Application of Rv2610 in preparation of medicine for resisting mycobacterium tuberculosis infection

Abstract

The invention discloses application of Rv2610 in preparation of a medicine for resisting mycobacterium tuberculosis infection, and belongs to the technical field of biology. The invention finds that the Rv2610 can promote the adhesion capacity of mycobacterium tuberculosis to macrophages and inhibit the expression of early inflammatory molecules TNF-alpha and IL-1beta of the macrophages, and in a mouse infection model, the Rv2610 promotes the colonization of mycobacterium in the lung in vivo. The Rv2610 can be used as a new drug target for resisting tuberculosis infection, and an inhibitor of the Rv2610 can be used for preparing a drug for resisting mycobacterium tuberculosis infection. The invention provides new tools and ideas for clinical prevention and treatment of tuberculosis, particularly has wide prospects in the aspects of development, clinical application and the like of antituberculosis drugs and vaccines, and can also be applied to the field of scientific research or guide development of inhibitors for inhibiting mycobacterium tuberculosis from infecting host macrophages. The invention has important application value for obtaining new anti-tuberculosis drug targets and screening new drugs.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of Mycobacterium tuberculosis pathogenic protein Rv2610 or its encoding gene as an important target site for designing and screening anti-tuberculosis drugs in the preparation of anti-Mycobacterium tuberculosis infection drugs. Background Art

[0002] Tuberculosis (TB) is a chronic infectious disease that seriously endangers the health of humans and animals. Tuberculosis caused by Mycobacterium tuberculosis is a zoonotic tuberculosis.

[0003] The number of multidrug-resistant tuberculosis patients is growing very rapidly, with the proportion of multidrug-resistant / rifampicin-resistant patients being 3.3% among new patients and 17% among retreated patients. Such huge data tells us that the treatment of tuberculosis is imminent. In order to avoid the emergence of drug resistance during drug treatment, the current clinical practice often adopts a combination of anti-tuberculosis drugs, but it also undoubtedly increases the burden on patients. Therefore, discovering new targets for anti-tuberculosis infection and developing new anti-tuberculosis drugs have become the most concerned issues at present.

[0004] Mycobacterium tuberculosis (Mtb) grows slowly, and its widespread spread and pathogenicity around the world are due to its strong survival ability. It has been determined that the cell wall of M. tuberculosis is conducive to its survival in the infected host, and the more effective anti-tuberculosis drugs currently also act on the metabolic pathways of cell wall components. Lipoarabinomannans (LAM) are the most potential non-peptide molecules that can regulate host immune responses. They are unique glycolipids on the cell wall of mycobacteria. Based on this, LAM plays an important role in the interaction between M. tuberculosis and the host and in affecting the immune response.

[0005] Macrophages are the main host cells for Mycobacterium tuberculosis. Some Mycobacterium tuberculosis can escape the host immune system, especially the pursuit of macrophages. After being engulfed into the phagosome of the macrophage, they can successfully prevent the fusion of the phagosome and the lysosome, inhibit the maturation of the phagolysosome, and thus prevent themselves from being degraded by the lysosome. At the same time, they can also use macrophages as a shelter, allowing themselves to lurk and even proliferate conditionally.

[0006] Identifying and analyzing the pathogenic genes of Mycobacterium tuberculosis, especially the functional genes related to the invasion of host macrophages, can provide important target sites for the design and screening of anti-tuberculosis drugs. Using molecular biology techniques to clone and identify new pathogenic genes that play an important role in the invasion of Mycobacterium tuberculosis can provide important drug targets for the design and screening of new tuberculosis agents, which has very important theoretical significance and application value for the comprehensive prevention and treatment of tuberculosis. Summary of the invention

