Multifunctional DNA nano-material, preparation method thereof and application of multifunctional DNA nano-material in treatment of traumatic brain injury secondary encephaledema

Abstract

The invention belongs to the field of biological materials, and particularly relates to a multifunctional DNA nanometer material, a preparation method and application of the multifunctional DNA nanometer material in treatment of traumatic brain injury secondary encephaledema. The multifunctional DNA nano material comprises a plurality of deoxyribozyme (DNAzyme) targeting C1q mRNA (messenger Ribonucleic Acid) and a repeating unit which is integrally connected with G-quadruplex / Hemin in series, wherein the G-quadruplex / Hemin is labeled by streptavidin SA and biotin and is used for scavenging free radicals. The DNAzyme for silencing the C1q gene of the mouse is designed on the basis of a bioinformatics method, and the C1q gene overexpressed in an inflammation model can be knocked down to an approximate normal level. The RCA technology mediated self-assembled nano material SA-B / H has excellent enzyme mimetic activity, can effectively remove free radicals such as H2O2 and O2 <.->, and has the potential of in-vivo oxidation resistance. In-vitro experiments prove that SA-B / H can effectively relieve high-level oxidative stress of cells caused by H2O2 stimulation.

Description

Technical Field

[0001] The invention belongs to the field of biomaterials, and specifically relates to a multifunctional DNA nanomaterial, a preparation method thereof, and an application thereof in treating brain edema secondary to traumatic brain injury. Background Art

[0002] Traumatic brain injury (TBI) is one of the major global public health problems, with high mortality and disability rates. Brain edema, cerebral blood perfusion disorders and neuroinflammation caused by secondary injuries are closely related to the prognosis of the disease. Currently, there is a lack of effective neuroprotective agents.

[0003] Among the many complex neuro-metabolic cascades, oxidative stress and chronic neuroinflammation play a key role. Brain tissue trauma increases oxygen consumption, further increasing the level of reactive oxygen species (ROS) in the tissue. Excessive ROS-mediated oxidative stress can interfere with the self-regulatory function of cerebrovascular vessels, causing focal or global cerebral ischemia, aggravating oxidative stress, forming a vicious cycle, and continuously destroying normal brain tissue. Among them, the immune molecule C1q is the initiator of the classical complement cascade reaction and is considered to be a key trigger for inflammation at the site of injury. Studies have shown that C1q is a disease regulator of TBI and has become a new target for alleviating neuronal loss and neuroinflammation caused by TBI. This article takes the elimination of excessive ROS as the key point and the inhibition of the innovative target C1q gene as the binding point to provide a new strategy for the construction of drugs to alleviate TBI neural injury.

[0004] In recent years, nanomaterials have been widely used in the field of biomedical research due to their high catalytic stability, design flexibility and low cost. Among them, inorganic nanomaterials with free radical catalytic activity are gradually replacing natural enzymes and have achieved satisfactory therapeutic effects in animal models of neurological diseases. As a new type of biomaterial, DNA nanotechnology has broad application prospects in biomedical engineering fields such as disease diagnosis, drug delivery and tissue regeneration due to its structural rigidity, biocompatibility and programmability. DNA nanomaterials can be programmed as carrier tools for functional nucleic acids such as deoxyribozymes or aptamers, which can achieve important physiological functions such as gene silencing, reactive oxygen scavenging and tissue targeting. Based on this, DNA nanotechnology has brought new opportunities for multi-target treatment of secondary injuries of TBI, and provided new ideas and methods. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a multifunctional DNA nanomaterial and a preparation method and application thereof in treating brain edema secondary to traumatic brain injury.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A multifunctional DNA nanomaterial comprises a plurality of DNAzymes targeting C1q mRNA and a repeating unit in which a free radical scavenging G-quadruplex / Hemin labeled with streptavidin SA and biotin is connected in series.

