates prepared in step (1), add them to 1#, 2#, 3#, 4#, 5#, 6#, 7#, and 8#, respectively, and use nuclease-free water to replace the standard solution in step (1) and add it to 9#; after the addition is completed, centrifuge instantly and place in a fluorescent PCR instrument for amplification reaction; The fluorescence PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 5 s, annealing at 55°C for 10 s, extension at 72°C for 15 s, and 40 cycles. After the cycle, the sample was heated at 60°C for 1 min, then heated at a rate of 0.1°C / s until it reached 97°C. During the whole process, fluorescence was continuously collected, and the sample was finally cooled at 40°C.

[0040] (3) Result analysis: The results were analyzed and determined according to the determination method established in Part 6 of Example 1.

[0041] like Figure 1 As shown, the minimum detection limit of pMD-Fiber using the kit provided by the present invention is 0.053 copies / μL, indicating that the primer set and the kit have good sensitivity.

[0042] Example 3 Kit specificity analysis The test was conducted using the SYBR Green I fluorescent PCR detection kit for JS strain EDSV determined in Part 5 of Example 1.

[0043] (1) Prepare templates: Use genomes of JS strain EDSV, standard strain AV127 strain EDSV, chicken infectious anemia virus, avian leukosis virus, infectious laryngotracheitis virus, infectious bronchitis virus, Newcastle disease virus, avian influenza virus, etc. as templates for later use; (2) Fluorescence PCR amplification: The total fluorescence PCR system is 50 μL, including 2×SYBR Green Pro Taq HS Premix 25 μL, primer set 5 μL, and nuclease-free water 5 μL were added to a 0.1 mL amplification tube to prepare 8 aliquots for later use; they were marked as 1#, 2#, 3#, 4#, 5#, 6#, 7#, and 8#; Take 15 μL of the templates of JS strain EDSV, standard strain AV127 strain EDSV, chicken infectious anemia virus, avian leukosis virus, chicken infectious laryngotracheitis virus, chicken infectious bronchitis virus, Newcastle disease virus, and avian influenza virus in step (1) and add them to 1#, 2#, 3#, 4#, 5#, 6#, 7#, and 8#, respectively. After the addition is completed, centrifuge instantly and place in a fluorescent PCR instrument for amplification reaction; Fluorescence PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 5 s, annealing at 55°C for 10 s, extension at 72°C for 15 s, 40 cycles; after the cycle, 60°C for 1 min, heating at a rate of 0.1°C / s until 97°C, during which fluorescence was continuously collected, and finally cooled at 40°C. (3) Result analysis: The results were analyzed and determined according to the determination method established in Part 6 of Example 1.

[0044] like Figure 2 As shown, the JS strain EDSV showed a specific peak at 81.5±0.5℃, and the rest were negative, proving that the primer set and kit had good specificity.

[0045] Example 4 The SYBR Green I fluorescent PCR detection kit for JS strain EDSV determined in Part 5 of Example 1 was used to detect JS strain EDSV isolated from duck embryos of the fifth generation, and the steps were as follows: (1) Preparation of the sample template to be tested: isolate the allantoic fluid of duck embryos with JS strain EDSV, centrifuge at 8000 rpm for 2 min, take 200 μL of the supernatant and place it in a 1.5 mL centrifuge tube, and use a commercial kit to extract the viral nucleic acid; (2) Fluorescence PCR amplification: The total fluorescence PCR system is 50 μL, including 2×SYBR Green Pro Taq HS Premix 25 μL, primer set 5 μL, and nuclease-free water 5 μL were added to 0.1 mL amplification tubes. Three replicates were made and labeled as amplification tube A, amplification tube B, amplification tube C, amplification tube D, and amplification tube E. Add 15 μL of the sample template to be tested to amplification tube A, add 15 μL of the positive control to amplification tube B, add 15 μL of the standard strain AV127 EDSV nucleic acid to amplification tube C, add 15 μL of the standard strain Jing 911 EDSV nucleic acid to amplification tube D, and add 15 μL of the negative control to amplification tube E. After the addition of samples, centrifuge instantly and place in a fluorescent PCR instrument for amplification reaction. The program design is as follows: Pre-denaturation at 95℃ for 3min, denaturation at 94℃ for 5s; annealing at 55℃ for 10s; extension at 72℃ for 15s; 40 cycles; after the cycle, 60℃ for 1min, heating at a rate of 0.1℃ / s until 97℃, fluorescence was continuously collected during the whole process, and finally cooled at 40℃; (3) Result analysis: The results were analyzed and determined according to the determination method established in Part 6 of Example 1.