[0007] In order to solve the deficiencies in the prior art, the purpose of the present invention is to provide a protein Rv2610 of pathogenic Mycobacterium tuberculosis or its coding gene that can significantly promote the adhesion of Mycobacterium tuberculosis to host macrophages and inhibit inflammation, and Rv2610 can be used as a new drug target for anti-tuberculosis infection. Rv2610 is a key mannosyltransferase responsible for the first step of the synthesis of Mycobacterium tuberculosis lipoarabinomannan in the synthesis pathway - transferring the first mannose residue from GDP-mannose (GDP-Mannose) to the C-2 position of the inositol part of phosphatidyl-myo-inositol (Phosphatidyl-myo-inositol, PI) to form phosphatidyl-myo-inositol monomannosides (Phosphatidyl-myo-inositol Mannosides, PIM1). The full length of the Rv2610 gene coding sequence is 1137bp, and the sequence is shown in SEQ ID NO: 1; the length of the Rv2610 protein is 378aa, the protein size is 40Kd, and the amino acid sequence is shown in SEQ ID NO: 2. At present, the specific reactions in the LAM synthesis pathway involved in Rv2610 have been discovered and elucidated, and most of the research results are focused on its protein structure. No one has further studied the impact and significance of Rv2610 in bacterial physiological processes and interactions with host macrophages.

[0008] To achieve the above purpose, the technical solution of the present invention is as follows:

[0009] The present invention designs primers of Rv2610 and uses the Mycobacterium tuberculosis H37Rv genome as a template to perform PCR amplification. It is then constructed onto a pMV261 prokaryotic expression vector, and the recombinant plasmid is electrotransferred into a Mycobacterium smegmatis competent state (M. smegmatis, Ms). After picking a single clone and shaking the bacteria, PCR and Western blot verify the positive clone colony, and then the recombinant Mycobacterium smegmatis rM.s::Rv2610 is used to infect a mouse macrophage cell line RAW264.7, a human macrophage cell line THP1 after PMA (phorbol ester) stimulation differentiation, and a bone marrow-derived Macrophage (The bone marrow-derived Macrophage, BMDM) for 30 minutes. For an adhesion experiment, after 30 minutes of infection, the culture medium is discarded, PBS is washed three times, the cells are lysed, and the lysate is coated on a kanamycin resistance (KanR) solid culture medium for colony counting. For the invasion experiment, 30 minutes after infection, the cells were treated with gentamicin for 30 minutes to remove and kill the extracellular bacteria that did not invade. After continuing to culture for 30 minutes, they were washed three times with PBS, and the washed cells were lysed. The lysate was spread on a kanamycin-resistant solid culture medium for colony counting. The results showed that compared with the invasion experiment, rM.s::Rv2610 produced more colonies in the adhesion experiment compared with the control group, and it was statistically significant. Therefore, the functional gene Rv2610 that can promote the adhesion of Mycobacterium tuberculosis to macrophages was screened out. Rv2610 can also inhibit the expression of early inflammatory molecules TNF-α and IL-1β in macrophages. It was also verified in animal models that the Rv2610 gene promotes bacterial colonization and pathogenicity. In addition, the H37Ra knockdown bacteria of Rv2610 were constructed using Crispri-cas9 technology, BMDM were infected with the bacteria, and the bacteria were counted at different time points. It was found that the loss of Rv2610 could significantly reduce the survival of Mycobacterium tuberculosis in macrophages.

[0010] Therefore, the Mycobacterium tuberculosis Rv2610 protein or its encoding gene can be used as a target for drug screening, and drugs that inhibit the activity of the Rv2610 protein or the expression of the Rv2610 gene can be used to inhibit the adhesion of Mycobacterium tuberculosis to host macrophages, thereby resisting infection with Mycobacterium tuberculosis.

[0011] The first aspect of the present invention provides the use of Rv2610 in the preparation of a drug for the prevention of Mycobacterium tuberculosis infection. Further, in the application, Rv2610 is used as a target for drug screening, and drugs that can inhibit Rv2610 gene expression or Rv2610 protein activity, thereby inhibiting Mycobacterium tuberculosis infection of host macrophages and / or promoting the expression of early inflammatory molecules TNF-α and IL-1β in macrophages are screened.