[0008] The repeating unit has the following structure:

[0009]

[0010] Among them, two functional sequences are located in the circular single-stranded region, 5'-GGACTGGTTCGTTGTAGCTAGCCTCCGAGGTT-3' is the complementary sequence SEQ NO.1 of the deoxyribozyme targeting C1q mRNA, 5'-CCCAACCCGCCCTACCCAAA-3' is the complementary sequence SEQ NO.1 of the G-quadruplex, and the hybridization sequence of the template and the primer is 5'-GTTGTAGCTAGCCTCCGA-3'SEQ NO.3.

[0011] The present invention also includes a method for preparing the multifunctional DNA nanomaterial, comprising the following steps: (1) template cyclization: using T4 DNA ligase to catalyze the ligation reaction of the annealed template Template to form a circular template; (2) polymerase amplification: reacting the biotin-labeled primer with the cyclized template to form a Primer-Template hybridization complex; then using Bst DNA polymerase to extend the primer to produce an amplification product SA-Bst; (3) purifying the amplification product to form a G-quadruplex structure; (4) preparing a complete nano drug: mixing the purified product with SA and incubating, mixing with Hemin, and culturing in the dark to obtain the multifunctional DNA nanomaterial SA-B / H.

[0012] The specific steps of step (1) are as follows: incubate the Template labeled with a 5'-terminal phosphate group in 0.5×T4 DNA ligation reaction buffer at 95°C for 5 minutes, and then slowly anneal to 4°C to form a secondary structure; use T4 DNA ligase to catalyze the ligation reaction of the annealed Template, and the reaction procedure is as follows: 100 μL of the system is reacted at 16°C for 16 hours and then inactivated at 65°C for 10 minutes to form a circular Template; wherein the 100 μL system contains 1 μM Template, 3 μL T4 DNA ligase and 1×T4 ligation reaction buffer; the Template sequence SEQ NO.4 is 5'-TAGGGTTAGGGAAAGGACTGGTTCGTTGTAGCTAGCCTCCGAGGTTAAACCCTAACCCTAACCCTAACCCTAAACCCAACCCGCCCTACCCAAAAGGGTTAGGGT-3', which contains a 5'-terminal phosphate group label.

[0013] The specific steps of step (2) are as follows: reacting the Biotin-labeled Primer with the circularized Template in a PCR instrument at 37° C. for 1 hour to form a Primer-Template hybrid complex; then using Bst DNA polymerase to perform a primer extension experiment, the reaction procedure is as follows: 40 μL of the system is reacted at 65° C. for 3 hours and then inactivated at 85° C. for 20 minutes to produce an amplification product, the 40 μL system includes 0.5 μM Primer-Template hybrid complex, 500 μM dNTP, 2 μL Bst DNA polymerase and 1×ThermoPol reaction buffer; wherein the primer Primer sequence SEQ NO.5 is 5'-TCGGAGGCTAGCTACAAC-3', containing a 5'Biotin label.

[0014] The specific steps of step (3) are as follows: add 1 / 10 volume of 3M NaCl solution to the amplified product, mix thoroughly and let stand at 4°C for 10 minutes to achieve electrostatic shielding of DNA; then add 3 times volume of -20°C pre-cooled anhydrous ethanol to the above solution, mix thoroughly and let stand at -20°C for 3 hours, and then centrifuge at 12000g for 20 minutes; take the precipitate and resuspend it in PBS solution, then incubate at 95°C for 5 minutes in a PCR instrument and then slowly anneal to 4°C; finally, place in a 4°C refrigerator to form a G-quadruplex structure; the PBS solution includes 8mM Na 2 HPO 4 , 136 mM NaCl, 2 mM K 2 HPO 4 , 2.6 mM KCl and 1.5 mM MgCl 2 .

[0015] The specific steps of step (4) are as follows: SA and the purified product labeled with Biotin are mixed in a molar ratio of 1:4, and then incubated in a metal bath at 30°C and 300 rpm for 1.5 hours; a concentrated Hemin solution is prepared using cell culture grade DMSO, and then diluted to 10 mM with PBS; the Primer and Hemin concentration ratio is 1:250, and then rotated and cultured at room temperature in the dark for 4 hours; finally, filtered using a 0.22 μm filter membrane.