[0046] The results are as follows Figure 3 As shown, Figure 3 The curve with number 1 is the template curve of the sample to be tested, the curve with number 2 is the positive control curve, the curve with number 3 is the template curve of the standard strain AV127 EDSV, the curve with number 3 is the template curve of the standard strain Jing 911 EDSV, and the curve with number 5 is the negative control curve. The amplification results were observed and analyzed, and only the JS strain EDSV template showed a peak at 81.5±0.5℃, indicating that the nucleic acid of the chicken egg laying decline syndrome virus was positive.

[0047] In summary, the present invention designs primers and probes based on the differences in the Fiber gene between the JS strain and the existing EDSV published in GenBank, which can achieve specific detection of the JS strain EDSV and no amplification of the existing EDSV standard strain, laying a foundation for the later study of the characteristics of the strain, vaccine development and identification detection.

[0048] Although the present invention has been described in detail with reference to the accompanying drawings and in combination with the preferred embodiments, the present invention is not limited thereto. Without departing from the spirit and essence of the present invention, a person of ordinary skill in the art may make various equivalent modifications or substitutions to the embodiments of the present invention, and these modifications or substitutions shall be within the scope of the present invention. Any person of ordinary skill in the art may easily think of changes or substitutions within the technical scope disclosed by the present invention, and these shall be within the scope of protection of the present invention.

Claims

1. A SYBR Green Ⅰ fluorescent PCR primer set for detecting a variant strain JS of chicken egg drop syndrome virus, characterized in that: comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6; The target sequence of the SYBR Green Ⅰ fluorescent PCR primer set is the Fiber gene sequence of the variant strain JS of the egg drop syndrome virus, and the specific nucleotide sequence is shown in SEQ ID NO.

7.

2. A kit for detecting a variant strain JS of chicken egg drop syndrome virus, characterized in that: Includes SYBRGreen Ⅰ fluorescent PCR primer set; The SYBR Green Ⅰ fluorescent PCR primer set includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6; The target sequence of the SYBR Green Ⅰ fluorescent PCR primer set is the Fiber gene sequence of the variant strain JS of the egg drop syndrome virus, and the specific nucleotide sequence is shown in SEQ ID NO.

7.

3. The kit according to claim 2, characterized in that The kit also includes 2×SYBR Green Pro Taq HS Premix, negative control, and positive control.

4. The kit according to claim 3, characterized in that The negative control was nuclease-free water.

5. The kit according to claim 3, wherein The positive control was the pMD-Fiber plasmid containing the gene sequence shown in SEQ ID NO.

7.

6. The kit according to claim 2, characterized in that The concentrations of the upstream primer and the downstream primer were both 10 pmol / μL.

7. A method for using the kit according to any one of claims 2 to 6, characterized in that: For non-disease diagnosis purposes, the specific steps are as follows: (1) Prepare the sample template to be tested; (2) Fluorescence PCR amplification: The total fluorescence PCR system is 50 μL, including 2×SYBR Green Pro Taq HS Premix 25 μL, primer set 5 μL, and nuclease-free water 5 μL were added to 0.1 mL amplification tubes. Three replicates were made and labeled as amplification tube I, amplification tube II, and amplification tube III. Add 15 μL of the sample template to be tested to amplification tube I, add 15 μL of the positive control to amplification tube II, and add 15 μL of the negative control to amplification tube III. After the addition of samples, centrifuge instantly and place in a fluorescent PCR instrument for amplification reaction; (3) Result determination: If the test sample has no Ct value and no typical amplification curve, or the Ct value is >35.0 but the melting curve Tm value is 81.5±0.5℃ and no melting peak appears, it is judged to be negative for egg laying syndrome virus nucleic acid; If the Ct value of the test sample is ≤30.0, a typical amplification curve appears, and the melting curve Tm value is 81.5±0.5℃ with a melting peak, it is judged to be positive for the egg laying syndrome virus nucleic acid; If 30.0<Ct value of the test sample≤35.0, a typical amplification curve appears, and the melting curve Tm value is 81.5±0.5℃ with a melting peak, the sample is judged to be suspicious and a double-well repeated test is performed. If the repeated test result of at least one well is positive, it is judged to be positive for the nucleic acid of the egg laying decline syndrome virus, otherwise it is negative.

8. The method of use according to claim 7, characterized in that: The specific method of preparing the sample template to be tested in step (1) is as follows: using the suspected diseased tissue as the test sample, grinding and preparing a suspension, centrifuging to obtain the supernatant, and using a commercial kit to extract viral nucleic acid.

9. The method of use according to claim 7, characterized in that: The conditions for step (2) fluorescence PCR amplification are as follows: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 5 s, annealing at 55°C for 10 s, extension at 72°C for 15 s, and 40 cycles. After the cycle, heat at 60°C for 1 min, and increase the temperature at a rate of 0.1°C / s until it reaches 97°C. During the whole process, fluorescence is continuously collected, and finally the sample is cooled at 40°C.

Images