[0012] The second aspect of the present invention provides the use of an inhibitor of Rv2610 in the preparation of a drug for the prevention of Mycobacterium tuberculosis infection. The inhibitor of Rv2610 includes a substance that inhibits the expression of the Rv2610 gene and a substance that inhibits the activity of the Rv2610 protein; the substance that inhibits the expression of the Rv2610 gene includes siRNA, dsRNA, shRNA, sgRNA, etc., as well as interference vectors, knockout vectors, etc.; the substance that inhibits the activity of the Rv2610 protein includes an antibody to the Rv2610 protein, a plasmid expressing the antibody to the Rv2610 protein, a compound that can bind to the Rv2610 protein and inhibit the activity of the Rv2610 protein, etc.

[0013] In some embodiments, the substance that inhibits the expression of the Rv2610 gene is a gene knockdown vector based on Crispri-cas9, and the sgRNA on the vector is preferably obtained by annealing the following primers:

[0014] Rv2610-sgRNAF:GGGATCCGGCGTCGTCCCACCTGAC,

[0015] Rv2610-sgRNAR:AAACGTCAGGTGGACGACGCCGGA.

[0016] In a third aspect of the present invention, an application of Rv2610 in the preparation of a Mycobacterium tuberculosis vaccine is provided, wherein the application is to knock out or knock down the Rv2610 gene of Mycobacterium tuberculosis to reduce its infectivity to the host and improve the safety of the vaccine. Further, a Mycobacterium tuberculosis vaccine is provided, which is a Mycobacterium tuberculosis with the Rv2610 gene knocked out or knocked down.

[0017] In a fourth aspect, the present invention provides the use of Rv2610 in developing an inhibitor for inhibiting Mycobacterium tuberculosis infection of host macrophages. The inhibitor for inhibiting Mycobacterium tuberculosis infection of host macrophages may be an inhibitor of Rv2610.

[0018] Beneficial effects of the present invention: The present invention provides an important target gene or target protein for the prevention and treatment of tuberculosis. The present invention is of great significance for revealing the effect of virulence proteins associated with the pathogenicity of tuberculosis on the invasion of tuberculosis into host macrophages. Drugs developed with this gene or protein as a target can inhibit the adhesion of tuberculosis to host macrophages, thereby controlling the pathogenicity of tuberculosis. The results of the present invention can provide new tools and ideas for the prevention and treatment of clinical tuberculosis, especially in the development and clinical application of anti-tuberculosis drugs and vaccines. It will have broad prospects, and can also be directly applied to the field of scientific research or guide the development of inhibitors that inhibit the infection of host macrophages by Mycobacterium tuberculosis. In addition, this achievement also has important theoretical significance for finding new drug targets and screening new drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : PCR detection of the distribution of Rv2610 in different mycobacteria. In the figure, Control: no template control, pcDNA3.1-Rv2610: eukaryotic expression vector of Rv2610 as positive control, H37Rv: standard strain of Mycobacterium tuberculosis, H37Ra: attenuated strain of Mycobacterium tuberculosis, BCG: Bacillus Calmette-Guérin, M.marinum: marine Mycobacterium, M.intracellulare: intracellular Mycobacterium, M.smegmatis: Mycobacterium smegmatis, M.avium: Mycobacterium avium.

[0020] Figure 2 :Construction and identification of recombinant Mycobacterium smegmatis overexpressing Rv2610. Figure 2 a: PCR detection of the successful construction of recombinant Mycobacterium smegmatis overexpressing Rv2610; Figure 2 b: Western Blot detection of Rv2610 successfully expressing protein in recombinant Mycobacterium smegmatis; Figure 2 c: Growth curves of Mycobacterium smegmatis Ms, rM.s::pMV261, and rM.s::Rv3621c.

[0021] Figure 3 :In vitro colony counts verified that Rv2610 could promote the adhesion level of Mycobacterium smegmatis to the mouse macrophage cell line RAW264.7 (a), the human macrophage cell line THP1 differentiated by PMA (phorbol ester) stimulation (b), and bone marrow-derived macrophages BMDM (c).