[0016] The particle size of the DNA nanomaterial SA-Bst after the amplification product in step (2) is 37.6 to 49.2 nm; the particle size of SA-B / H in step (4) is 47.5 to 66.1 nm.

[0017] The present invention also includes an application of the multifunctional DNA nanomaterial, which is applied to the preparation of a medicine for treating cerebral edema secondary to traumatic brain injury.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) Innovation: Based on bioinformatics methods, a DNAzyme for silencing the mouse C1q gene was designed, which can knock down the overexpressed C1q gene in the inflammatory model to a near normal level. The self-assembled nanomaterial SA-B / H mediated by RCA technology has excellent enzyme-like activity and can effectively remove H 2 O 2 and O 2 · - It can remove free radicals and has the potential of antioxidant in the body.

[0020] (2) High efficiency: In vitro experiments have confirmed that SA-B / H is effective in relieving H 2 O 2 At the same time, SA-B / H can effectively reduce the expression of intracellular C1q gene, relieve the inflammatory stress caused by LPS stimulation, and has a good neuroprotective effect.

[0021] (3) Biosafety: In vivo experiments have shown that SA-B / H has good biosafety and can alleviate secondary injury of TBI at the organ tissue, cell and molecular levels. SA-B / H can alleviate brain edema and cerebral blood flow hypoperfusion secondary to TBI and improve motor, memory and cognitive dysfunction by reducing ROS levels, reducing the recruitment of inflammatory cells at the injury site and inhibiting the production of inflammatory factors.

[0022] In addition, the broad-spectrum gene silencing strategy based on 10-23 DNAzyme proposed in the present invention has not only been successfully applied to the targeted knockdown of C1q, a key gene for secondary injury in TBI, but also provides a general design idea for silencing other pathogenic genes. The multifunctional DNA nanomaterials constructed by this study with the help of RCA technology are equipped with functional nucleic acid fragments with excellent gene silencing and ROS scavenging effects, and have achieved good therapeutic effects in alleviating brain tissue dysfunction in TBI mouse models, which is expected to further promote the practical application of DNA nanomaterials as new DNA drugs in neurological diseases and other diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings:

[0024] Figure 1 Schematic diagram of the synthesis route of SA-B / H prepared in the present invention;

[0025] Figure 2 A diagram showing the synthesis process of SA-B / H prepared in the present invention by agarose gel electrophoresis analysis;

[0026] Figure 3 The dynamic light scattering analysis particle size diagram of SA-B / H prepared in the present invention;

[0027] Figure 4 The G-quadruplex structure diagram of SA-B / H prepared in the present invention is analyzed by circular dichroism spectrum;

[0028] Figure 5 This is an investigation of the in vitro enzyme-like activity of SA-B / H prepared in the present invention, i.e., a schematic diagram of SA-B / H clearing ROS. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and the best embodiments.

[0030] The purpose of the present invention is to provide a multifunctional DNA nanomaterial for treating brain edema secondary to traumatic brain injury and its application method. The present invention intends to use bioinformatics methods to predict the dominant cleavage site of DNAzyme on C1q mRNA, and based on this, construct a universal design strategy for 10-23 type DNAzyme, and will use silencing of TBI novel target C1q gene and scavenging free radicals as the treatment mechanism to prepare a multifunctional DNA nanomaterial SA-B / H enriched in C1q mRNA specific DNAzyme and G-quadruplex / Hemin. This multifunctional DNA nanomaterial SA-B / H with excellent anti-oxidative stress performance and high efficiency in inhibiting neuroinflammation can effectively alleviate brain tissue trauma secondary to TBI, improve neurological dysfunction, and has excellent anti-oxidative stress and neuroinflammation potential, broadening the application of DNA nanomaterials in the treatment of TBI and providing new ideas for the treatment of other neurological diseases.