[0022] Figure 4 :In vitro colony counts verified that Rv2610 could promote the early (1, 3 hours) adhesion level of Mycobacterium smegmatis to the human macrophage cell line THP1 (a) and bone marrow-derived macrophages BMDM (b) after differentiation by PMA (phorbol ester) stimulation.

[0023] Figure 5 :The colony counts verified that Rv2610 could promote the colonization and pathogenicity of Mycobacterium smegmatis in the lungs of mice. Figure 5 a: Experimental process; Figure 5 b: Colony counting results.

[0024] Figure 6 : ELISA verified that Rv2610 inhibited the secretion levels of macrophage inflammatory factors TNF-α(a) and IL-1β(b) after infecting the human macrophage cell line THP1.

[0025] Figure 7: The Rv2610 knockdown H37Ra strain was constructed using Crispri-cas9 technology, and the protein levels of Rv2610 in different H37Ra recombinant bacteria were detected (a) and the colony counts after infecting BMDM cells at different time points (b). DETAILED DESCRIPTION

[0026] The features and advantages of the present invention can be further understood through the following detailed description in conjunction with the accompanying drawings. The embodiments provided are only for illustration of the present invention and do not limit the rest of the contents disclosed by the present invention in any way.

[0027] Unless otherwise specified, the materials used in the following examples are all commercially available, and the operating methods are all conventional operating methods.

[0028] [Example 1] Distribution of Rv2610 in different mycobacteria

[0029] The genome of each mycobacterium was extracted, and Rv2610 primers were designed (Table 1). The gene was amplified by PCR. The specific steps are as follows: Use a bacterial genomic DNA extraction kit to extract the genome of each bacteria as a template for the PCR reaction. The PCR system and process of the Rv2610 gene: 1 μL of primers F and R (both at a concentration of 10 μM), 100 ng of genomic DNA, 25 μL of 2×PCR Mix, and sterile deionized water to a final volume of 50 μL. The PCR amplification conditions are: pre-denaturation at 95°C for 3 minutes under the action of Taq DNA polymerase; denaturation at 95°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 35 cycles; finally extension at 72°C for 5 minutes, and finally storage at 4°C. Prepare 1% agarose gel electrophoresis to identify the PCR amplification products. The results are as follows. Figure 1 As shown, Rv2610 is most obviously expressed in the standard strain H37Rv, attenuated strain H37Ra and BCG of Mycobacterium tuberculosis, while other strains including Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium intracellulare and Mycobacterium avium do not contain this gene.

[0030] Table 1 Primer sequences for Rv2610 gene amplification

[0031]

[0032] Note: The underline in the above primer sequences represents the restriction site.

[0033] [Example 2] Construction and identification of Rv2610 recombinant expression plasmid and recombinant Mycobacterium smegmatis (Ms)

[0034] The genome of the standard strain of Mycobacterium tuberculosis H37Rv was extracted, and PCR amplification was performed using the Rv2610 primer (Table 1). The PCR amplification product was identified by preparing a 1% agarose gel electrophoresis, and recovered and purified using a gel recovery kit. In order to construct it into the prokaryotic expression vector of pMV261-6×his, the pMV261-6×his empty vector was double-digested, and the two restriction sites of BamH I and EcoR I were selected, and the restriction digestion was carried out in a water bath at 37°C for 3 hours. After the restriction product was recovered by the gel recovery kit, it was connected with the recovered and purified Rv2610 PCR product using a homologous recombinase, and the condition was 50°C for more than 30 minutes. Subsequently, the homologous recombination product was transformed into Ecoli DH5α competent bacteria by heat shock method, and the transformation product was coated with LB solid medium (containing kanamycin 50μg / mL). Culture at 37℃ overnight, pick single clone colonies, inoculate LB liquid medium (containing kanamycin 50μg / mL), shake culture at 37℃ for 12-16h, and then identify positive clone strains by PCR. After preserving the strain, extract the plasmid with a plasmid mini-preparation kit, identify by enzyme digestion, and sequence.

[0035] After successful identification and sequencing, the recombinant pMV261 plasmid was electroporated into Ms to construct recombinant mycobacteria, laying the foundation for the next step of macrophage adhesion and invasion experiments. After electroporation, single clones were picked and verified by bacterial liquid PCR and western blot. The results are as follows Figure 2 a and 2b show that the recombinant pMV261-Rv2610 plasmid was successfully electroporated into the Ms competent cell to obtain the recombinant Mycobacterium rM.s::Rv2610, and the Rv2610 protein was successfully expressed.

[0036] To further verify whether the recombinant Mycobacterium smegmatis rM.s::Rv2610 affects the growth rate of bacteria, wild-type Ms. smegmatis, recombinant Mycobacterium smegmatis rM.s::pMV261 (transferred with empty pMV261) and rM.s::Rv2610 were cultured to control the initial OD 450 The culture was carried out at 0.02, and then the OD of the bacterial solution was measured at different time points (6, 12, 24, 36, 48, 72 hours). 450 The results showed that the growth rate of rM.s::Rv2610 was not significantly different from that of the two control groups of Mycobacterium smegmatis Ms and rM.s::pMV261 ( Figure 2 c).

[0037] [Example 3] Screening and identification of Rv2610 that can significantly promote the adhesion of Mycobacterium tuberculosis to macrophages

[0038] Mouse macrophage cell line RAW264.7, PMA (phorbol ester)-stimulated differentiated human macrophage cell line THP1 and bone marrow-derived macrophage BMDM were plated in 12-well cell plates (cell density was 4×10 5 / well), in a 12-well plate, rM.s::pMV261 and rM.s::Rv2610 were infected with cells at an MOI of 10:1 for 30 minutes. For the invasion experiment, after the infection, gentamicin was used for 30 minutes to remove and kill the bacteria outside the cells that did not invade, and the cells were placed in a cell culture incubator for further culture for 30 minutes. After the culture was completed, the cells were washed 3 times with sterile PBS, 200μL Triton X-100 (0.2%) was added and placed at 37°C for 15min to fully lyse the cells. After diluting ten times with PBS, 100μL of the bacterial solution was spread on 2×YT solid culture medium containing kanamycin (50μg / mL) and 0.5% glycerol, placed at 37°C for 2 days and the colonies were counted. For the adhesion experiment, after the infection was completed, gentamicin treatment was not required, and the cells were directly washed 3 times with sterile PBS, 200μL Triton X-100 (0.2%) was added and placed at 37°C for 15min to fully lyse the cells. After ten-fold dilution with PBS, 100 μL of bacterial solution was spread on 2×YT solid medium containing kanamycin (50 μg / mL) and 0.5% glycerol, and cultured at 37°C for 2 days and the colonies were counted. Figure 3 a, b, c, after repeated verification (n>3), in the three cell types, the adhesion of the rM.s::Rv2610 group was significantly increased compared with the rM.s::pMV261 control group that was transferred with empty pMV261, and the results were statistically significant ( Figure 3 a, b, c), while the invasion level was not significantly different. Therefore, it was preliminarily concluded that Rv2610 could significantly promote the adhesion level of Mycobacterium tuberculosis to macrophages.

[0039] Afterwards, colony counting experiments at different time points (1, 3, and 12 hours) of infected macrophages THP-1 and BMDM further verified whether Rv2610 promoted the adhesion of mycobacteria to macrophages. The process was as described above. Macrophages were plated in 12-well plates, and then recombinant Mycobacterium smegmatis was added to the 12-well plates at a ratio of MOI 1:10 according to different time points (1, 3, and 12 hours). After mixing, they were placed in a 37°C cell culture incubator for infection for the corresponding time. The infection groups were rM.s::pMV261 group and rM.s::Rv2610 group. After the infection, wash three times with sterile PBS, add 200μL Triton X-100 (0.2%) and place at 37°C for 15min to fully lyse the cells. After ten-fold dilution with PBS, 100 μL of bacterial solution was spread on 2×YT solid medium containing kanamycin (50 μg / mL) and 0.5% glycerol, incubated at 37°C for 2 days and colony counted. Figure 4 As shown in a and b, in both cell types, rM.s::Rv2610 can significantly promote the adhesion of mycobacteria to macrophages at different time points (1 hour, 3 hours and 12 hours). This further confirms that Rv2610 can significantly promote the early adhesion level of Mycobacterium tuberculosis to macrophages.