[0031] Specifically, the particle size of the DNA nanomaterial SA-Bst after amplification is 37.6-49.2 nm; the particle size of the complete structure SA-B / H formed after incubation with Hemin is 47.5-66.1 nm.

[0032] In order to obtain the best assay performance, the inventors evaluated the in vitro anti-oxidative stress and neuroinflammation potential of SA-B / H through experiments such as reaction condition optimization, technical route characterization, enzyme activity detection, intracellular ROS scavenging ability, and improvement of neurological function and exercise fatigue. And determined its therapeutic effect, and finally proved that the multifunctional DNA nanomaterial SA-B / H has excellent therapeutic effect, verifying its practicality and safety.

[0033] The working principle of the multifunctional DNA nanomaterial SA-B / H is as follows: the multifunctional DNA nanomaterial SA-B / H containing DNAzyme targeting C1qmRNA and G-quadruplex / Hemin repeating units for scavenging free radicals was prepared by RCA technology. Firstly, G-quadruplex / Hemin is the most common peroxidase-type DNAzyme, and its pseudo-enzyme activity comes from Hemin, mainly including peroxidase (POD), catalase (CAT) and superoxide dismutase (SOD)-like activities, which can effectively scavenge H 2 O 2 and O 2 · -Free radicals such as scavenger and scavenger. Secondly, the RNA-cutting DNAzyme targets specific silencing genes. In the presence of metal ions, its cutting activity is activated and it specifically cuts mRNA at the predetermined phosphodiester bond, which has the advantages of higher stability, lower cost and simpler synthetic modification process. Both are amplified by rolling circle amplification, which is an isothermal amplification reaction catalyzed by a DNA polymerase with chain displacement activity. After the primer matches the circular template, it extends along the ring under the action of DNA polymerase and continuously replaces the previously generated extended chain, eventually producing repeated long single-stranded DNA products.

[0034] The method for preparing the multifunctional DNA nanomaterial SA-B / H comprises:

[0035] (1) Template cyclization experiment. The 5'-terminal phosphate-labeled Template was incubated in 0.5×T4 DNA ligation buffer at 95°C for 5 min, and then slowly annealed to 4°C to form a secondary structure. T4 DNA ligase was used to catalyze the ligation reaction of the annealed Template. The reaction procedure was as follows: 100 μL of the system (1 μM Template, 3 μL T4 DNA ligase and 1×T4 ligation buffer) was reacted at 16°C for 16 h and then inactivated at 65°C for 10 min to form a circular Template.

[0036] (2) Polymerase amplification experiment. The Biotin-labeled Primer and the circularized Template were reacted in a PCR instrument at 37°C for 1 hour to form a Primer-Template hybridization complex. Subsequently, a primer extension experiment was performed using Bst DNA polymerase. The reaction procedure was as follows: 40 μL of the system (0.5 μM Primer-Template hybridization complex, 500 μM dNTP, 2 μL Bst DNA polymerase and 1× ThermoPol reaction buffer) was reacted at 65°C for 3 hours and then inactivated at 85°C for 20 minutes to produce an amplification product.

[0037] (3) Purification of amplified products. Add 1 / 10 volume of 3M NaCl solution to the amplified product, mix thoroughly and let stand at 4°C for 10 min to achieve electrostatic shielding of DNA. Then add 3 times volume of -20°C precooled anhydrous ethanol to the above solution, mix thoroughly and let stand at -20°C for 3 h, then centrifuge at 12000g for 20 min. Take the precipitate and resuspend it in PBS solution (8mM Na 2 HPO 4 , 136 mM NaCl, 2 mM K 2 HPO 4 , 2.6 mM KCl and 1.5 mM MgCl 2), then incubate at 95°C for 5 min in a PCR instrument and slowly anneal to 4°C. Finally, place in a 4°C refrigerator for several days to form a G-quadruplex structure.