[0040] [Example 4] Colony count experiment in mice to detect whether Rv2610 promotes colonization and pathogenicity of mycobacteria in mouse lungs

[0041] Eight-week-old C57BL / 6J mice were given 100 μL of rM.s::pMV261 and rM.s::Rv2610 bacterial solution (concentration of 10 9 / mL). Three days after infection, the lung tissue of mice was obtained under sterile conditions and ground into a homogenate, diluted ten times with PBS, and spread on 2×YT solid medium containing kanamycin (50 μg / mL), incubated at 37°C for 2 days, and the colonies were counted ( Figure 5 a). After repeated verification (n=5), the number of rM.s::Rv2610 colonies remained higher than that of the control group, and the results were statistically significant ( Figure 5 b).

[0042] [Example 5] ELISA test to see whether Rv2610 affects the regulation of mycobacteria on macrophage inflammatory factors

[0043] The steps of infecting macrophages were as described above. Briefly, differentiated human macrophage THP1 cells were stimulated with PMA (phorbol ester) and plated in 12-well cell plates (cell density was 4 × 10 5 / well), in a 12-well plate, rM.s::pMV261 and rM.s::Rv2610 were infected with cells at an MOI of 10:1 at different time points (0, 3, 24 hours). After the infection, the cell supernatant was taken for subsequent ELISA detection of inflammatory factors. The ELISA detection of TNF-α and IL-1β was as described in the instructions of the kit (4ABIOTECH): the cell supernatant and standard (100μL / well) were added to the corresponding wells, the reaction wells were sealed with sealing tape, and incubated at 37°C for 90 minutes. After the completion, the plate was washed four times, the corresponding biotinylated antibody working solution (100μL / well) was added, the reaction wells were sealed with sealing tape, and incubated at 37°C for 60 minutes. After the completion, the plate was washed four times, the enzyme conjugate working solution (100μL / well) was added, the reaction wells were sealed with sealing tape, and incubated at 37°C for 30 minutes. After the plate is washed four times, 100 μL / well of colorimetric solution is added, and the color is developed at 37°C for 10-20 minutes in the dark, during which the color development state is observed. After the color development is completed, 100 μL / well of stop solution is added, and the OD450 value can be measured after mixing. The results are as follows Figure 6 As shown in a and b, compared with the control group, rM.s::Rv2610 can significantly inhibit the levels of inflammatory factors TNF-α and IL-1β at 3 hours ( Figure 6 a, b). Therefore, it was preliminarily confirmed that Rv2610 may inhibit the expression of inflammatory factors TNF-α and IL-1β in macrophages at an early stage, thereby inhibiting inflammation in macrophages.

[0044] [Example 6] Knockdown of Rv2610 reduces the survival level of Mycobacterium tuberculosis in BMDM cells

[0045] 1. Construction of H37Ra::SiRv2610

[0046] (1) Single restriction enzyme digestion of pLJR965 plasmid

[0047] The pLJR965 plasmid was digested with BsmBI-v2 (purchased from NEB, catalog number R0739S). The enzyme digestion system is shown in Table 2.

[0048] Table 2 Single restriction enzyme digestion system of pLJR965 plasmid

[0049]

[0050] The reaction system was gently mixed in a centrifuge tube and centrifuged, incubated at 55°C for 10 minutes, and then heat-inactivated at 80°C for 20 minutes. After completion, the reaction product was electrophoresed with 1% agarose gel, and the gel was cut and recovered using a gel recovery kit for later use.