[0038] (4) Complete nanodrug preparation experiment. SA and Biotin-labeled purified products were mixed in a molar ratio of 1:4, and then incubated in a metal bath at 30°C and 300 rpm for 1.5 h. Hemin concentrated solution was prepared using cell culture grade DMSO and diluted to 10 mM with PBS. Primer and Hemin were mixed at a ratio of 1:250, and then rotated and incubated at room temperature in the dark for 4 h. Finally, a 0.22 μm filter was used.

[0039] The experimental reagents used in the present invention are all commercially available without further processing, and the detection instruments and equipment are all commonly used instruments.

[0040] Unless otherwise specified, all solution concentrations in this article are volume concentrations.

[0041] Example 1: Synthesis and characterization of multifunctional DNA nanomaterial SA-B / H

[0042] Combination Figure 1 This example provides a synthetic route for the multifunctional DNA nanomaterial SA-B / H, comprising the following steps:

[0043] (1) The annealed template was ligated using T4 DNA ligase, hybridized with the Biotin-labeled Primer to form a Primer-Template hybrid complex, and mixed with SA at a molar ratio of 1:4, and incubated in a metal bath at 30°C and 300 rpm for 1.5 h.

[0044] (2) The product was mixed at a ratio of 1:250 between Primer and Hemin, and incubated with rotation at room temperature in the dark for 4 h. Filtered with a 0.22 μm filter membrane, the multifunctional DNA nanomaterial SA-B / H was obtained.

[0045] Combination Figure 2 , this example gives the characterization of the multifunctional DNA nanomaterial SA-B / H:

[0046] (1) Perform electrophoresis using 3% agarose gel or 16% PAGE at 120 V, and then photograph the results using the cy3 channel of the Azurec600 gel imager. The position of the band is positively correlated with the molecular weight.

[0047] See Figure 2 , the band position of each nucleic acid structure during the SA-B / H synthesis process was observed using agarose gel electrophoresis, indicating that the assembly process of DNA nanomaterials can proceed smoothly.

[0048] (2) SA, SA-Bst, and SA-B / H were placed in different micro-sample cells, and the particle size was measured using a nanoparticle size analyzer and a Zeta potential analyzer. Each sample was tested four times and the average value was taken.

[0049] See Figure 3 DLS measured the hydrated particle size of the nanomaterials. The particle size of the SA-linked amplified product was 43.4±5.8nm, which was significantly increased compared to SA (5.6±0.4nm). The particle size of the complete structure SA-B / H formed after incubation with Hemin was 56.8±9.3nm, which was significantly smaller than DNA nanoflowers and other DNA nanomaterials constructed based on nucleic acid amplification technology.

[0050] (3) Place G-DNA (G-quadruplex), NonG-DNA (non-G-quadruplex) and RCA product in quartz micro-cuvettes with a 1 mm optical path. Adjust the instrument parameters: starting wavelength 210 nm, end wavelength 310 nm, scanning frequency 100 nm / min, temperature 25 °C. Repeat scanning 3 times for each sample to obtain the average value and deduct the baseline level. Figure 4 The formation of G-quadruplex structure in the amplified product was verified by CD. The negative peak near 240nm and the positive peak near 260nm are typical CD characteristics of parallel G-quadruplex topology. Parallel G-quadruplex structure was observed in G-quadruplex-containing DNA strands (G-DNA) and RCA products. Due to the adjustment of the spatial structure of G-quadruplex in RCA products, its positive peak moved to the right to around 280nm.

[0051] Example 2: In vitro enzyme activity assay of multifunctional DNA nanomaterial SA-B / H

[0052] Combination Figure 5 This example provides an exploration of the pseudoenzyme activity of the multifunctional DNA nanomaterial SA-B / H: As the "pseudoenzyme activity center" of SA-B / H, Hemin itself has POD-like activity and can effectively remove H 2 O 2 and O 2 ·- and other free radicals, which determines that SA-B / H will also be endowed with a variety of pseudo-enzyme activities. The absorbance of TMB oxidation products at 652nm was measured using a multifunctional microplate reader. 200μL of colorimetric solution (110μL TMB solution + 40μL 1M H 2 O 2 ), Hemin, G4 / Hemin and SA-B / H were added to the experimental groups, and 6 wells were repeated in each group. The cells were shaken for 10 seconds before the test, and the cells were measured every 2 minutes for a total of 26 minutes.

[0053] See Figure 5 , using TMB colorimetric solution and H 2 O 2 As a substrate, the POD-like activity of SA-B / H was explored by measuring the absorbance of TMB oxidation products at 652 nm. The catalytic rate of SA-B / H was significantly higher than that of other groups, and when Hemin was in excess, SA-B / H showed POD-like activity superior to that of G-quadruplex / Hemin.

[0054] In summary, the present invention has:

[0055] (1) Innovation: Based on bioinformatics methods, a DNAzyme for silencing the mouse C1q gene was designed, which can knock down the overexpressed C1q gene in the inflammatory model to a near normal level. The self-assembled nanomaterial SA-B / H mediated by RCA technology has excellent enzyme-like activity and can effectively remove H 2 O 2 and O 2 · - It can remove free radicals and has the potential of antioxidant in the body.

[0056] (2) High efficiency: In vitro experiments have confirmed that SA-B / H is effective in relieving H 2 O 2 At the same time, SA-B / H can effectively reduce the expression of intracellular C1q gene, relieve the inflammatory stress caused by LPS stimulation, and has a good neuroprotective effect.

[0057] (3) Biosafety: In vivo experiments have shown that SA-B / H has good biosafety and can alleviate secondary injury of TBI at the organ tissue, cell and molecular levels. SA-B / H can alleviate brain edema and cerebral blood flow hypoperfusion secondary to TBI and improve motor, memory and cognitive dysfunction by reducing ROS levels, reducing the recruitment of inflammatory cells at the injury site and inhibiting the production of inflammatory factors.

[0058] In addition, the broad-spectrum gene silencing strategy based on 10-23 DNAzyme proposed in the present invention has not only been successfully applied to the targeted knockdown of C1q, a key gene for secondary injury in TBI, but also provides a general design idea for silencing other pathogenic genes. The multifunctional DNA nanomaterials constructed by this study with the help of RCA technology are equipped with functional nucleic acid fragments with excellent gene silencing and ROS scavenging effects, and have achieved good therapeutic effects in alleviating brain tissue dysfunction in TBI mouse models, which is expected to further promote the practical application of DNA nanomaterials as new DNA drugs in neurological diseases and other diseases.

[0059] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A multifunctional DNA nanomaterial, characterized in that: The invention comprises a plurality of DNAzymes targeting C1q mRNA and a repeating unit in which a G-quadruplex / Hemin for scavenging free radicals labeled with streptavidin SA and biotin is connected in series.

2. The multifunctional DNA nanomaterial according to claim, characterized in that: The repeating unit has the following structure: Among them, two functional sequences are located in the circular single-stranded region, 5'-GGACTGGTTCGTTGTAGCTAGCCTCCGAGGTT-3' is the complementary sequence SEQ NO.1 of the deoxyribozyme targeting C1q mRNA, 5'-CCCAACCCGCCCTACCCAAA-3' is the complementary sequence SEQ NO.1 of the G-quadruplex, and the hybridization sequence of the template and the primer is 5'-GTTGTAGCTAGCCTCCGA-3'SEQNO.

3.

3. A method for preparing the multifunctional DNA nanomaterial according to claim 1 or 2, characterized in that: The method comprises the following steps: (1) template cyclization: using T4 DNA ligase to catalyze the ligation reaction of the annealed template to form a circular template; (2) polymerase amplification: reacting the biotin-labeled primer with the cyclized template to form a Primer-Template hybridization complex; then using Bst DNA polymerase to extend the primer to produce an amplified product SA-Bst; (3) purifying the amplified product to form a G-quadruplex structure; (4) preparing a complete nano drug: mixing the purified product with SA and then incubating the mixture, mixing it with Hemin, and culturing it in the dark to obtain a multifunctional DNA nanomaterial SA-B / H.