[0051] (2) Rv2610 primer annealing and ligation

[0052] By searching for a protospacer adjacent motif (PAM sequence) of G / AGAAN in the antisense strand of the CDs region of Rv2610, and taking the first 20 bp as the target sequence, the sgRNA sequence designed by the target sequence is shown in Table 3.

[0053] Table 3 Knockdown primer sequences

[0054]

[0055] Dilute the synthesized sgRNA forward and reverse primers to 100 μM, and prepare the annealing and ligation system according to Table 4.

[0056] Table 4 sgRNA annealing and connection system

[0057]

[0058] Set the PCR instrument to the following program: 37°C, 30 minutes; 95°C, 5 minutes, and cool down to 25°C at a rate of 5°C / min. After completion, dilute the reaction product 10 times and place it at low temperature for later use.

[0059] (3) Product ligation and transformation

[0060] The annealed and diluted sgRAN oligo and the single enzyme digestion product of the pLJR965 plasmid were connected, and the connection system is shown in Table 5.

[0061] Table 5 Connection system

[0062]

[0063] The ligation was carried out at room temperature for 20 minutes, and then the cells were quickly transformed into DN5α competent cells and plated on Kana-resistant LB solid culture plates. The next day, bacterial monoclonal sequencing was performed to verify the plasmids, and the positive clones were sequenced and saved for future use. The pLJR965-Rv2610 plasmid was successfully obtained.

[0064] 2. Electroporate pLJR965-Rv2610 into H37Ra and verify positive clones

[0065] (1) Preparation of H37Ra competent cells

[0066] Pick a single colony containing H37Ra and inoculate it into 10 mL of 7H9 medium. Incubate at 37°C with shaking until it grows to saturation. Take an appropriate amount of saturated bacterial liquid and transfer it to a roller bottle containing 100 mL of 7H9 medium. The initial OD 600= 0.02, rolling culture at 37℃ until the bacterial OD600 is about 0.6-0.8, add 15% glycine (1:100) and continue to culture for 24h. Collect bacteria, 100mL bacterial solution, centrifuge at 3700g, 25℃ for 10 minutes, discard the supernatant, wash three times with 100mL preheated 10% glycerol water, for the first wash, add 2mL 10% glycerol and gently blow up and down with 1mL gun tip to resuspend the bacteria, do not vortex, then add more 10% glycerol to 25mL, then centrifuge and discard the supernatant, add less than 2mL 10% glycerol to resuspend, the 10% glycerol volume used for three washes is reduced to 1 / 2, 1 / 4, 1 / 8 of the original culture volume, and finally 100mL bacterial solution is resuspended with 2-3mL 10% glycerol; after blowing the bacteria, dispense into 1.5mL EP tubes, 200μL each, and store in -80℃ refrigerator for standby use.

[0067] (2) Electrotransfer pLJR965-Rv2610 into H37Ra

[0068] Take an appropriate amount of positive pLJR965-Rv2610 plasmid and add it to the H37Ra electroporation competent medium and mix well. At the same time, electroporate pLJR965 empty load as a control bacteria, and use a 2mm electroporation cup Bio-Rad electroporator for electroporation transformation (electroporation parameters: voltage 2.5kV, resistance 1000Ω, capacitance 25μF). After electroporation, add complete culture medium, culture in a 37°C incubator overnight, divide the bacterial solution into two and spread it on 7H10 solid culture plates containing 50ng / mL Kana resistance and double resistance containing Kana and anhydrotetracycline (200ng / mL ATC), and culture at 37°C for 15-20 days.

[0069] (3) Verification of H37Ra::SiRv2610 bacteria

[0070] The pLJR965 vector contains a tetracycline-inducible gene on-system (Tet-on). Based on this, in the presence of ATC, the downstream dCas9 protein will be induced to transcribe and function, causing gene interference in Rv2610. Therefore, the number of bacteria on the 7H10 solid culture plates containing Kana resistance and double resistance to Kana and anhydrotetracycline (ATC) can be used to preliminarily determine whether the sgRNA is effective: if the bacteria on the double resistance plate are less than 1 / 10 of the bacteria on the single resistance plate, it is preliminarily determined that this target is effective. Pick WT H37Ra, H37Ra-pLJR965 (written as H37Ra::SiVector), H37Ra-pLJR965-Rv2610 (written as H37Ra::SiRv2610 (Kana) respectively. +)) into 7H9 liquid culture medium and cultured at 37℃ for about 15 days. + ) were inoculated into a medium containing Kana and ATC dual resistance (written as H37Ra::SiRv2610 (Kana + ,ATC + )), this group is the Rv2610 knockdown bacterial group.

[0071] An equal number of bacteria were drawn and crushed, and the crushed bacteria solution was collected for western blot experiment. Rv2610 rabbit polyclonal antibody was used as the primary antibody to detect whether the protein level of Rv2610 in the four bacteria changed. The results showed that compared with the first three control groups, H37Ra::SiRv2610 (Kan + ,ATC + ) group Rv2610 protein level was significantly decreased ( Figure 7 a), which indicates that the Rv2610 knockdown bacteria were successfully constructed.

[0072] 3. H37Ra::SiRv2610(Kan + ,ATC + ) strains infected BMDM cells

[0073] Take H37Ra::SiVector, H37Ra::SiRv2610 (Kan + ) and H37Ra::SiRv2610 (Kan + ,ATC + ) (MOI 1:10) was used to infect BMDM cells, and the colonies were counted 1h, 3h, 6h, 12h, and 24h after infection.

[0074] The results of BMDM cell counting are as follows Figure 7 As shown in b, at different time points, H37Ra::SiRv2610 (Kan + ,ATC + ) group had significantly lower bacterial counts than the other two control groups, indicating that knocking down Rv2610 significantly reduced the survival of mycobacteria in BMDM cells. Therefore, Rv2610 is a functional gene that promotes the invasion of Mycobacterium tuberculosis into macrophages, and inhibiting its expression can reduce the survival of Mycobacterium tuberculosis in macrophages.

[0075] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

Claims

1. Application of Rv2610 in the preparation of drugs for anti-Mycobacterium tuberculosis infection.

2. The use according to claim 1, characterized in that: The application is to use Rv2610 as a target for drug screening, and to screen drugs that can inhibit Rv2610 gene expression or Rv2610 protein activity, thereby inhibiting Mycobacterium tuberculosis from infecting host macrophages.

3. Application of Rv2610 inhibitors in the preparation of drugs for anti-Mycobacterium tuberculosis infection.

4. The use according to claim 3, characterized in that: The Rv2610 inhibitors include substances that inhibit the expression of the Rv2610 gene and substances that inhibit the activity of the Rv2610 protein.

5. The use according to claim 4, characterized in that: The substances that inhibit the expression of the Rv2610 gene include siRNA, dsRNA, shRNA, sgRNA, interference vectors, and knockout vectors; the substances that inhibit the activity of the Rv2610 protein include antibodies to the Rv2610 protein, plasmids expressing antibodies to the Rv2610 protein, and compounds that inhibit the activity of the Rv2610 protein.

6. Application of Rv2610 in the preparation of Mycobacterium tuberculosis vaccine.

7. The use according to claim 6, characterized in that: The application is to knock out or knock down the Rv2610 gene of Mycobacterium tuberculosis to weaken its infectivity to the host and improve the safety of the vaccine.

8. A Mycobacterium tuberculosis vaccine, characterized in that: The invention relates to a Mycobacterium tuberculosis strain in which the Rv2610 gene is knocked out or knocked down.

9. Application of Rv2610 in developing inhibitors that inhibit Mycobacterium tuberculosis infection of host macrophages.

10. The use according to claim 9, characterized in that: The inhibitor for inhibiting Mycobacterium tuberculosis from infecting host macrophages is an inhibitor of Rv2610.

Images