4. The preparation method according to claim 3, characterized in that: The specific steps of step (1) are as follows: incubate the 5'-terminal phosphate-labeled Template in 0.5×T4 DNA ligation reaction buffer at 95°C for 5 minutes, and then slowly anneal to 4°C to form a secondary structure; use T4 DNA ligase to catalyze the ligation reaction of the annealed Template, and the reaction procedure is as follows: 100 μL of the system is reacted at 16°C for 16 hours and then inactivated at 65°C for 10 minutes to form a circular Template; wherein the 100 μL system contains 1 μM Template, 3 μM T4 DNA ligase and 1×T4 ligation reaction buffer; the Template sequence SEQ NO.4 is 5'-TAGGGTTAGGGAAAGGACTGGTTCGTTGTAGCTAGCCTCCGAGGTTAAACCCTAACCCTAACCCTAA CCCTAAACCCAACCCGCCCTACCCAAAAGGGTTAGGGT-3', which contains a 5'-terminal phosphate label.

5. The preparation method according to claim 3, characterized in that: The specific steps of step (2) are as follows: reacting the Biotin-labeled Primer with the circularized Template in a PCR instrument at 37° C. for 1 hour to form a Primer-Template hybrid complex; then using Bst DNA polymerase to perform a primer extension experiment, the reaction procedure is as follows: 40 μL of the system is reacted at 65° C. for 3 hours and then inactivated at 85° C. for 20 minutes to produce an amplification product, the 40 μL system includes 0.5 μM Primer-Template hybrid complex, 500 μM dNTP, 2 μL Bst DNA polymerase and 1×ThermoPol reaction buffer; wherein the primer Primer sequence SEQ NO.5 is 5'-TCGGAGGCTAGCTACAAC-3', containing a 5'Biotin label.

6. The preparation method according to claim 3, characterized in that: The specific steps of step (3) are as follows: add 1 / 10 volume of 3M NaCl solution to the amplified product, mix thoroughly and let stand at 4°C for 10 minutes to achieve electrostatic shielding of DNA; then add 3 times volume of -20°C pre-cooled anhydrous ethanol to the above solution, mix thoroughly and let stand at -20°C for 3 hours, and then centrifuge at 12000g for 20 minutes; take the precipitate and resuspend it in PBS solution, then incubate at 95°C for 5 minutes in a PCR instrument and then slowly anneal to 4°C; finally place in a 4°C refrigerator to form a G-quadruplex structure; the PBS solution includes 8mM Na2HPO4, 136mM NaCl, 2mM K2HPO4, 2.6mM KCl and 1.5mM MgCl2.

7. The preparation method according to claim 3, characterized in that: The specific steps of step (4) are as follows: SA and the purified product labeled with Biotin are mixed in a molar ratio of 1:4, and then incubated in a metal bath at 30°C and 300 rpm for 1.5 hours; a concentrated Hemin solution is prepared using cell culture grade DMSO, and then diluted to 10 mM with PBS; the Primer and Hemin concentration ratio is 1:250, and then rotated and cultured at room temperature in the dark for 4 hours; finally, filtered using a 0.22 μm filter membrane.

8. The preparation method according to claim 3, characterized in that: The particle size of the DNA nanomaterial SA-Bst after the amplification product in step (2) is 37.6 to 49.2 nm; the particle size of SA-B / H in step (4) is 47.5 to 66.1 nm.

9. Use of the multifunctional DNA nanomaterial according to claim 1 or 2.

10. The use according to claim 9, characterized in that: It is used to prepare drugs for treating cerebral edema secondary to traumatic brain injury.

Images